CN116732205A - New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application - Google Patents
New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application Download PDFInfo
- Publication number
- CN116732205A CN116732205A CN202310630844.3A CN202310630844A CN116732205A CN 116732205 A CN116732205 A CN 116732205A CN 202310630844 A CN202310630844 A CN 202310630844A CN 116732205 A CN116732205 A CN 116732205A
- Authority
- CN
- China
- Prior art keywords
- primer
- lmtia
- malonate
- amplification
- cronobacter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- OFOBLEOULBTSOW-UHFFFAOYSA-L Malonate Chemical compound [O-]C(=O)CC([O-])=O OFOBLEOULBTSOW-UHFFFAOYSA-L 0.000 title claims abstract description 84
- 238000001514 detection method Methods 0.000 title claims abstract description 61
- 241000989055 Cronobacter Species 0.000 title claims description 50
- 230000003321 amplification Effects 0.000 claims abstract description 95
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 95
- 239000007795 chemical reaction product Substances 0.000 claims abstract description 52
- 238000006243 chemical reaction Methods 0.000 claims abstract description 47
- 239000002773 nucleotide Substances 0.000 claims description 36
- 125000003729 nucleotide group Chemical group 0.000 claims description 36
- 238000000034 method Methods 0.000 claims description 27
- 238000011144 upstream manufacturing Methods 0.000 claims description 26
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 11
- 239000011324 bead Substances 0.000 claims description 8
- 230000000295 complement effect Effects 0.000 claims description 8
- 230000035484 reaction time Effects 0.000 claims description 6
- 239000012154 double-distilled water Substances 0.000 claims description 5
- 150000003839 salts Chemical class 0.000 claims 1
- 241001135265 Cronobacter sakazakii Species 0.000 abstract description 15
- 108020004707 nucleic acids Proteins 0.000 abstract description 14
- 102000039446 nucleic acids Human genes 0.000 abstract description 14
- 150000007523 nucleic acids Chemical class 0.000 abstract description 14
- 238000013461 design Methods 0.000 abstract description 12
- 230000000694 effects Effects 0.000 abstract description 8
- 239000000758 substrate Substances 0.000 abstract 1
- 108020004414 DNA Proteins 0.000 description 48
- 238000005516 engineering process Methods 0.000 description 24
- 108090000623 proteins and genes Proteins 0.000 description 22
- 101150091444 ompR gene Proteins 0.000 description 12
- 239000000243 solution Substances 0.000 description 11
- 239000013256 coordination polymer Substances 0.000 description 8
- 241000894006 Bacteria Species 0.000 description 7
- 238000001962 electrophoresis Methods 0.000 description 7
- 238000002474 experimental method Methods 0.000 description 7
- 239000012634 fragment Substances 0.000 description 7
- 241000894007 species Species 0.000 description 7
- 230000000007 visual effect Effects 0.000 description 7
- 201000010099 disease Diseases 0.000 description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 230000008901 benefit Effects 0.000 description 5
- 241000989066 Cronobacter dublinensis Species 0.000 description 4
- 241000607142 Salmonella Species 0.000 description 4
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 238000012136 culture method Methods 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000005684 electric field Effects 0.000 description 4
- 235000013305 food Nutrition 0.000 description 4
- 235000013350 formula milk Nutrition 0.000 description 4
- 239000000499 gel Substances 0.000 description 4
- 238000002844 melting Methods 0.000 description 4
- 230000008018 melting Effects 0.000 description 4
- 230000035945 sensitivity Effects 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 108020004465 16S ribosomal RNA Proteins 0.000 description 3
- 102000053602 DNA Human genes 0.000 description 3
- 230000001580 bacterial effect Effects 0.000 description 3
- 238000011901 isothermal amplification Methods 0.000 description 3
- 235000012736 patent blue V Nutrition 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- 208000031729 Bacteremia Diseases 0.000 description 2
- 241000988642 Cronobacter turicensis Species 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- 241001360526 Escherichia coli ATCC 25922 Species 0.000 description 2
- 241000186779 Listeria monocytogenes Species 0.000 description 2
- 201000009906 Meningitis Diseases 0.000 description 2
- 206010051606 Necrotising colitis Diseases 0.000 description 2
- 241000209094 Oryza Species 0.000 description 2
- 235000007164 Oryza sativa Nutrition 0.000 description 2
- 241000588770 Proteus mirabilis Species 0.000 description 2
- 239000011543 agarose gel Substances 0.000 description 2
- 238000009835 boiling Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 239000003651 drinking water Substances 0.000 description 2
- 235000020188 drinking water Nutrition 0.000 description 2
- 238000005265 energy consumption Methods 0.000 description 2
- 235000013312 flour Nutrition 0.000 description 2
- 238000010438 heat treatment Methods 0.000 description 2
- 230000001900 immune effect Effects 0.000 description 2
- 238000010324 immunological assay Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 244000005700 microbiome Species 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 208000004995 necrotizing enterocolitis Diseases 0.000 description 2
- 201000006195 perinatal necrotizing enterocolitis Diseases 0.000 description 2
- 239000000843 powder Substances 0.000 description 2
- 235000009566 rice Nutrition 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 101150033897 sea gene Proteins 0.000 description 2
- 239000008223 sterile water Substances 0.000 description 2
- 235000013311 vegetables Nutrition 0.000 description 2
- 108020000946 Bacterial DNA Proteins 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 238000003287 bathing Methods 0.000 description 1
- 239000006227 byproduct Substances 0.000 description 1
- 230000008094 contradictory effect Effects 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 239000008367 deionised water Substances 0.000 description 1
- 229910021641 deionized water Inorganic materials 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000009792 diffusion process Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000013508 migration Methods 0.000 description 1
- 230000005012 migration Effects 0.000 description 1
- 230000003287 optical effect Effects 0.000 description 1
- 239000008188 pellet Substances 0.000 description 1
- 238000011056 performance test Methods 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000002864 sequence alignment Methods 0.000 description 1
- 238000001179 sorption measurement Methods 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000013518 transcription Methods 0.000 description 1
- 230000035897 transcription Effects 0.000 description 1
- 238000009281 ultraviolet germicidal irradiation Methods 0.000 description 1
- 238000012800 visualization Methods 0.000 description 1
- 238000007794 visualization technique Methods 0.000 description 1
- 101150075472 ycf27 gene Proteins 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a novel target for detecting clonobacter malonate, an LMTIA primer pair, a kit, a detection method and application, and belongs to the technical field of molecular biology application. The invention provides a new target for detecting Cronobacter sakazakii, which is used for designing LMTIA primers, carrying out LMTIA amplification reaction by taking sample DNA as a substrate, and judging whether positive amplification exists in a DNA sample in a reaction product after amplification for a period of time under the condition of constant temperature. The novel target of the clonobacter malonate provided by the invention has high specificity. The detection method for detecting the clonobacter malonate has the technical effects of simple primer design, simple equipment requirement and high nucleic acid target specificity.
