CN109929914A - MicroRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) - Google Patents
MicroRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) Download PDFInfo
- Publication number
- CN109929914A CN109929914A CN201711347118.1A CN201711347118A CN109929914A CN 109929914 A CN109929914 A CN 109929914A CN 201711347118 A CN201711347118 A CN 201711347118A CN 109929914 A CN109929914 A CN 109929914A
- Authority
- CN
- China
- Prior art keywords
- mir744
- microrna
- pcr
- pipe
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is a kind of microRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method).By the method for RT-PCR, the RNA reverse transcription in sample is obtained into corresponding cDNA, recycles specific primer and probe, in conjunction with real-time fluorescence quantitative PCR detection technique, can accurately detect the expression quantity of microRNA 744 (MIR744) in sample.Such detection method can the microRNA 744 (MIR744) in the peripheral blood serum sample to Pancreas cancer patients carry out quantitative analysis, clinically can be to the therapeutic effect of auxiliary diagnosis and evaluation prognosis.The present invention, come guiding clinical treatment, has certain clinical value by the medicine detection means in molecules.
Description
Technical field
The invention belongs to biotechnology people fields, to obtain cDNA by reverse transcription (RT) RNA sample, now in conjunction with glimmering in real time
Fluorescent Quantitative PCR technology can detect the kit of people microRNA 744 (MIR744) expression quantity in sample with accurate quantification.
Background technique
It is shown according to the data of Chinese tumour Register, newly-increased 4,300,000 cases of cancer of China in 2015, cancer mortality case
More than 2,810,000, occupies the 28.82% of annual death toll ratio, occupy first place in the world, i.e., it is average just to have more than 7500 people daily
Die of cancer.The disease incidence of cancer of pancreas is 9/,100,000 at U.S. 1988, male to female ratio 1.3:1.It is more common in 45 years old or more
Person.Sweden's disease incidence is higher, is 1,25/,100,000, and remained unchanged in past 20 years.Britain and Norway respectively increase 1 times.
The seventies, the Standardized incidence rate of Canada, Denmark and Poland increased 50% or more compared with the sixties.In China, cancer of pancreas is
One of ten big malignant tumours as China human mortality death.According to 354 analysiss of cases of the hospital of Beijing area 7,41 in patient
~70 years old persons account for 80%, young Patients with Pancreatic Cancer also compared with 10 years before the trend that is significantly increased, and grade of malignancy is higher, more after
It is worse.For the happening part of cancer of pancreas, still at most seen with head of pancreas position, account for about 70% or so, body of pancreas takes second place, and tail of pancreas portion is more
Take second place, some head bodies tail portion has, and belongs to diffusivity lesion or multicentricity lesion.
Now, cancer of pancreas is to have become the significant threat of human health.Currently, operation excision, chemotherapy, radiotherapy and endocrine
Treatment is still the main method for the treatment of of pancreatic cancer.While above-mentioned technology has reached quite mature and universal, Gao Fufa
The main problem that Pancreas cancer patients face also is still with the rate of transform, the appearance of these problems plays effective life cycle of patient
Important influence seriously endangers the postoperative quality of life of tumor patient.So how to be answered in postoperative its tumour that detects of patient
Send out and translated into the research topic of numerous scholars.After 2000, many scholars answer molecular biology field in research
It uses in human health project, so far more than ten years, the vitro detection technology developed therefrom is also continuous mature and complete
In kind.Wherein TaqMan quantitative fluorescent PCR is exactly one such vitro diagnostic techniques.
