CN106544416A - A kind of primer sets and detection method for detecting gastric cancer - Google Patents
A kind of primer sets and detection method for detecting gastric cancer Download PDFInfo
- Publication number
- CN106544416A CN106544416A CN201610895859.2A CN201610895859A CN106544416A CN 106544416 A CN106544416 A CN 106544416A CN 201610895859 A CN201610895859 A CN 201610895859A CN 106544416 A CN106544416 A CN 106544416A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- gastric cancer
- pcr
- reverse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The present invention is provided to detect the primer sets and its detection method of gastric cancer, the primer of the present invention includes SEQ ID No.1 SEQID No.18, can carry out joint-detection to EpCAM, HER2, EGFR, CEA, MUC1, CMET, CK18, CK19, CK20 gene.By PCR or the method for quantitative fluorescent PCR, Sensitive Detection expression and the expression of target gene can be gone out at short notice；Using the PCR conditions of optimization, by the period for increasing amplified reaction, make observation result more notable, further improve method applicability；Amplified production has specificity, it is ensured that PCR detects high accuracy and sensitivity.Implement the primer sets for gastric cancer detection in the present invention, by the expression for detecting patient's sample target gene, can simply, conveniently and accurately diagnosis of gastric cancer.
Description
Technical field
The present invention relates to oncogene field, and in particular to a kind of primer sets and detection method for detecting gastric cancer.
Background technology
Gastric cancer system originates from the malignant tumor of gastric epithelial, is to endanger one of major disease of our people's health.I
State is vast in territory, populous, and adult's helicobacter pylori (Helicobacterpylori, H.pylori) infection rate is up to 40%
～60%, belong to the High Risk For Gastric Cancer country, annual gastric cancer new cases about 400,000, death about 350,000, Xin Fa and death account for complete
The 40% of world's gastric cancer cases.China's gastric cancer Area distribution is extensive, is more concentrated with the Northwest and southeastern coast, is dispersed in more
Typical district occurred frequently, regional difference are obvious；Male's sickness rate and case fatality rate are about 2 times of women；Rural area sickness rate is higher by compared with city
60%～70%, it is common with 40～60 years old crowd；Patient's case fatality rate increases with the age and increases.
Radical treatment can be obtained under most of early gastric cancer scope, 5 years survival rates of patient are more than 90%.Early gastric cancer
Diagnosis and treatment can greatly save medical resource, but the diagnosis and treatment rate of China's early gastric cancer is less than 10% at present, well below Japan
And Korea's (50%) (70%).It is complete to carry out that China there is no simplicity, effective diagnostic method in terms of early gastric cancer examination, at present
Body mass survey；There is no method that the diagnostic methods such as endoscopy are used for the generaI investigation of gastric cancer, it is invasive inspection to add endoscopy,
The patient of many asymptomatic, low Risk of Gastric Cancer is difficult to receive.Therefore, only carry out examination for gastric cancer high-risk group just may be used
Can be the effective ways of early gastric cancer examination.
Recently, detection of the appearance that circulating tumor cell (Circulating Tumor Cells, CTCs) is detected to patient
Bring new hope.CTCs is to depart from and be displaced to the tumor cell in blood from tumor focus, is malignant tumor patient art
The major reason of recurrence and metastasis, and the key factor for causing tumor patient dead afterwards.With other histological specimens such as
Bone marrow etc. is compared, and periphery blood specimen is easily obtained, and little to patient trauma, is that clinically the ideal specimen of conventional sense is come
Source.CTCs detections contribute to the early diagnosiss of tumor, judge patient's prognosis, the curative effect of assessment antitumor drug and formulate individuation
Therapeutic scheme.Compared with traditional diagnostic method, CTCs detections can more sensitively find the change of disease, and patient is not had
Side effect.
The detection of CTC is generally carried out by extracting the blood of certain volume.Detection is divided into two classes, including not capturing (be enriched with)
Direct detection and first capture (enrichment) detect that latter of which is the detection method of main flow afterwards.The side that (enrichment) is detected afterwards is captured first
Method is also classified into two classes, i.e. key player on a team and negative choosing.Key player on a team is mainly (size, close by the physical property of CTC surface markers or cell
Degree) captured；The former is that, based on biomolecular technology and microfluidic chip technology, the latter is based on the principle for filtering, be centrifuged.