Description
Technical Field
The invention relates to the technical field of molecular biology application, in particular to a novel target for detecting clonobacter malonate, an LMTIA primer pair, a kit, a detection method and application.
Background
Cronobacter (Cronobacter spp.) is widely present in infant milk powder rice flour, meat, drinking water and vegetables, and can cause bacteremia, meningitis, necrotizing enterocolitis and other diseases. The genus cronobacter comprises 7 species: cronobacter sakazakii (c.sakazakii), cronobacter malonate (c.malonatics), cronobacter Mo Jinsi (c.muytjini), cronobacter zurich (c.turicensis), cronobacter Kang Dimeng (c.condition), cronobacter You Niwo (c.unisails) and cronobacter dublinensis (c.dublinensis). 7 species of Cronobacter can cause human disease, and Cronobacter malonate is the second only disease causing species of Cronobacter sakazakii.
The current methods for detecting the clonobacter malonate in food mainly comprise a traditional microorganism culture method, an immunological detection method and a molecular biological detection method. The traditional detection method is based on a plate counting method, the detection period is generally 5-7 days, the labor capacity is large, the specificity is low, and the detection false positive is easy to cause. Immunological assays generally require relatively expensive equipment and long detection times, which do not meet the requirements for rapid detection. Compared with the traditional culture method, the detection method developed based on the nucleic acid technology is becoming a hot spot for rapidly detecting the bacteria, and finding out the specific nucleic acid target of the clonobacter malonate is the core of the development of the related detection technology.
At present, the detection of Cronobacter malonate mainly uses 16SrRNA gene as a target, but the specificity of the 16SrRNA is not high, so that the development of a novel detection target with strong specificity is urgently needed. The related genes aiming at the detection of the nucleic acid of the clonorbacterium malonate are small in quantity and weak in specificity, and cannot be effectively distinguished from other strains of the genus clonorbacterium and some bacteria with relatively close relativity. Therefore, the screening of the novel nucleic acid target with high specificity and the establishment of the method for detecting the clonobacter malonate with strong specificity and less false positive have great significance for guaranteeing the safety of infant formulas. The current molecular biological detection method for detecting the clonobacter malonate in food is mainly a PCR technology and an LAMP technology. However, the PCR technology requires three temperature cycles, and the temperature control of an amplification instrument is not easy to realize, so that the instrument based on the PCR technology is complex and expensive, and the heating energy consumption is high; in the LAMP technology, 6 primers are generally required to be relatively long, the design difficulty of the primers is high, and the cost of the reagents is correspondingly high. Therefore, the problems of complex primer design, complex instrument and equipment and low nucleic acid target specificity of the detection method of the clonobacter malonate are needed to be solved.
Disclosure of Invention
The invention mainly aims to provide a novel target for detecting the clonobacter malonate, an LMTIA primer pair, a kit and a detection method and application thereof, and aims to solve the problems that the primer design of the clonobacter malonate detection method is complex, the instrument and equipment are complex and the specificity of a nucleic acid target is not high.
In order to achieve the aim, the invention provides a novel target for detecting the clonobacter malonate, and the nucleotide sequence of the novel target is shown as SEQ ID NO. 1.
The invention also provides an LMTIA primer pair for detecting the clonobacter malonate, which is designed by a new target based on the clonobacter malonate, and comprises the following steps:
an upstream primer ompR-P, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;
and a downstream primer ompR-D, wherein the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
Optionally, the upstream primer ompR-P comprises primer P1 and primer P2;
the downstream primer ompR-D comprises a primer D1 and a primer D2;
wherein the primer P1 and the primer D2 are complementary to the negative strand of the new target nucleotide sequence, and the primer P2 and the primer D1 are complementary to the positive strand of the new target nucleotide sequence;
the nucleotide sequence of the primer P1 is shown as SEQ ID NO. 4;
the nucleotide sequence of the primer P2 is shown as SEQ ID NO. 5;
the nucleotide sequence of the primer D1 is shown as SEQ ID NO. 6;
the nucleotide sequence of the primer D2 is shown as SEQ ID NO. 7.