Since TaqMan quantitative fluorescent PCR has reproducible, as a result accurate and reliable feature, so in medicine detection side
The problem of face, some common detection methods cann't be solved, can be solved with this.In general cytomorphology inspection can be direct
It observes tumour cell, but is only limitted to the pathological examination of tissue.Due to tumour small, this inspection that drops to the number in blood circulation
The sensibility and specificity looked into is poor, and positive rate is only 1%.The immunohistochemical method in later period improves recall rate, but should
Technology production is complicated, and needs the antibody of specificity, and false positive rate is also high.TaqMan quantitative fluorescent PCR and these technologies
It compares, there is clear advantage, synthesized due to the transcribed specific mrna of some tumours, but without corresponding albumen, therefore fluorescent quantitation
PCR application range is extensive compared with albumen；In addition only it is to be understood that testing gene sequence, can design synthetic primer probe and carry out reverse transcription
And amplification, it is easy to operate；This method sensitivity with higher and repeatability simultaneously, ensure that the accurate of results from medical tests
Property.
By taking microRNA 744 (MIR744) detection as an example, microRNA 744 (MIR744) is the specificity of cancer of pancreas
Biomarker, content is very low in healthy human peripheral blood or can't detect microRNA 744 (MIR744), and is recurring
In the Pancreas cancer patients of transfer, if cancer cell falls off in blood, microRNA will be generated in serum or blood plasma
744 (MIR744), can detect.At the same time, TaqMan fluorescent quantitative PCR technique has good sensitivity and spy
The opposite sex, targetedly to the microRNA 744 in Pancreas cancer patients peripheral blood and Zhong Liu Zu Zhi ﹑ marrow equal samples
(MIR744) expression is detected, and can the diagnosis such as pancreatic cancer cell hematogenous spread be provided with important foundation.So should
The application of technology, it will the diagnosis of Early pancreatic carcinoma patient, guiding clinical treatment, improvement patient's prognosis are generated particularly important
Effect.
Summary of the invention
The present invention is a kind of microRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method),
Containing 4 kinds of components, it is respectively as follows: One step RT-PCR reaction solution (360 μ L/ pipe), positive reference substance (50 μ L/ pipe), negative control
Product (50 μ L/ pipe), 2 × 106Copies/ μ l standard items (20 μ L/ pipe) main ingredient composition.
Water, reverse transcriptase, Taq enzyme containing DEPC processing in One step RT-PCR reaction solution, dNTPs, RT-PCR buffering
Liquid, oligomerization (dT)15-18、MgCL2(3mM), detection are visited with upstream primer (0.2 μM), detection with downstream primer (0.2 μM), fluorescence
Needle (0.3 μM), in which:
Detection upstream primer sequence are as follows: 5 '-TTGGGCAAGGTGCGGGGCTAGG -3 '；
Detection downstream primer sequence are as follows: 5 '-GACCGAGTAAGGTTGAGGTTAG -3 '；
Fluorescence probe sequence: 5 '-FAM-GCAACAGCATGTGCGTGGTTTC-TAMRA -3 '；
Standard items sequence are as follows: TTGGGCAAGGTGCGGGGCTAGGGCTAACAGCAGTCTTACTGAAGGTTTCCTGGAAA CCAC
GCACATGCTGTTGCCACTAACCTCAACCTTACTCGGTC。
Quality-control product is divided into positive reference substance and negative controls, and positive reference substance is to have microRNA 744 (MIR744)
RNA sample, negative controls be microRNA 744 (MIR744) RNA sample.
2×106Copies/ μ l standard items are the plasmid containing standard amplification sequence.
- 20 DEG C of freezen protectives of this kit, validity period are 6 months, and multigelation should be avoided.
The present invention establishes the method using TaqMan technology detection microRNA 744 (MIR744), and suffers from through detection
Person's sample shows that this method is practical.Since this method uses real-time fluorescent PCR amplification technology, to from Fresh human peripheral
Total serum IgE is extracted in serum and carries out reverse transcription, then glimmering with the specific primer and specificity of microRNA 744 (MIR744)
Light probe is equipped with PCR buffer, hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomers (dGTP, dATP, dCTP, dTTP)
Equal ingredients detect the expression quantity of human peripheral microRNA 744 (MIR744) nucleic acid middle clearly using real-time fluorescent PCR technology,
Important foundation is provided with the presence or absence of hematogenous spread to the tumour cell of primary pancreatic carcinoma patient.
The application method of kit of the present invention:
Detection should set up positive and negative control every time.