Negative choosing is then to capture indirectly CTC by leukocyte surface markers thing.But had based on the method that first capture (enrichment) is detected afterwards
Obvious defect.It depends critically upon the expression of tumor cell surface marker thing, therefore cannot capture and do not express surface tumours mark
The CTC cells of note thing.
It is another mode of CTC cell detection using the specific gene of the method detection CTC cells of RT-PCR.It is first
The blood of certain volume is first extracted, CTCs is enriched with by way of density gradient centrifugation, is then detected by way of RT-PCR
With this, the mRNA of specific gene, judges that CTCs whether there is, and quantitative to CTCs by detecting the change of CT values.This method inspection
Survey CTCs expenses low, sensitivity is high, and easily automatization.
The examination criteria of gastric cancer CTCs of RT-PCR method detection at present is also not set up.We are by detecting patients with gastric cancer
CTCs characterizing genes, determine the detection method and examination criteria of gastric cancer CTCs.These detection methods and establishment of standard contribute to
The early diagnosiss of tumor patient, judge patient's prognosis, the curative effect of assessment antitumor drug (include NK and CAR-T immunization therapies) and
Formulate individualized treatment scheme.
For the problems referred to above, a kind of test kit of high-sensitive polygene combined detection of present invention exploitation, by combining inspection
Survey 9 genes of EpCAM, HER2, EGFR, CEA, MUC1, CMET, CK18, CK19, CK20 to realize the early screening of tumor or examine
It is disconnected.Present invention design increases substantially the sensitivity of detection with targeting specific primer sets.The recall rate of the detection method can
Reach 95%, be provided simultaneously with that sensitivity is high, specificity is good, quick and precisely the advantages of.
The content of the invention
Present invention aims to the deficiencies in the prior art, there is provided a kind of primer sets and detection for detecting gastric cancer
Method.
The purpose of the present invention is achieved through the following technical solutions, a kind of primer sets for detecting gastric cancer, comprising：
The primer sets of the present invention can realize the detection of neuroblastoma by following two methods.
Method 1：PCR method.
(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extraction
Thing, reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, the condition of each circulation of PCR reactions is 94 Celsius
Degree, 30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；
(2) reverse transcription and PCR reactions are carried out, is detected with agarose gel electrophoresis method.
Method 2：Fluorescence quantifying PCR method
(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive,
Reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, wherein,
The condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three multiple holes；
(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；
(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.
The beneficial effects of the present invention is：The present invention is developed for early gastric caacer inspection by designing Specific PCR primers
The polygene combined detection method surveyed.The method：(1) PCR system set up can to EpCAM, HER2, EGFR, CEA, MUC1,
CMET, CK18, CK19, CK20 gene carries out joint-detection；(2) by carrying out detecting that gastric cancer recall rate can to multiple genes simultaneously
Reach 98%；(3) sensitivity is high, and the gene expression dose of as little as 1-5 copies can be detected；(4) high specificity, normal person or non-
Patients with Gastric Cancer sample will not produce non-specific signals；(5) detection speed is fast, simple to operate, low cost.
Description of the drawings
Fig. 1 is healthy human peripheral blood pattern detection feminine gender PCR figures in embodiment.
Fig. 2 is non-peripheral blood from patients with gastric cancer pattern detection feminine gender PCR figures in embodiment.
Fig. 3 is non-patients with gastric cancer tumor tissues pattern detection feminine gender PCR figures in embodiment.
Fig. 4 is peripheral blood from patients with gastric cancer detection positive PCR figures in embodiment.
Fig. 5 is patients with gastric cancer tumor tissues detection positive PCR figures in embodiment.
In figure, M.100bp marker；1.EpCAM；2.HER2；3.EGFR；4.CEA；5.MUC1；6.CMET；7.CK20；
8.CK18；9.CK19；10.B2M.
Specific embodiment
The present invention for main driven nature mutant gene in current tumor, joint-detection EpCAM, HER2, EGFR, CEA,
9 genes of MUC1, CMET, CK18, CK19, CK20 realize early screening or the diagnosis of gastric cancer.It is sensitive for current detection method
Degree is low, and detection process complexity is loaded down with trivial details, long the time required to detection, it is impossible to meet the actual demand of Clinical detection.For the problems referred to above,
Design for detecting a whole set of specific primer groups of above-mentioned 9 genes.