The invention also provides a detection method of the clonobacter malonate, which comprises the following steps:
obtaining a DNA sample to be detected;
carrying out LMTIA amplification reaction on the obtained DNA sample by using the LMTIA primer pair to obtain an amplification reaction product;
obtaining a characteristic value of an amplification reaction product;
judging whether positive amplification exists in the DNA sample to be detected according to the characteristic value of the amplification reaction product.
Optionally, the step of determining whether a positive amplification is present in the DNA sample in the reaction product based on the characteristic value of the amplification reaction product comprises:
obtaining the color of the amplification reaction product;
if the color of the reaction product is blue, judging that the DNA sample to be detected has positive amplification.
Optionally, the step of determining whether a positive amplification is present in the DNA sample in the reaction product based on the characteristic value of the amplification reaction product comprises:
obtaining an agarose gel electrophoresis detection result of an amplification reaction product;
if the agarose gel electrophoresis detection result of the amplification reaction product is that the trapezoidal band exists, judging that the DNA sample to be detected has positive amplification.
Optionally, the LMTIA reaction system includes:
1/2 Bst 4.0HNB Bead;
1. Mu.L of the upstream primer ompR-P;
1. Mu.L of the downstream primer ompR-D;
1. Mu.L of template DNA;
22. Mu.L of ddH2O.
Alternatively, the concentration of the upstream primer ompR-P is 10 mM/. Mu.L; and/or the number of the groups of groups,
the concentration of the downstream primer ompR-P is 10 mM/. Mu.L; and/or the number of the groups of groups,
the reaction temperature of the LMTIA reaction is 60-70 ℃; and/or the number of the groups of groups,
the reaction time is 30-50 min.
The invention also provides a kit for detecting the clonobacter malonate, which comprises the LMTIA primer pair. The LMTIA primer pair is designed based on the novel target and comprises the following components:
an upstream primer ompR-P, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;
and a downstream primer ompR-D, wherein the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The invention also provides application of the LMTIA primer pair in detection of the clonobacter malonate for non-diagnostic purposes. The LMTIA primer pair is designed based on the novel target and comprises the following components:
an upstream primer ompR-P, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2;
and a downstream primer ompR-D, wherein the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
The invention uses the malonate Cronobacter cloacae to adopt ompR gene as a highly matched LMTIA primer pair designed for detecting a new target, uses the LMTIA primer pair to carry out LMTIA amplification reaction on the obtained DNA sample, obtains the characteristic value of an amplification reaction product and judges whether the DNA sample to be detected has positive amplification according to the characteristic value of the amplification reaction product. Because the ompR gene has stronger specificity, the method has the effect of strong specificity when the LMTIA amplification technology is adopted to detect the clonobacter malonate, and meanwhile, the LMTIA amplification technology is adopted during detection, so that the primer design is simple, the equipment requirement is simple, and the visual observation of the amplification result can be realized. Therefore, the detection method of the clonobacter malonate provided by the invention has the technical effects of simple primer design, simple equipment requirement and high nucleic acid target specificity.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to the structures shown in these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a schematic diagram showing sequence homology comparison of the NCBI database of the present invention's cloacae malonate ompR gene;
FIG. 2 is a schematic diagram showing sequence homology comparison of NCBI database of Cronobacter malonate 16SrRNA gene of the present invention;
FIG. 3 is a schematic representation of the position of the LMTIA primer pair of the present invention relative to a target sequence;
FIG. 4 is a graph showing the results of a sensitivity test for detecting Cronobacter malonate by using an LMTIA amplification reaction according to the present invention;
FIG. 5 is a graph showing the results of a specific experiment for detecting Cronobacter malonate by using an LMTIA amplification reaction according to the present invention;
FIG. 6 is a graph showing the results of a specific experiment using the visualization method for detecting Cronobacter malonate by using the LMTIA amplification reaction of the present invention.
The achievement of the objects, functional features and advantages of the present invention will be further described with reference to the accompanying drawings, in conjunction with the embodiments.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention. In addition, the meaning of "and/or" as it appears throughout includes three parallel schemes, for example "A and/or B", including the A scheme, or the B scheme, or the scheme where A and B are satisfied simultaneously. In addition, the technical solutions of the embodiments may be combined with each other, but it is necessary to base that the technical solutions can be realized by those skilled in the art, and when the technical solutions are contradictory or cannot be realized, the combination of the technical solutions should be regarded as not exist and not within the protection scope of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Cronobacter (Cronobacter spp.) is widely present in infant milk powder rice flour, meat, drinking water and vegetables, and can cause bacteremia, meningitis, necrotizing enterocolitis and other diseases. The genus cronobacter comprises 7 species: cronobacter sakazakii (c.sakazakii), cronobacter malonate (c.malonatics), cronobacter Mo Jinsi (c.muytjini), cronobacter zurich (c.turicensis), cronobacter Kang Dimeng (c.condition), cronobacter You Niwo (c.unisails) and cronobacter dublinensis (c.dublinensis). 7 species of Cronobacter can cause human disease, and Cronobacter malonate is the second only disease causing species of Cronobacter sakazakii.
The current methods for detecting the clonobacter malonate in food mainly comprise a traditional microorganism culture method, an immunological detection method and a molecular biological detection method. The traditional detection method is based on a plate counting method, the detection period is generally 5-7 days, the labor capacity is large, the specificity is low, and the detection false positive is easy to cause. Immunological assays generally require relatively expensive equipment and long detection times, which do not meet the requirements for rapid detection. Compared with the traditional culture method, the detection method developed based on the nucleic acid technology is becoming a hot spot for rapidly detecting the bacteria, and finding out the specific nucleic acid target of the clonobacter malonate is the core of the development of the related detection technology.