One, Preparatory work of experiment
Extract human peripheral total serum IgE (using common serum micro RNA extracts kit on the market) middle clearly, -20 DEG C of preservations
It is spare.
Two .RT-PCR
RNA initial denaturation: total rna solution being placed in 70 DEG C of water-baths and keeps the temperature 5 minutes, is placed rapidly after taking-up on ice, spare.By table
1 prepares reverse transcription system:
1 reverse transcription system of table
| One step RT-PCR reaction solution | 20μl |
| Template total rna solution | 5.0μl |
PCR reaction tube is put into instrument sample slot (instrument concrete operation method is carried out according to respective operation instructions).
RT-PCR reaction condition: 1) 40 DEG C 30 minutes；2) 95 DEG C 5 minutes；3) 95 DEG C 15 seconds → 60 DEG C 1 minute, 45
A circulation.
Three, the amplification of standard items and reference substance
Take 2 × 10610 μ l of copies/ μ l standard items is 2 × 10 with deionized water gradient dilution5, 2 × 104, 2 × 103, 2 ×
102, 2 × 101Copies/ μ l, together with 2 × 106Copies/ μ l standard items totally 6 concentration, respectively taking 5 μ l is template (other groups
Divide with table 1) PCR amplification is carried out together with sample to be tested, to draw standard curve.
Four, result judgement: the critical value that the positive of this kit judges is 102 Copies/ml serum.
Detailed description of the invention: Fig. 1 is the detection of real-time fluorescence quantitative RT-PCR standard items
Fig. 2 is real-time fluorescence quantitative RT-PCR standard curve
Specific embodiment
The present invention is described further with reference to the drawings and specific embodiments, it should be appreciated that these embodiments are merely to illustrate mesh
, without limiting the scope of the invention.
Embodiment 1 microRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) detection
The application of the expression of microRNA 21
One, material:
Reagent constituents material source: the RT-PCR buffer components in One step RT-PCR reaction solution are purchased from TAKARA company,
Detection probe, primer are synthesized by TAKARA company；The water of DEPC processing is self-control；2×106Copies/ μ l standard items are to have mesh
Segment plasmid solution；Positive reference substance is the RNA sample for having microRNA 744 (MIR744), and negative controls are nothing
The RNA sample of microRNA 744 (MIR744).
Two, instrument and equipment:
ABI7300 fluorescence quantitative PCR instrument.
Three, primer and probe design and synthesis:
With microRNA 744 (MIR744) sequence (GenBank accession number: NR-030613.1) for template, ABI 7300 is used
Type real-time fluorescence quantitative PCR instrument accompanying software analyzes TaqMan primer and probe site, while considering genomic dna sequence feelings
Condition therefrom selects optimal combination.Primer and probe is synthesized by TAKARA company.The recombination containing target gene in standard solution
Plasmid is by the raw work biosynthesis in Shanghai.
Detection upstream primer sequence are as follows: 5 '-TTGGGCAAGGTGCGGGGCTAGG -3 '；
Detection downstream primer sequence are as follows: 5 '-GACCGAGTAAGGTTGAGGTTAG -3 '；
Fluorescence probe sequence: 5 '-FAM-GCAACAGCATGTGCGTGGTTTC-TAMRA -3 '.
Four, prepared by standard items
Standard items are synthesized by the raw work in Shanghai, are then inserted into pCR2.1 cloning vector with cloning system, and by positive colony through being sequenced
Verifying.Recycling is standard items after I digestion of EcoR, measures concentration and is converted into (copy number/volume).
Five, experimental result
Through being sequenced, above-mentioned design standard product are consistent with expection completely, following (including the both ends EcoR of the standard items fragment sequence of recycling
I site):GAATTCTTGGGCAAGGTGCGGGGCTAGGGCTAACAGCAGTCTTACTGAAGGTTTCCTGGAAACCACGCAC
ATGCTGTTGCCACTAACCTCAACCTTACTCGGTC GAATTC。
The clinical application of embodiment 2 microRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method)
One, samples sources
It is experimental group that 52, which are Pancreas cancer patients through pathological diagnosis, wherein 42 have occurred lymph node or distal end turn for pathological diagnosis
It moves, 10 lymph node or far-end transfer do not occur for pathological diagnosis；20 Healthy Peoples and 30 pancreatitis diseases are control group.