Specificity amplification primer is designed according to the reference sequences of above-mentioned 9 genes, its PCR primer length optimum is in 180-
Between 200bp, not higher than 60 degree of annealing temperature, G/C content meets the requirement of general primer-design software between 40-60%.It is logical
Cross using real-time fluorescence PCR reaction detection system, realize the highly sensitive detection of multiple gene associations, its detection method is as described below.
The present invention is further described in conjunction with the accompanying drawings and embodiments.As do not specialized part, can be according to this area skill
Familiar to art personnel institute《Molecule can grand experiment guide》The third edition (Cold Spring Harbor laboratory Press),
《Cell experiment guide》(Science Press, Beijing, China, calendar year 2001),《RNA experimental technique handbooks》(Science Press, north
Capital, China, 2004),《Immunoassay technology》1991) (Science Press, Beijing, China, laboratory manual and this paper such as
In cited list of references, listed method is implementing.Wherein, (tape label) probe used, primer can be entrusted
The synthesis of support Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
With reference to embodiment, the invention will be further described.
Embodiment 1:Gene Selection
Multiple studies have shown that, single-gene examination sensitivity is about 20-30%, is mostly used in the single of tumor early screening
Gene test, its detection sensitivity or specificity it is low, it is impossible to meet clinical needs.Can be effective using polygene combined detection
Solve the problems, such as that sensitivity is low, improve the accuracy of tumor early screening and diagnosis.Kolostova K, Matkowski R et al.
(Kolostova K,Matkowski R,Gürlich R,et al.Detection and cultivation of
circulating tumor cells in gastric cancer[J].Cytotechnology,2015,34(5):1-8.)
EpCAM, HER2, MUC1 gene is detected simultaneously, as a result shows that three genes of joint-detection are used for the sensitivity of early gastric caacer diagnosis
For 54%, rate of accuracy reached 71.2%.In order to improve the recall rate of infantile tumour, the cure rate of tumor patient is improved, improves patient
Prognosis, we are screened the difference expression gene to stomach organization and normal structure.We are sent out by a large amount of control experiments
The genome of existing EpCAM, HER2, EGFR, CEA, MUC1, CMET, CK20, CK18, CK19 composition has higher inspection to gastric cancer
Go out rate, reach 96%, relative to existing detection technique, generate unexpected technique effect, with significant progressive.
Embodiment 2:Primer screening
(1) design primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1
～i3, specially：Target gene A-I sequences are analyzed using bioinformatics software, it is special using sequence analysis software design
Specific primer group, using each pairing specificity of the primer in human genome of NCBI primers search software detection, separately designs out 3
To specificity amplification primer a1～a3, b1～b3, c1～c3, d1～d3, e1～e3, f1～f3, g1～g3, h1～h3, i1～i3；
Table 1：PCR detection primers
(2) process of peripheral blood sample
The experiment material of the present embodiment is to collect the peripheral blood from patients with gastric cancer that certain hospital accepts simultaneously Jing proved by pathology for medical treatment, early morning 7
Point, on an empty stomach, Jing ulnar veins collection fresh blood is deposited in anticoagulant tube, is shaken up, preservation≤4hr under room temperature.
1. the whole blood sample in anticoagulant tube is added into equal-volume PBS (pH7.0), 5min is centrifuged in room temperature 3000rpm, removed
Upper plasma；
2., to retaining in liquid, equal-volume ammonium chloride erythrocyte cracked liquid (being purchased from the green skies) is added, in room temperature 20rpm
After centrifugation 8min is mixed, 5min, supernatant discarded are centrifuged with 3000rpm room temperatures；
3. by lower floor's hemocyte and normal saline according to volume ratio 1:2～2:After 1 mixing, Ficoll separating liquids are added, mixed
The volume ratio that liquid is closed with Ficoll separating liquids is 1:2～2:1, centrifugal force is 700g, and 20～40min is centrifuged；
4. inhale and abandon supernatant, take cell precipitation, wash, that is, obtain PBMC；
5. PBMC is taken for nucleic acid extraction, unnecessary PBMC is resuspended with RNA protective agents, be stored in -20 degree.