At present, the detection of Cronobacter malonate mainly uses 16SrRNA gene as a target, but the specificity of the 16SrRNA is not high, so that the development of a novel detection target with strong specificity is urgently needed. The related genes aiming at the detection of the nucleic acid of the clonorbacterium malonate are small in quantity and weak in specificity, and cannot be effectively distinguished from other strains of the genus clonorbacterium and some bacteria with relatively close relativity. Therefore, the screening of the novel nucleic acid target with high specificity and the establishment of the method for detecting the clonobacter malonate with strong specificity and less false positive have great significance for guaranteeing the safety of infant formulas.
The current molecular biological detection method for detecting the clonobacter malonate in food is mainly a PCR technology and an LAMP technology. However, the PCR technology requires three temperature cycles, and the temperature control of an amplification instrument is not easy to realize, so that the instrument based on the PCR technology is complex and expensive, and the heating energy consumption is high; in the LAMP technology, 6 primers are generally required to be relatively long, the design difficulty of the primers is high, and the cost of the reagents is correspondingly high. Therefore, the problems of complex primer design, complex instrument and equipment and low specificity of the detection method of the clonobacter malonate are needed to be solved.
In view of the above, the invention provides a novel target for detecting the clonobacter malonate, wherein the nucleotide sequence of the novel target is shown as SEQ ID NO. 1. The method comprises the following steps:
CCCATTGATATTACCCCGCCGACAATTACTTGTTCTTGAGGCTCTCT GTACCCGCGCGCGCCGCACCGTTCAGCGTGAATGGTTAACAGAATGCG TGTACGGTTTCAGTGAAGAAATTCAGTCTAACTCTC。
the non-homologous gene fragment between the two homologous segments was found by BLAST method for the gene sequence alignment (https:// blast.ncbi.nlm.nih.gov/blast.cgi) of Cronobacter sakazakii JXES-28 (NCBI accession number: CP 098777.1) with Cronobacter malonate LMG23826 (NCBI accession number: CP 013940.1). The gene of Cronobacter malonate LMG23826 was annotated by RAST, the annotation form was analyzed, the repetitive sequence and the hypothetical protein gene were deleted, and the functional gene located in the non-homologous segment was selected. And respectively carrying out highest and lowest similarity comparison on the functional gene sequences through NCBI database, verifying whether the gene is a gene special for the cloacae malonate, and selecting a gene with better specificity as an alternative target gene.
The method screens out the clonobacter malonate to detect a new target ompR gene. The gene is a bi-component transcription reaction regulator. The ompR gene and the 16S rRNA gene of cronobacter malonate LMG23826 were respectively input into NCBI data for blast comparison.
Referring to FIG. 1, ompR genes were aligned in NCBI database to 2 similar sequences, 2 of which were Cronobacter malonate strains, with sequence coverage and similarity all around 100%.
Referring to FIG. 2, the 16S rRNA genes are aligned in NCBI database to multiple highly similar sequences, wherein the first two gene sequences are derived from Cronobacter malonate, and the sequence coverage and similarity are about 100%. The latter sequences were derived from Cronobacter sakazakii, with sequence coverage up to 100% and similarity up to about 99.9%. Compared with the 16S rRNA gene, the ompR gene belongs to a gene special for malonate, so that the method has excellent specificity in identifying and distinguishing the malonate Cronobacter cloacae.
The LMTIA target sequence requires that the melting temperature curve of the sequence be trapezoidal and that the GC content of the sequence be generally 40-80%, then the sequence is highly specific. Using Oligo7 to select a nucleotide sequence meeting the above requirement from ompR gene of clonobacter malonate LMG23826 as a target sequence, wherein the nucleotide sequence of the target is:
CCCATTGATATTACCCCGCCGACAATTACTTGTTCTTGAGGCTCTCT GTACCCGCGCGCGCCGCACCGTTCAGCGTGAATGGTTAACAGAATGCG TGTACGGTTTCAGTGAAGAAATTCAGTCTAACTCTC。
the invention also provides an LMTIA primer pair for detecting the clonobacter malonate, which is designed by a new target based on the clonobacter malonate, and comprises the following steps:
an upstream primer ompR-P, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and specifically comprises the following components: GCGGGTACAGAGTTTTTTACCCCGCCGACAATTACT;
the nucleotide sequence of the downstream primer ompR-D is shown as SEQ ID NO.3, and specifically comprises the following steps: GCGGGTACAGAGTTTTTTACCCCGCCGACAATTACT.
The nucleotide sequence of the new target was designed by on-line software Primer3Plus (https:// dev. Primer3Plus. Com /), and the LMTIA Primer pair was also highly specific for Cronobacter malonate due to the highly specific target gene.
Further, the upstream primer ompR-P comprises a primer P1 and a primer P2;
the downstream primer ompR-D comprises a primer D1 and a primer D2;
wherein the primer P1 and the primer D2 are complementary to the negative strand of the new target nucleotide sequence, and the primer P2 and the primer D1 are complementary to the positive strand of the new target nucleotide sequence.