Two, pattern detection:
It is sample that each subject, which takes 1ml serum, and through method appropriate, extracting takes the RNA in sample.Using reagent of the invention
Carry out fluorescence quantitative RT-RCR amplification, RT-PCR reaction condition: 1) 40 DEG C 30 minutes；2) 95 DEG C 5 minutes；3) 95 DEG C 15 seconds
→ 60 DEG C 1 minute, 45 circulation.Simultaneously plus standard items and positive and negative reference substance, standard items are used to make standard curve.As a result
The content of detection sample micro RNA 744 (MIR744) is calculated according to standard curve after instrument is handled.
Three, pattern detection result
Standard items testing result is referring to Fig. 1, and standard curve is referring to fig. 2.
2 102 clinical case microRNA 744 (MIR744) copy number testing results of table
The results showed that the serum testing result positive rate of 52 Pancreas cancer patients of experimental group reaches 90% or more, and control group
In 20 Healthy Peoples and 30 Pancreatitis Patients in addition to 2 Pancreatitis Patients detections are positive, remaining is detected as feminine gender.
It is more accurate that the above results show that kit of the invention can carry out the amount of microRNA 744 (MIR744)
Qualitative and quantitative analysis.
TTGGGCAAGGTGCGGGGCTAGGGCTAACAGCAGTCTTACTGAAGGTTTCCTGGAAACCACGCACATGCTGTTG
CCACTAACCTCAACCTTACTCGGTC
Claims (2)
1. the present invention is a kind of microRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method), contain
There are 4 kinds of components, is respectively as follows: One step RT-PCR reaction solution (360 μ L/ pipe), positive reference substance (50 μ L/ pipe), negative controls
(50 μ L/ pipe), 2 × 106Copies/ μ l standard items (20 μ L/ pipe) main ingredient composition；
(1) water containing DEPC processing in One step RT-PCR reaction solution, reverse transcriptase, Taq enzyme, dNTPs, RT-PCR buffering
Liquid, oligomerization (dT)15-18、MgCL2(3mM), detection are visited with upstream primer (0.2 μM), detection with downstream primer (0.2 μM), fluorescence
Needle (0.3 μM)；
(2) reagent of the invention contains special primer, probe sequence and standard items sequence:
Detection upstream primer sequence are as follows: 5 '-TTGGGCAAGGTGCGGGGCTAGG -3 ',
Detection downstream primer sequence are as follows: 5 '-GACCGAGTAAGGTTGAGGTTAG -3 ',
Fluorescence probe sequence: 5 '-FAM-GCAACAGCATGTGCGTGGTTTC-TAMRA -3 '；
(3) quality-control product is divided into positive reference substance and negative controls, and positive reference substance is to have microRNA's 744 (MIR744)
RNA sample, negative controls for no microRNA 744 (MIR744) RNA sample；
(4) 2 × 106Copies/ μ l standard items are the plasmid containing standard amplification sequence, standard items sequence are as follows:
TTGGGCAAGGTGCGGGGCTAGGGCTAACAGCAGTCTTACTGAAGGTTTCCTGGAAACCACGCACATGCTGTTGCCAC
TAACCTCAACCTTACTCGGTC。
2. microRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe according to claim 1
Method), it is characterized in that: kit specification of the present invention is 10 person-portions/box；The amount of each component in every box are as follows: One step RT-PCR reaction
Liquid (360 μ L/ pipe), positive reference substance (50 μ L/ pipe), negative controls (50 μ L/ pipe), 2 × 106Copies/ μ l standard items (20
μ L/ pipe).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711347118.1A CN109929914A (en) | 2017-12-15 | 2017-12-15 | MicroRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711347118.1A CN109929914A (en) | 2017-12-15 | 2017-12-15 | MicroRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109929914A true CN109929914A (en) | 2019-06-25 |
Family
ID=66979544