(3) extraction of nucleic acid
1. not more than 5 × 10 are taken5PBMC, add 250 μ L Buffer RLT Plus, piping and druming mix；
2. lysate is transferred to gDNA to remove in centrifugal type post, 8000 × g (10,000rpm) centrifugation 30s.Collection is flowed through
Liquid, abandons centrifugal column；
3. add 70% ethanol (350 μ L) of 1 times of volume to flowing through in liquid, piping and druming is mixed；
4. sample is transferred to into RNeasyMinElute centrifugal columns, covers tightly lid, 8000 × g (10,000rpm) centrifugations
15s, abandoned stream wear liquid；
5. 700 μ L Buffer RW1 are added in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10,
15s is centrifuged 000rpm), abandoned stream wears liquid；
6. 500 μ L Buffer RPE are added in RNeasyMinElute centrifugal columns, cover tightly lid, 8000 × g (10,
15s is centrifuged 000rpm), abandoned stream wears liquid；
7. RNeasyMinElute centrifugal columns are placed in new 2mL collecting pipes, open lid, centrifugation 5min, makes at full speed
Ethanol volatilizees；
8. RNeasyMinElute centrifugal columns are placed in new 1.5mL collecting pipes, add 20 μ LRNase-free H2O,
Lid is covered tightly, at full speed centrifugation 1min eluted rnas.
(4) acquisition of template cDNA
1. sample RNA concentration is accurately measured；
2. reverse transcription system is prepared on ice in strict accordance with cDNA reverse transcription reagent box description；
| Composition | Volume |
| 5×Mix | 8μL |
| RNA | 500ng |
| RNase-free H2O | To 40 μ L |
It is soft to mix above reaction system, and the of short duration centrifugation of centrifuge is utilized, 55 degree of 20min, 85 degree of 2min obtain template
cDNA；
(5) regular-PCR amplification
Reaction system is configured with Taq archaeal dna polymerases, with primer be a-i and people's reference gene (B2M) enters performing PCR amplification
Each sample, 1% gel detection of product；
Amplification system
| Composition | Volume |
| 2×Mix | 10μL |
| cDNA | 2μL |
| Primer-F | 0.8μL |
| Primer-R | 0.8μL |
| RNase-free H2O | 6.4μL |
PCR reaction conditions are 95 DEG C of denaturations 3 minutes, 1 circulation；95 DEG C of degeneration 20 seconds, 55 DEG C are annealed 20 seconds, and 72 DEG C are prolonged
Stretch 10 seconds, 35 circulations；72 DEG C extend 7 minutes.
(6) fluorescence real-time quantitative PCR amplification
Specifically draw a group a-i according to what is designed, expanded by quantitative fluorescent PCR, system is as follows：
95 DEG C of denaturations 20s, 1 circulation；95 DEG C of 10s, 60 DEG C of 30s, 40 circulations；Often pipe sets up three multiple holes；
According to step 5 and 6 pcr results, following primer sets are filtered out, be used for detecting the primer of gastric cancer as the present invention
Group.
Embodiment 3：Compliance test result
According to the selection result of embodiment 2,200 tumor samples are detected using the primer sets described in following table.
Wherein, the forward primer of hTERT is CTGAGCTGTACTTTGTCAAG, and reverse primer is
The forward primer of AGACGTGGCTCTTGAAGGCC, MAGE1 is CTCTGAGTCCTTGCAGCTGG, and reverse primer is
The forward primer of CCGCCCTCCATTGCAATCAT, CD90 is ATGAACCTGGCCATCAGCAT, and reverse primer is
CTTCTTTGTCTCACGGGTCA。
The recall rate of 1～No. 8 primer sets as shown above, as can be seen from the table, in primer sets, with primer quantity
Increase, its recall rate can be improved to a certain extent.Further, by comparing 5～No. 8 primer sets it is found that primer
Combination in group is had a major impact for the height of recall rate.Simultaneously in the case of identical detection gene dosage, No. 5 primer sets
Recall rate be higher than 6～No. 8 primer sets.Therefore, the assortment of genes of our preferably No. 5 primer sets is used for the detection of gastric cancer.