The nucleotide sequence of the primer P1 is shown as SEQ ID NO.4, and specifically comprises the following steps:
TTACCCCGCCGACAATTACT；
the nucleotide sequence of the primer P2 is shown as SEQ ID NO.5, and specifically comprises the following steps:
GCGGGTACAGAG；
the nucleotide sequence of the primer D1 is shown as SEQ ID NO.6, and specifically comprises the following steps:
CACTGAAACCGTACACGCA；
the nucleotide sequence of the primer D2 is shown as SEQ ID NO.7, and specifically comprises the following steps:
GCCGCACCGTTC。
referring to FIG. 3, two pairs of nested primers are designed based on the selected target sequence, wherein primer P1 and primer D2 are complementary to the negative strand of the target sequence, and primer P2 and primer D1 are complementary to the positive strand of the target sequence. The primer P2 and the primer P1 are connected by-TTTT-to form an upstream primer ompR-P, and the nucleotide sequence of the upstream primer is as follows: GCGGGTACAGAGTTTTTTACCCCGCCGACAATTACT; primer D2 and primer D1 are connected by-TTTT-to form a downstream primer ompR-D, and the nucleotide sequence of the downstream primer is as follows: GCCGCACCGTTCTTTTCACTGAAACCGTACACGCA. In order to realize specific amplification, the LMTIA adopts the method that 2 primers are respectively linked by TTTT, firstly, the primers can be combined with a template better, and secondly, the difference of Tm values of an upstream primer pair and a downstream primer pair and template DNA is increased, so that isothermal amplification reaction can be realized by taking double-stranded DNA as a template and single-stranded DNA as a template.
The invention also provides a detection method of the clonobacter malonate, which comprises the following steps:
obtaining a DNA sample to be detected;
carrying out LMTIA amplification reaction on the obtained DNA sample by using the LMTIA primer pair to obtain an amplification reaction product;
obtaining a characteristic value of an amplification reaction product;
judging whether positive amplification exists in the DNA sample to be detected according to the characteristic value of the amplification reaction product.
The LMTIA technology, i.e. ladder-type melting temperature isothermal amplification (ladder-type melting temperature isothermal amplification, LMTIA) technology, has the biggest advantage that isothermal reaction of polymerase chain reaction is realized by utilizing the difference of melting temperature (Tm) of the primer and the target sequence. The LMTIA has the advantages of both LAMP and PCR technologies. And a PCR instrument is not needed, and the equipment requirement is simple. In addition, compared with the LAMP technology, the LMTIA can finish amplification by adopting a pair of primers.
According to the invention, the ompR gene is adopted as a new target for detection by utilizing the clonobacter malonate, a highly matched LMTIA primer pair is designed, the LMTIA amplification reaction is carried out on the obtained DNA sample by utilizing the LMTIA primer pair, the characteristic value of an amplification reaction product is obtained, and whether positive amplification exists in the DNA sample to be detected is judged according to the characteristic value of the amplification reaction product. Because the ompR gene has stronger specificity, the method has the effect of strong specificity when the LMTIA amplification technology is adopted to detect the clonobacter malonate, and meanwhile, the LMTIA amplification technology is adopted during detection, so that the primer design is simple, the equipment requirement is simple, and the visual observation of the amplification result can be realized. Therefore, the detection method of the clonobacter malonate provided by the invention has the technical effects of simple primer design, simple equipment requirement and high specificity.
Further, the step of judging whether the DNA sample in the reaction product has positive amplification according to the characteristic value of the amplification reaction product comprises the following steps:
obtaining the color of the amplification reaction product;
if the color of the reaction product is blue, judging that the DNA sample to be detected has positive amplification.
The color of the reaction product appears blue if there is positive amplification of the DNA sample of the reaction product, and purple if there is no positive amplification of the DNA sample of the reaction product. Bst 4.0HNB Bead contains HNB dye, and the combination of HNB dye and Mg2+ before the LMTIA amplification starts shows macroscopic violet, when positive amplification happens, mg2+ is chelated by byproducts of LMTIA reaction, HNB dye can not be combined with Mg2+, and macroscopic sky blue is shown. The judging method can realize the visual judgment of the reaction product, is very visual in observation of the reaction product, does not need other operations, and is convenient and quick.
Further, the step of judging whether the DNA sample in the reaction product has positive amplification according to the characteristic value of the amplification reaction product comprises the following steps:
obtaining an agarose gel electrophoresis detection result of an amplification reaction product;
if the agarose gel electrophoresis detection result of the amplification reaction product is that the trapezoidal band exists, judging that the DNA sample to be detected has positive amplification.
Agarose gel electrophoresis is a typical method for separating, purifying and identifying DNA fragments, and is characterized by simplicity and rapidness. The difference of charged property, molecular weight, shape and the like of molecules in the reaction product causes the charged molecules to generate different migration speeds, and the DNA molecules are negatively charged in a pH solution higher than the isoelectric point of the DNA molecules and move to the positive electrode in an electric field. The DNA molecule moves through medium in electric field, small amount of Goldview is added into gel, and the molecule can be inserted between bases of DNA to form a kind of optical complex, and under ultraviolet irradiation, trapezoid band can be formed, so that the reaction product after LMTIA amplification reaction can be detected.
When detecting the reaction products after the LMTIA amplification reaction, the movement of the smaller DNA fragments in the gel is relatively easier than the movement of the larger fragments in the gel. The power supply is regulated to proper voltage, so that DNA fragments with different sizes can be separated. If the DNA sample in the LMTIA amplification reaction product has positive amplification, the amplified small DNA fragment can move to the positive electrode in an electric field, so that a trapezoid band is formed under ultraviolet irradiation; if there is no positive amplification of the DNA sample in the LMTIA amplification reaction product, the intact DNA fragment cannot move to the positive electrode in the electric field, so that no trapezoidal bands are formed under UV irradiation.