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711347118.1A Pending CN109929914A (en) | 2017-12-15 | 2017-12-15 | MicroRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109929914A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101988060A (en) * | 2009-07-30 | 2011-03-23 | 江苏命码生物科技有限公司 | Marker for detecting colon and rectum cancer as well as detection method, kit and biological chip thereof |
| WO2011154008A1 (en) * | 2010-06-11 | 2011-12-15 | Rigshospitalet | Microrna classification of thyroid follicular neoplasia |
| CN106636464A (en) * | 2016-12-07 | 2017-05-10 | 中国人民解放军军事医学科学院微生物流行病研究所 | Characteristic miRNAs in Ebola virus infected blood and application of characteristic miRNAs |
-
2017
- 2017-12-15 CN CN201711347118.1A patent/CN109929914A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101988060A (en) * | 2009-07-30 | 2011-03-23 | 江苏命码生物科技有限公司 | Marker for detecting colon and rectum cancer as well as detection method, kit and biological chip thereof |
| WO2011154008A1 (en) * | 2010-06-11 | 2011-12-15 | Rigshospitalet | Microrna classification of thyroid follicular neoplasia |
| CN106636464A (en) * | 2016-12-07 | 2017-05-10 | 中国人民解放军军事医学科学院微生物流行病研究所 | Characteristic miRNAs in Ebola virus infected blood and application of characteristic miRNAs |
Non-Patent Citations (2)
| Title |
|---|
| 吴学朕等: ""胰腺癌患者血浆miR-744表达及临床意义"", 《热带医学杂志》 * |
| 彭瑞云等: "《现代实验病理技术》", 31 August 2012, 军事医学科学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108048570A (en) | For primer pair, kit and the method for colorectal cancer related gene Septin9 DNA methylation assays | |
| CN108624695B (en) | One kind circulation miRNA marker relevant to thyroid papillary carcinoma auxiliary diagnosis and its application | |
| WO2017054325A1 (en) | Breast cancer combined diagnosis markers and detection kit | |
| CN106047989A (en) | Application of circular RNA to colorectal cancer inspection marker | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| Li et al. | Prognostic and clinicopathological significance of circulating tumor cells in osteosarcoma | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| CN105296481B (en) | A kind of method of the HLA B27 Genotypings based on gene sequencing method | |
| CN110229910A (en) | MYD88 gene L265P mutation detection kit and detection method | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN106967792A (en) | The gene methylation diagnostic reagent systems of DKK 3, kit and its application | |
| CN109957609A (en) | Utilize the kit of PCR- fluorescence probe method detection 155 nucleic acid quantification of MicroRNA | |
| CN109929921A (en) | MicroRNA 21 (MIR21) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN110331208A (en) | Application of the molecular target in adenocarcinoma of lung Combining diagnosis | |
| CN103173538B (en) | Kit for detecting HLA-B*1301 gene | |
| CN109929914A (en) | MicroRNA 744 (MIR744) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN107326092A (en) | Applications and colorectal cancer detection kit of the related miRNA of colorectal cancer as biomarker | |
| CN109337961A (en) | The kit of one-step method real-time fluorescent quantitative reverse transcription polymerase chain reaction detection people's matrix metalloproteinase 11 | |
| CN109957610A (en) | MicroRNA 378 (MIR378) nucleic acid quantitative determination reagent kit (PCR- fluorescence probe method) | |
| CN107937514A (en) | Applications of the circZFY in pulmonary tuberculosis biomarker | |
| CN109957618A (en) | MicroRNA 210 (MIR210) nucleic acid quantitative determination reagent kit | |
| CN106544416A (en) | A kind of primer sets and detection method for detecting gastric cancer | |
| CN106148562A (en) | For detecting the label of carcinoma of prostate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190625 |
|
| WD01 | Invention patent application deemed withdrawn after publication |