Further by studying discovery, in No. 5 primer sets, EPCAM is a kind of molecular weight by GA-733-2 gene codes
For the transmembrane glycoprotein of 40kDa, as homophilic calcium dependent/non-dependent epithelial cell between adhesion molecule in carcinogenesis process
In play and act on.CEA epitopes are glycoprotein, and the sugar of the infiltration of tumor cell and transfer with glycoprotein
Baseization changes relevant.The albumen of CMET codings belongs to the receptor family of tyrosine kinase growth factor, and malignant turns in vitro
It can be activated to swash positioned at intracellular after can occurring gene amplification, rearrangement and overexpression .EGFR dimerization during change
Enzyme path, including the activation such as Y992, Y1045, Y1068, Y1148 and Y1173 site.This autophosphorylation can be guided down
The phosphorylation of trip, including MAPK, Akt and JNK paths, induced cell proliferation.MUC1 is by the high sugar of one kind of muc1 gene expressions
Base (saccharifying is more than 50%), also known as membrane albumen, is transmembrane molecule, and it is updated and differentiation in epithelium, maintains epithelial integrity
All play an important role with the aspect such as the generation and transfer of cancer.From the foregoing, it will be observed that the present invention is not to carry out simply 9 pairs of primers
Stack combinations, 9 pairs of primers complement each other, and functionally support one another so that recall rate is improved significantly, and achieve imaginary
Less than technique effect.In sum, in the present invention, the gene that selects is related to the aspects such as the metabolism of tumor, propagation, invasion and attack, can be compared with
Comprehensively to detect the cell biological characteristics of gastric cancer.
Embodiment 4：Specificity analyses
According to the selection result of embodiment 2, using the primer sets described in upper table to normal person's peripheral blood sample, non-gastric cancer
The peripheral blood and tumor tissues sample of people, the peripheral blood of Patients with Gastric Cancer and tissue samples are detected.As a result as Figure 1-5,
As seen from the figure described primer sets in normal human peripheral blood, the peripheral blood of non-Patients with Gastric Cancer and tumor tissues sample not or
The weaker expression for detecting gene, and the strong table of multiple genes is can detect that in the peripheral blood and tissue samples of Patients with Gastric Cancer
Reach, illustrate that heretofore described primer sets have the specificity of height.
Claims (3)
1. a kind of primer sets for detecting gastric cancer, it is characterised in that the primer sets comprising a～i 9 to primer, the primer
The forward primer of a as shown in SEQ ID No.1, the reverse primer of primer a as shown in SEQ ID No.2, the forward primer of primer b
As shown in SEQ ID No.3, the reverse primer of primer b as shown in SEQ ID No.4, the forward primer such as SEQ ID of primer c
Shown in No.5, as shown in SEQ ID No.6, the forward primer of primer d draws as shown in SEQ ID No.7 the reverse primer of primer c
As shown in SEQ ID No.8, as shown in SEQ ID No.9, primer e's reversely draws the forward primer of primer e the reverse primer of thing d
Thing as shown in SEQ ID No.10, the forward primer of primer f as shown in SEQ ID No.11, the reverse primer such as SEQ of primer f
Shown in ID No.12, the forward primer of primer g as shown in SEQ ID No.13, the reverse primer such as SEQ ID No.14 of primer g
It is shown, the forward primer of primer h as shown in SEQ ID No.15, the reverse primer of primer h as shown in SEQ ID No.16, primer
, as shown in SEQ ID No.17, the reverse primer of primer i is as shown in SEQ ID No.18 for the forward primer of i.
2. a kind of PCR detection method for detecting gastric cancer, it is characterised in that comprise the steps：
(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive,
Reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；Wherein, PCR reaction each circulation condition be 94 degrees Celsius,
30s；55 degrees Celsius, 30s；72 degrees Celsius, 10s；
(2) reverse transcription and PCR reactions are carried out, is detected with agarose gel electrophoresis method.