The agarose gel electrophoresis method is adopted to detect the amplification reaction product, and the agarose gel has the advantages of uniform structure, large water content, approximate free electrophoresis, free sample diffusion and very little sample adsorption, so that the electrophoresis pattern is clear, the resolution is high and the repeatability is good; and agarose gel is transparent without ultraviolet absorption, and the electrophoresis process and result can be directly detected by ultraviolet lamp and quantitatively measured.
In addition, the LMTIA reaction system includes:
1/2 Bst 4.0HNB Bead;
1. Mu.L of the upstream primer ompR-P;
1. Mu.L of the downstream primer ompR-D;
1. Mu.L of template DNA;
22. Mu.L of ddH2O.
As a preferred embodiment of the invention, the LMTIA reaction system is: 1/2 Bst 4.0HNB Bead; 1. Mu.L of the upstream primer ompR-P and 1. Mu.L of the downstream primer ompR-D; then 22. Mu.L of ddH2O was added; finally, 1. Mu.L of template DNA was added. The sample was carried out using Bst 4.0HNB Bead kit (Harbin sea Gene detection Co., ltd.).
The concentration of the upstream primer ompR-P is 10 mM/. Mu.L;
the concentration of the downstream primer ompR-P is 10 mM/. Mu.L;
the reaction temperature of the LMTIA reaction is 60-70 ℃, specifically, the reaction temperature of the LMTIA reaction can be 60 ℃, 62 ℃, 64 ℃, 65 ℃, 66 ℃, 68 ℃, 70 ℃ and the like;
the reaction time of the LMTIA reaction is 30-50 min, specifically, the reaction time of the LMTIA reaction can be 30min, 35min, 40min, 45min, 50min and the like.
The concentration of the upstream primer ompR-P, the concentration of the downstream primer ompR-P, the reaction temperature of the LMTIA reaction and the reaction time of the LMTIA reaction can be set simultaneously or respectively, and the effect of the LMTIA amplification reaction is better.
As a preferred aspect of the present invention, the concentration of the upstream primer ompR-P is 10 mM/. Mu.L; the concentration of the downstream primer ompR-P is 10 mM/. Mu.L; preferably, the LMTIA amplification reaction condition adopts the amplification reaction temperature of 66 ℃ and the amplification reaction time of 35min.
The invention also provides a kit for detecting the clonobacter malonate, which comprises the LMTIA primer pair.
The invention also provides application of the LMTIA primer pair in detection of the clonobacter malonate for non-diagnosis purpose.
The following technical solutions of the present invention will be described in further detail with reference to specific examples and drawings, and it should be understood that the following examples are only for explaining the present invention and are not intended to limit the present invention.
Example 1: LMTIA method for detecting clonobacter malonate
A method of detecting LMTIA of cronobacter malonate comprising the steps of:
1. preparation of bacterial DNA template to be detected
Extracting genome DNA of the strain to be detected by a boiling method, which comprises the following specific steps: culturing the strain in LB liquid medium overnight, taking 1mL of bacterial liquid, centrifuging at 12000rpm for 5min, and discarding the supernatant; the cell pellet was washed with 1mL of sterile water, centrifuged at 12000rpm for 5min, and the supernatant was discarded. Adding 100 mu L of sterile deionized water into the precipitate to form a suspension, boiling for 10min, ice-bathing for 5min, and centrifuging at 12000rpm for 5min, wherein the supernatant is genomic DNA and used as a template for LMTIA amplification.
In other embodiments, the strain DNA to be tested may also be extracted using commercial kits or organic reagent methods.
2. Establishment of LMTIA reaction system
The LMTIA reaction system is as follows: 1/2 Bst 4.0HNB Bead; 1. Mu.L of the upstream primer ompR-P at a concentration of 10 mM/. Mu.L; 1. Mu.L of the downstream primer ompR-D at a concentration of 10 mM/. Mu.L; then 22. Mu.L of ddH2O was added; finally, 1. Mu.L of template DNA was added. As shown in table 1.
TABLE 1LMTIA amplification Table
As a preferred embodiment of the present invention, the reaction conditions are: 66 ℃,35mins. The sample was carried out using Bst 4.0HNB Bead kit (Harbin sea Gene detection Co., ltd.).
3. Judgment of LMTIA reaction product
After the reaction, 5. Mu.L of the reaction solution was taken and subjected to 1.5% agarose gel electrophoresis, goldview was added to the electrophoresis gel and stained, and after the electrophoresis was completed, the reaction solution was observed under an ultraviolet projector, and if the result was a trapezoid band, it was judged that positive amplification was present.
In other embodiments, the reaction tube may also be directly observed, and positive amplification may be determined to be present if the product appears sky blue.
Performance test:
sensitivity detection experiment
Based on example 1, DNA of Cronobacter malonate CICC24177 was extracted, and the concentration was measured to be 109 ng/. Mu.L, and ten-fold dilution with sterile water was used as a detection template. A1. Mu.L portion of each concentration gradient was used as a DNA template, and a blank was set, and sensitivity was measured in accordance with the LMTIA reaction system and conditions described in example 1.
Lanes 1-14 show the electrophoresis results of the LMTIA amplification products of Cronobacter malonate at different concentrations, as shown in FIG. 4. Wherein, the concentration of lanes 1-2 is 1.09 ng/. Mu.L, the concentration of lanes 3-4 is 109 pg/. Mu.L, the concentration of lanes 5-6 is 10.9 pg/. Mu.L, the concentration of lanes 7-8 is 1.09 pg/. Mu.L, the concentration of lanes 9-10 is 109 fg/. Mu.L, the concentration of lanes 11-12 is 10.9 fg/. Mu.L, the concentration of lanes 13-14 is 1.09 fg/. Mu.L, and lanes 15-16 are blank controls without nucleic acid template. Lane M is DL 2000DNA Maker.
The results showed that agarose gel electrophoresis gave the following results: in the case where the control group showed a negative result, the result was positive when the concentration of the pure culture was 1.09 ng/. Mu.L to 1.09 ng/. Mu.L, while the control group showed a negative. Therefore, the detection method of the clonobacter malonate provided by the invention can detect the clonobacter malonate with the DNA concentration as low as 1 fg/mu L, and has good sensitivity for detecting the clonobacter malonate.
Specificity detection experiment
Based on example 1, 9 bacteria were selected for DNA extraction, 1 μl was taken as a DNA template, and a blank was set at the same time, and LMTIA specificity experiments were performed according to the LMTIA reaction system and conditions in example 1.
Referring to FIG. 5, lanes 1-10 show the electrophoresis results of different species of bacterial LMTIA amplification products. Wherein, lane M is DL 2000DNA Maker, lane 1 is Cronobacter malonate CICC24177, lane 2 is Cronobacter sakazakii JXES-28 (NCBI accession number: CP 098777.1), lane 3 is Cronobacter sakazakii JXES-5, lane 4 is Cronobacter sakazakii JXES-30, lane 5 is Listeria monocytogenes ATCC19114, lane 6 is Escherichia coli ATCC25922, lane 7 is Salmonella diphasic S499 (NCBI accession number: CP 082954.1), lane 8 is Proteus mirabilis 012 (NCBI accession number: CP 062146), lane 9 is Salmonella ATCC14028, and lane 10 is NTC.
The agarose gel electrophoresis result shows that only the clonobacter malonate lane presents a trapezoid band and is positive. Other bacterial lanes were all negative without trapezoidal bands. Therefore, the detection method of the clonobacter malonate provided by the invention has good specificity for detecting the clonobacter malonate.
Visual detection experiment
Based on example 1, 9 bacteria were selected for DNA extraction, 1 μl was taken as a DNA template, and a blank control was set at the same time, and LMTIA visualization specificity experiments were performed according to the LMTIA reaction system and conditions in example 1.
Wherein, PCR tube 1 is Cronobacter malonate CICC24177, PCR tube 2 is Cronobacter sakazakii JXES-28 (NCBI accession number: CP 098777.1), PCR tube 3 is Cronobacter sakazakii JXES-5, PCR tube 4 is Cronobacter sakazakii JXES-30, PCR tube 5 is Listeria monocytogenes ATCC19114, PCR tube 6 is Escherichia coli ATCC25922, PCR tube 7 is Salmonella diphasic S499 (NCBI accession number: CP 082954.1), PCR tube 8 is Proteus mirabilis 012 (NCBI accession number: CP 062146), PCR tube 9 is Salmonella ATCC14028, and PCR tube 10 is NTC.
Referring to FIG. 6, after the completion of the LMTIA reaction, the amplification products in the PCR tubes of Cronobacter malonate all exhibited a pronounced sky blue color. Other bacteria and NTC sample PCR products present a distinct violet color. Therefore, the detection method of the clonobacter malonate provided by the invention realizes visual on-site rapid detection.
The invention uses the malonate Cronobacter cloacae to adopt ompR gene as a highly matched LMTIA primer pair designed for detecting a new target, uses the LMTIA primer pair to carry out LMTIA amplification reaction on the obtained DNA sample, obtains the characteristic value of an amplification reaction product and judges whether the DNA sample to be detected has positive amplification according to the characteristic value of the amplification reaction product. Because the ompR gene has stronger specificity, the method has the effect of strong specificity when the LMTIA amplification technology is adopted to detect the clonobacter malonate, and meanwhile, the LMTIA amplification technology is adopted during detection, so that the primer design is simple, the equipment requirement is simple, and the visual observation of the amplification result can be realized. Therefore, the detection method of the clonobacter malonate provided by the invention has the technical effects of simple primer design, simple equipment requirement and high nucleic acid target specificity.
The foregoing is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention, but various modifications and variations will be apparent to those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the scope of the present invention.
Claims (10)
1. A novel target for detecting malonate Cronobacter cloacae, wherein the nucleotide sequence of the novel target is shown as SEQ ID NO. 1.
2. An LMTIA primer pair for detecting cronobacter malonate, characterized in that it is designed from a new target based on claim 1, comprising:
an upstream primer ompR-P, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 2; and
and a downstream primer ompR-D, wherein the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 3.
3. The LMTIA primer pair of claim 2 wherein,
the upstream primer ompR-P comprises a primer P1 and a primer P2;
the downstream primer ompR-D comprises a primer D1 and a primer D2;
wherein the primer P1 and the primer D2 are complementary to the negative strand of the new target nucleotide sequence, and the primer P2 and the primer D1 are complementary to the positive strand of the new target nucleotide sequence;
the nucleotide sequence of the primer P1 is shown as SEQ ID NO. 4;
the nucleotide sequence of the primer P2 is shown as SEQ ID NO. 5;
the nucleotide sequence of the primer D1 is shown as SEQ ID NO. 6;
the nucleotide sequence of the primer D2 is shown as SEQ ID NO. 7.