3. a kind of fluorescent quantitative PCR detection method for detecting gastric cancer, it is characterised in that comprise the steps：
(1) 9 pairs of primers described in claim 1 are added separately in single PCR reaction tubes, and add nucleic acid extractive,
Reverse transcription, RNase inhibitor, archaeal dna polymerase, dNTP；2 × ChamQ SYBR qPCR Master Mix are separately added into, its
In, the condition of each circulation of PCR reactions is 95 degrees Celsius, 10s and 60 degree Celsius, 30s；40 circulations；Often pipe sets up three
Multiple holes；
(2) reverse transcription and PCR reactions, and real-time detection fluorescence are carried out；
(3) the Ct values calculated according to fluoroscopic examination result, determine whether mark expression of target gene in sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610895859.2A CN106544416A (en) | 2016-10-14 | 2016-10-14 | A kind of primer sets and detection method for detecting gastric cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610895859.2A CN106544416A (en) | 2016-10-14 | 2016-10-14 | A kind of primer sets and detection method for detecting gastric cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106544416A true CN106544416A (en) | 2017-03-29 |
Family
ID=58368980
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610895859.2A Pending CN106544416A (en) | 2016-10-14 | 2016-10-14 | A kind of primer sets and detection method for detecting gastric cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106544416A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987649A (en) * | 2017-05-31 | 2017-07-28 | 上海博慷生物科技有限公司 | A kind of primer sets and detection method for being used to detect glioma |
| CN113215663A (en) * | 2021-06-02 | 2021-08-06 | 中国科学院合肥物质科学研究院 | Construction method and primers of gastric cancer targeted therapy genome library based on high-throughput sequencing |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103237901A (en) * | 2010-03-01 | 2013-08-07 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarkers for theranostics |
-
2016
- 2016-10-14 CN CN201610895859.2A patent/CN106544416A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103237901A (en) * | 2010-03-01 | 2013-08-07 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarkers for theranostics |
Non-Patent Citations (3)
| Title |
|---|
| ABEER A BAHNASSY 等: "Circulating tumor and cancer stem cells in hepatitis C virus-associated liver disease", 《WORLD JOURNAL OF GASTROENTEROLOGY》 * |
| KATARINA KOLOSTOVA等: "Detection and cultivation of circulating tumor cells in gastric cancer", 《CYTOTECHNOLOGY》 * |
| 张静等: "cMET 基因与胃癌相关研究进展", 《中华病理学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987649A (en) * | 2017-05-31 | 2017-07-28 | 上海博慷生物科技有限公司 | A kind of primer sets and detection method for being used to detect glioma |
| CN113215663A (en) * | 2021-06-02 | 2021-08-06 | 中国科学院合肥物质科学研究院 | Construction method and primers of gastric cancer targeted therapy genome library based on high-throughput sequencing |
| CN113215663B (en) * | 2021-06-02 | 2023-04-25 | 中国科学院合肥物质科学研究院 | Construction method of gastric cancer targeted therapy genome library based on high-throughput sequencing and primers |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Allan et al. | Circulating tumor cell analysis: technical and statistical considerations for application to the clinic | |
| CN104726570B (en) | The kit of lncRNA NEAT1 and its application in liver cancer serum diagnosis in a kind of detection serum | |
| Economopoulou et al. | Liquid biopsy: an emerging prognostic and predictive tool in head and neck squamous cell carcinoma (HNSCC). Focus on circulating tumor cells (CTCs) | |
| MX2008011839A (en) | Propagation of primary cells. | |
| CN104152452B (en) | A kind of blood miRNA marker relevant to hepatocarcinoma and application thereof | |
| US20070048750A1 (en) | Rapid efficacy assessment method for lung cancer therapy | |
| CN103074430B (en) | Special primer, kit and method for testing miRNA-155 in bladder cancer urine | |
| CN103074431B (en) | Special primer, kit and method for testing minRNA-128 in colorectal cancer serum | |
| Zhang et al. | Association of chemotactic factor receptor 5 gene with breast cancer | |
| CN109234394A (en) | A kind of diagnosing cancer of liver marker and its screening technique | |
| CN106191055A (en) | A kind of non-small cell lung carcinoma marker, detectable and test kit | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| Wei et al. | Clinical significance of circulating tumor cell (CTC)-specific microRNA (miRNA) in breast cancer | |
| CN106544416A (en) | A kind of primer sets and detection method for detecting gastric cancer | |
| CN106399527A (en) | Primer group for detecting renal cancer and detecting method thereof | |
| CN107287345B (en) | Detection kit for accurate diagnosis and treatment of acute myeloid leukemia and TSEN34 clinical application | |
| CN106520924A (en) | Primer set and detection method for detecting ovarian cancer | |
| Shimazui et al. | Detection of cadherin-6 mRNA by nested RT-PCR as a potential marker for circulating cancer cells in renal cell carcinoma | |
| CN106755309A (en) | Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared | |
| CN106755459A (en) | A kind of primer sets and detection method for detecting breast cancer | |
| CN113337613B (en) | Serum exosome tsRNA marker related to liver cancer, probe and application thereof | |
| CN106434936A (en) | Primer group used for detecting lung cancer and detection method thereof | |
| CN106498041A (en) | A kind of primer sets and detection method for detecting cervical cancer | |
| KR101594735B1 (en) | Composition for early diagnosis of obesity and uses thereof | |
| CN106834447A (en) | A kind of primer sets and detection method for detecting neuroblastoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170329 |
|
| RJ01 | Rejection of invention patent application after publication |