4. A method for detecting cronobacter malonate, comprising the steps of:
obtaining a DNA sample to be detected;
performing an LMTIA amplification reaction on the obtained DNA sample by using the LMTIA primer pair as claimed in claim 2 or 3 to obtain an amplification reaction product;
obtaining a characteristic value of an amplification reaction product;
judging whether positive amplification exists in the DNA sample to be detected according to the characteristic value of the amplification reaction product.
5. The method according to claim 4, wherein the step of judging whether the DNA sample in the reaction product has positive amplification based on the characteristic value of the amplification reaction product comprises:
obtaining the color of the amplification reaction product;
if the color of the reaction product is blue, judging that the DNA sample to be detected has positive amplification.
6. The method according to claim 4, wherein the step of judging whether the DNA sample in the reaction product has positive amplification based on the characteristic value of the amplification reaction product comprises:
obtaining an agarose gel electrophoresis detection result of an amplification reaction product;
if the agarose gel electrophoresis detection result of the amplification reaction product is that the trapezoidal band exists, judging that the DNA sample to be detected has positive amplification.
7. The method for detecting cronobacter malonate according to claim 4, wherein the LMTIA reaction system comprises:
1/2 Bst 4.0HNB Bead;
1. Mu.L of the upstream primer ompR-P;
1. Mu.L of the downstream primer ompR-D;
1. Mu.L of template DNA;
22. Mu.L of ddH2O.
8. The method for detecting a salt of Cronobacter malonate according to claim 7,
the concentration of the upstream primer ompR-P is 10 mM/. Mu.L; and/or the number of the groups of groups,
the concentration of the downstream primer ompR-P is 10 mM/. Mu.L; and/or the number of the groups of groups,
the reaction temperature of the LMTIA reaction is 60-70 ℃; and/or the number of the groups of groups,
the reaction time is 30-50 min.
9. A kit for detecting cronobacter malonate, characterized in that it comprises the pair of LMTIA primers according to claim 2 or 3.
10. Use of a pair of LMTIA primers according to claim 2 or 3 for the detection of cronobacter malonate for non-diagnostic purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310630844.3A CN116732205A (en) | 2023-05-26 | 2023-05-26 | New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310630844.3A CN116732205A (en) | 2023-05-26 | 2023-05-26 | New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116732205A true CN116732205A (en) | 2023-09-12 |
Family
ID=87912517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310630844.3A Pending CN116732205A (en) | 2023-05-26 | 2023-05-26 | New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116732205A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117512194A (en) * | 2023-12-13 | 2024-02-06 | 许昌学院 | Primer group, detection method and kit for identifying angelica sinensis and Dongangelica sinensis by double LMTIA technology and application of primer group and detection method and kit |
-
2023
- 2023-05-26 CN CN202310630844.3A patent/CN116732205A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117512194A (en) * | 2023-12-13 | 2024-02-06 | 许昌学院 | Primer group, detection method and kit for identifying angelica sinensis and Dongangelica sinensis by double LMTIA technology and application of primer group and detection method and kit |
| CN117512194B (en) * | 2023-12-13 | 2024-05-28 | 许昌学院 | Primer group for identifying angelica sinensis and Dongangelica sinensis by double LMTIA technology, detection method, kit and application of primer group |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434884A (en) | Method, primer and kit for fast detecting Listeria monocytogenes at constant temperature | |
| CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| CN116732205A (en) | New target for detecting malonate Cronobacter cloacae, LMTIA primer pair, kit, detection method and application | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN113801920A (en) | Kit and method for rapidly detecting salmonella based on CRSIPR-Cas system | |
| CN110684866A (en) | Primer pair, kit and method for detecting chicken infectious anemia virus | |
| CN107574261B (en) | Detection primer, detection kit and detection method for detecting hantavirus | |
| CN114107282A (en) | Method for extracting nucleic acid by modified diatomite and application | |
| CN108624713B (en) | Method and kit for identifying and detecting porcine pseudorabies vaccine virus and wild virus | |
| CN103866048A (en) | HRM (High Resolution Melt) identification method, kit and primer group for muscovy duck parvovirus and goose parvovirus | |
| CN110982916B (en) | Primer combination and detection kit for detecting shiga toxin-producing escherichia coli | |
| CN111073986B (en) | Rapid constant-temperature detection method for salmonella, primer group and application | |
| CN116287344A (en) | Primer pair, kit and method for detecting Cronobacter sakazakii | |
| CN116656845A (en) | Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof | |
| Lin et al. | A smartphone-assisted high-throughput integrated color-sensing platform for the rapid detection of Campylobacter coli | |
| CN110747261A (en) | Specific primer, detection method and application of tetracycline antibiotic resistance gene tetX | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN105039517A (en) | PCR-HRM primer and method for distinguishing five types of rodent helicobacters | |
| CN108203736A (en) | A kind of method of quick detection Salmonella in Food | |
| CN107058463B (en) | Primer for identifying salmonella H antigen | |
| CN112592965B (en) | E.coli host DNA residue detection kit adopting TaqMan probe method | |
| CN111621578A (en) | RU 61-00441 gene-based Salmonella spelt constant-temperature detection kit and method | |
| CN112592989A (en) | RPA primer for distinguishing proteus mirabilis and salmonella and detection method | |
| CN114085924A (en) | Novel coronavirus 4-point mutation S gene identification kit based on high-resolution melting curve and identification method thereof | |
| CN111996268A (en) | Vibrio alginolyticus double TaqMan probe real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |