CN109929845A

CN109929845A - A kind of double sites sgRNA knock out the CRISPR/Cas9 system and application of RSPH6A gene

Info

Publication number: CN109929845A
Application number: CN201910242004.3A
Authority: CN
Inventors: 赵恩峰; 贺小宏; 王延宾; 任江涛; 韩露
Original assignee: Nanjing North Heng Biological Technology Co Ltd
Current assignee: Nanjing North Heng Biological Technology Co Ltd
Priority date: 2019-03-28
Filing date: 2019-03-28
Publication date: 2019-06-25

Abstract

The invention belongs to technical field of bioengineering, in particular to tumour occurs, develop related gene knockout technique, the CRISPR/Cas9 system and application of RSPH6A gene are knocked out more particularly to a kind of double sites sgRNA, double site knocks out method to the present invention for the first time, using two sgRNA sequences of design on same exon, it is cut for two sites on the exon, RSPH6A gene can efficiently be knocked out, and only need PCR, electrophoresis can be determined whether to knock out successfully, greatly reduce appraisal cost after knocking out, and there was only a kind of saltant type after knocking out, considerably increase the stability for knocking out result；The CRISPR/Cas9 system transfections cell of the sgRNA will be contained, can get the cell strain for knocking out RSPH6A gene.

Description

A kind of double sites sgRNA knock out the CRISPR/Cas9 system and application of RSPH6A gene

Technical field

The invention belongs to technical field of bioengineering, in particular to tumorigenesis related gene knockout technique, specifically It is related to the CRISPR/Cas9 system and application of a kind of double site sgRNA knockout RSPH6A genes.

Background technique

The protein-based of RSPH6A (6 homolog A of radial spoke head) gene coding is similar to sea urchin radial spoke Noggin.Radial radiation albumen composition forms a part of eukaryon axoneme, outer ring and center positioned at two-tube micro-pipe Micro-pipe pair between.Radial radiation albumen can adjust the activity of dynein and the symmetry of flagellum beam mode, in tumour Important left and right is played in transfer process, it is the diagnosis of tumour that further investigation RSPH6A, which helps to find the important mechanisms of metastases, New thinking is provided with treatment, while being also the important investigation of tumour novel marker.

CRISPR/Cas system is a kind of adaptive immunity defence that bacterium and archeobacteria are formed during long-term evolution, It can be used to eliminate the virus and exogenous DNA of invasion.CRISPR/Cas system, which passes through, will invade bacteriophage and the segment of Plasmid DNA is whole It closes in CRISPR, and instructs the degradation of homologous sequence using corresponding CRISPRRNAs (crRNAs), to provide immune Property.The working principle of this system is that crRNA (CRISPR-derivedRNA) passes through base pairing and tracrRNA (trans- ActivatingRNA) combine form tracrRNA/crRNA compound, this compound guide nuclease Cas9 albumen with The sequence target site of crRNA pairing shears double-stranded RNA.By both RNA of engineer, being transformed to be formed, there is guidance to make SgRNA (shortguideRNA), guidance Cas9 carry out fixed point cutting to DNA's, and CRISPR/Cas system has operation letter The features such as list, shear efficiency is high.

Currently, CRISPR/Cas gene Knockout is widely used to the experiment mould such as drosophila, rat, mouse, zebra fish Type.Traditional knockout technique uses a sgRNA, is knocked out for a site, although high-efficient, DNA is independently repaired It is uncertain high, and lack 1 base and be unsuitable for identifying, it generally requires largely to be sequenced, substantial contribution is spent to be identified.

Summary of the invention

The present invention solves the above-mentioned technical problems in the prior art, provides a kind of double site sgRNA knockout RSPH6A The CRISPR/Cas9 system and application of gene.

To solve the above problems, technical scheme is as follows:

A kind of sgRNA knocking out RSPH6A gene, including RSPH6A sgRNA-1 and RSPH6A sgRNA-2；

The sequence of the RSPH6A sgRNA-1 is as follows:

RSPH6A sgRNA-1:TCTTTCGGGCGTTCACGATC；(SEQ ID No.1)

RSPH6A sgRNA-1 oligo1:5 '-caccgTCTTTCGGGCGTTCACGATC-3 '；(SEQ ID No.2)

RSPH6A sgRNA-1 oligo2:5 '-aaacGATCGTGAACGCCCGAAAGAc-3 '；(SEQ ID No.3)

The sequence of the RSPH6A sgRNA-2 is as follows:

RSPH6A sgRNA-2:GGCCCAGATAGCCCGCATCT；(SEQ ID No.4)

RSPH6A sgRNA-2 oligo1:5 '-caccgGGCCCAGATAGCCCGCATCT-3 '；(SEQ ID No.5)

RSPH6A sgRNA-2 oligo2:5 '-aaacAGATGCGGGCTATCTGGGCCc-3 '.(SEQ ID No.6)

A kind of CRISPR/Cas9 system of the double site sgRNA targeting knockout RSPH6A genes, including the RSPH6A The DNA sequence dna of sgRNA-1 and RSPH6A sgRNA-2.

A kind of construction method of the CRISPR/Cas9 system of the double site sgRNA targeting knockout RSPH6A genes, including it is following Step:

Step 1, the carrier using BsmbI digestion CRISPR/Cas9 carrier LentiCRISPR V2, after obtaining digestion；

It step 2, will be after the DNA sequence dna phosphorylation of the sgRNA of the targeting knockout RSPH6A gene and after digestion The connection of LentiCRISPR-V2 carrier, obtains the LentiCRISPR V2-RSPH6A of targeting knockout RSPH6A gene SgRNA-1&LentiCRISPR V2-RSPH6A sgRNA-2 constructs the CRISPR/Cas9 system of targeting knockout RSPH6A gene System.

The CRISPR/Cas9 system of the targeting knockout RSPH6A gene can be used for preparing the cell for knocking out RSPH6A gene Strain.

A kind of cell strain knocking out RSPH6A gene, the cell strain are with double sites sgRNA targeting knockout The CRISPR/Cas9 system of RSPH6A gene carries out the cell strain of the RSPH6A gene delection in the cell that targeting knockout obtains.

Preferably, the cell strain is A549 cell strain.

Preferably, the A549 cell strain is people's non-small cell lung cancer cell A549.

Preferably, the specific targeting knockout site of the RSPH6A gene are as follows:

AGGATGTGCTGTGTGTGATGCACCCAGTTGGCCATGGAGTCGACCAGCTCCAGCACGGGGATGCCCTC GAAGTCCGGGTTCTCCTCGTAGGAGTCGCGCCCAGCACCACCTTCCTCCTCCTCGTCGCCCTCCTCCTCACTAAAC TGGTAGAAGCCCAGCGGGCTGACCTGCGTGGCGGCCAGAT------------------------------------- ------------------------------------------------------TCTCGGGCTGGAGTGACGTGGG GCAGCCGCGTCCATGGCAGGCCCGGCTCGTTGCACACAAAGTACAGGTACTTGTTGGCGCCTGAGCGGCTCTCCTC CTTGGGGATCACGGGCGGCGGCTTCCATACGGACTTAGGGACGATGTCCACGGCCTTCTCCTCGTCCTCCTCGCCC TCCTCCTCGCCGTGCGCCTCCATGACCTCGCCACCTTCCGTCATCTCCTCCACCTCCTCCTCCTCTGCCTCCTCCT CGCCCTCCCGGAATTCCACCTCGGCCACCAGGTAGCTGCGTTTGATTCCCAGGAT。(SEQ ID No.10)

The preparation method of the cell strain for knocking out RSPH6A gene, comprising the following steps: turn the plasmid containing sgRNA Dye obtains the cell strain for knocking out RSPH6A gene to cell strain；

The identification method of the double site sgRNA targeting knockout RSPH6A genes are as follows:

Step A discharges cell genomic dna using alkaline lysis lytic cell；

Step B, using PCR amplification and detected through gel electrophoresis.

Preferably, the primer of the PCR amplification are as follows:

hsRSPH6A-jc-F:AGGATGTGCTGTGTGTGATG；(SEQ ID No.7)

hsRSPH6A-jc-R:ATCCTGGGAATCAAACGC。(SEQ ID No.8)

Compared with the existing technology, advantages of the present invention is as follows,

The present invention designs two sgRNA sequences on same exon, is cut for two sites on the exon, Only needing PCR, electrophoresis i.e. can be determined whether to knock out successfully, greatly reduce appraisal cost after knockout, and only have after knocking out a kind of prominent Modification considerably increases the stability for knocking out result；

The prior art generally uses unit point to knock out method, and the present invention knocks out method using double site；

RSPH6A sgRNA-1&RSPH6A sgRNA-2 of the invention knocks out high-efficient.

Detailed description of the invention

Fig. 1 is LentiCRISPR V2-RSPH6A sgRNA-1&LentiCRISPR V2-RSPH6A sgRNA-2 sequencing As a result；

Fig. 2 is that alkaline lysis identifies corotation LentiCRISPR V2-RSPH6A sgRNA-1&LentiCRISPR V2- RSPH6A sgRNA-2 electrophoretogram；Wherein M is DNA Marker ,-be negative control ,+is corotation double-mass model

Fig. 3 is that alkaline lysis identifies corotation LentiCRISPR V2-RSPH6A sgRNA-1&LentiCRISPR V2- RSPH6A sgRNA-2 monoclonal electrophoretogram；Wherein+it is A549 control group, M is DNA Marker, 1 is A549-RSPH6A 1,2 For A549-RSPH6A 2；

Fig. 4 is fluorescence quantitative PCR detection A549 cell RSPH6A mRNA expression；Wherein actin is reference gene expression pair According to group；RSPH6A group is to knock out gene expression experiment group；A549 is that RSPH6A gene does not knock out group, A549-RSPH6A 1 is RSPH6A gene knockout group and negative control group；

Fig. 5 is gene knockout sequencing result；Wherein A549 is negative control sequencing result, A549-RSPH6A 1&A549- RSPH6A 2 is gene knockout group sequencing result；

Fig. 6 is RSPH6A Genomic sequence information；Wherein segment 2 is the genetic fragment information that knockout group knocks out.

Specific embodiment

Embodiment 1:

1. knocking out RSPH6A plasmid using the building of CRISPR/Cas9 technology

The synthesis of 1.1sgRNA oligonucleotide chain

Using CRISPR Photographing On-line tool (http://crispr.mit.edu/) according to points-scoring system, exist respectively The sgRNA of 2 20bp is designed on 3 exons of RSPH6A.The core sequence on exon is found according to this two standards: RSPH6A sgRNA-1 and RSPH6A sgRNA-2.The end of coding strand template 5 ' addition CACCG, the addition of the end of noncoding strand template 3 ' AAAC, C is added at 5 ' ends, complementary with the cohesive end formed after BsmbI digestion, designs 2 pairs of CRISPR oligonucleotide chains.

RSPH6A target site and sgRNA oligonucleotide sequence

RSPH6A sgRNA-1 oligo1:5 '-caccgTCTTTCGGGCGTTCACGATC-3 '；(SEQ ID No.2)

RSPH6A sgRNA-1 oligo2:5 '-aaacGATCGTGAACGCCCGAAAGAc-3 '；(SEQ ID No.3)

RSPH6A sgRNA-2 oligo1:5 '-caccgGGCCCAGATAGCCCGCATCT-3 '；(SEQ ID No.5)

RSPH6A sgRNA-2 oligo2:5 '-aaacAGATGCGGGCTATCTGGGCCc-3 '；(SEQ ID No.6)

1.2 vector construction

1.2.1 use 1 μ g LentiCRISPR V2 plasmid of BsmbI digestion, 30min, 37 DEG C:

1.2.2 digested plasmid product is purified using Tiangeng plastic recovery kit, by specification is operated.

1.2.3 sg RNA oligo annealing and the formation of double-strand

1.2.4 LentiCRISPR V2&sgRNA connection, 16 DEG C of incubation 2h.

1.2.5 the plasmid after connection is converted into competent cell DH5 α, is uniformly applied to amp resistance LB solid medium It in plate, is placed in 37 DEG C of incubators and cultivates 12-16 hours, single bacterium colony may occur in which.

1.2.6 picking single bacterium colony expands culture and plasmid is small mentions.

1.2.7 sequencing identification plasmid construction success, is named as LentiCRISPR V2-RSPH6A sgRNA-1& LentiCRISPR V2-RSPH6A sgRNA-2.Fig. 1 is LentiCRISPR V2-RSPH6A sgRNA-1&LentiCRISPR V2-RSPH6A sgRNA-2 sequencing result.

1.3 liposome methods are by two plasmid 1:1 transfection cells (by the plasmid containing sgRNA&cas9 gene LentiCRISPR V2-RSPH6A sgRNA-1 transfects the cell strain for obtaining knocking out RSPH6A gene to A549 cell strain；It is described A549 cell strain be preferably Non-small cell lung carcinoma cell A549)

1.3.1 reagent to be mixed: A&B

1.3.2 the previous day complete medium (the DMEM in high glucose culture medium of 10% fetal calf serum) inoculating cell is mentioned, in 5% CO2 is cultivated in 37 DEG C of constant incubators；

1.3.3 transfection when cell reaches 70-90% convergence degree；

1.3.4 it is mixed well using 3000 reagent of opti-MEM lipofectamine R；

1.3.5 DNA liquid to be mixed is prepared using opti-MEM culture medium dilution DNA, then adds P3000^TMReagent is sufficiently mixed It is even；

1.3.6 dilution DNA is mixed into (1:1) with diluted 3000 reagent of lipofectamine R；

1.3.7 it is incubated for 5mins；

1.3.8 DNA- liposome complex is added into cell；

1.3.9 48-72h puromycin containing 1ng/ml (puro) complete medium resistance screening；

1.3.10 completely dead to control cell, use complete medium renewal cultivation instead 2-3 days；

1.3.11 it digests, collects cell for monoclonal and select & alkaline lysis PCR identification；

1.3.12 to corotation LentiCRISPR V2-RSPH6A sgRNA-1&LentiCRISPR V2-RSPH6A There are two bands in sgRNA-2 plasmid A549 result such as Fig. 2: PCR, wherein 2 cut jointly for double site, leads to gene piece Section missing 116bp, 1 cuts for unit point or cutting genetic fragment size does not occur and can not judge.Such method is after PCR is identified Whether generation cutting is very clear, double bands such as occurs, and the smaller band small 116bp of segment than expected, then two on the gene A site is cut, and qualification time is shortened, and reduces appraisal cost.

1.4 limiting dilution assays choose monoclonal

1.4.1 dispense 0.1 milliliter of every hole A549 cell 96 porocyte culture plates (can shift to an earlier date 24 hours it is ready, set CO₂It is spare in incubator)

1.4.2 the cell (can also collect from 24 well culture plate holes) to grow fine is collected from Tissue Culture Flask, is made Suspension

1.4.3 by white blood cell count(WBC) method accurately based on cell suspension cell number, generally 10⁵/ milliliter or so

1.4.4 3 10 milliliters of graduated centrifuge tubes is taken to be arranged on superclean bench rack for test tube, it first will with serum free medium Cell is diluted to 10³/ milliliter, then 10 are diluted to the complete medium containing 15% calf serum¹/ milliliter cell, i.e., every 0.1 milli Rise 1 cell

1.4.5 0.1 milliliter of every hole cell suspension

1.4.6 37 DEG C of 5%CO are set₂Incubator takes out observation, and covers and mark in plate, make a record and unite after 4 days Count result

When 1.4.7 continuing culture, in the 4-5 days 1/2 culture mediums of replacement

1.4.8 about the 7-9 days selection monoclonals grow hole, well-grown, and positive powerhouse is transferred to 24 orifice plates and clones again Cultivated or expanded culture

1.4.9 experimental result counts clone's percentage to occur clone hole in total cell hole (such as 96 holes), and can be into one Step calculates separately out percentage by slender hilum, double cell holes, many cells hole.

1.5 alkaline lysis identify Knockout cells strain

1.5.1 design synthesis PCR identifies primer

hsRSPH6A-jc-F:AGGATGTGCTGTGTGTGATG(SEQ ID No.7)

hsRSPH6A-jc-R:ATCCTGGGAATCAAACGC(SEQ ID No.8)

1.5.2 50uM NaOH, 8.0 trisHCl of 1M PH are configured；

1.5.3 the cell digested >=5000rpm is centrifuged 1~3 minute, abandons supernatant；

1.5.4 add 50ul 50uM NaOH to centrifugation bottom of the tube；

1.5.5 it 95 DEG C/boil 10~30 minutes, is cooled to room temperature；

1.5.6 be added 8.0 tris-HCl of 10%1M PH in and solution；

1.5.7 12000rpm is centrifuged 5min, draws supernatant and is used for subsequent experimental；

1.5.8 PCR is detected

1.5.9 2% agarose gel electrophoresis 120v 20-25min；

1.5.10 electrophoretic band send sequencing than compareing the sample of small 116bp or so；

Alkaline lysis identifies corotation LentiCRISPR V2-RSPH6A sgRNA-1&LentiCRISPR V2-RSPH6A SgRNA-2 monoclonal electrophoretogram is as shown in Figure 3；Wherein+it is A549 control group, M is DNA Marker, 1 is A549-RSPH6A 1,2 be A549-RSPH6A 2；

The result of fluorescence quantitative PCR detection A549 cell RSPH6A mRNA expression is as shown in Figure 4；Wherein actin is internal reference Gene expression control group；RSPH6A group is to knock out gene expression experiment group；A549 is that RSPH6A gene does not knock out group, A549- RSPH6A 1 is RSPH6A gene knockout group and negative control group；

Gene knockout sequencing result is as shown in Figure 5；Wherein A549 is negative control sequencing result, A549-RSPH6A 1& A549-RSPH6A 2 is gene knockout group sequencing result；

RSPH6A Genomic sequence information is as shown in Figure 6 (SEQ ID No.9)；Wherein segment 2 is the base that knockout group knocks out Because of piece segment information；RSPH6A genome sequence after knockout is as shown in SEQ ID No.10.

1.5.11 it is cut through sequencing identification 3 base positions before NGG of A549-RSPH6A 1&A549-RSPH6A 2 It cuts, multiple clones lack the piece segment information, avoid unit point missing uncertainty, keep gene knockout fixed point deletion operational It is stronger, while identification method is simplified, the time is not only saved, but also reduce cost.

Fig. 5, Fig. 6 can be seen that the gene order segment knocks out successfully on genome, through mRNA reverse transcription quantitative fluorescent PCR Identification, gene RSPH6A are not expressed, and have achieved the purpose that gene knockout.

It should be noted that above-described embodiment is only presently preferred embodiments of the present invention, there is no for the purpose of limiting the invention Protection scope, the equivalent substitution or substitution made on the basis of the above all belong to the scope of protection of the present invention.

Sequence table

<110>Nanjing Bei Heng Biotechnology Co., Ltd

<120>a kind of double sites sgRNA knock out the CRISPR/Cas9 system and application of RSPH6A gene

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213>people (Homo sapiens)

<400> 1

tctttcgggc gttcacgatc 20

<210> 2

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

caccgtcttt cgggcgttca cgatc 25

<210> 3

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

aaacgatcgt gaacgcccga aagac 25

<210> 4

<211> 20

<212> DNA

<213>people (Homo sapiens)

<400> 4

ggcccagata gcccgcatct 20

<210> 5

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

caccgggccc agatagcccg catct 25

<210> 6

<211> 25

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

aaacagatgc gggctatctg ggccc 25

<210> 7

<211> 20

<212> DNA

<213>people (Homo sapiens)

<400> 7

aggatgtgct gtgtgtgatg 20

<210> 8

<211> 18

<212> DNA

<213>people (Homo sapiens)

<400> 8

atcctgggaa tcaaacgc 18

<210> 9

<211> 605

<212> DNA

<213>people (Homo sapiens)

<400> 9

aggatgtgct gtgtgtgatg cacccagttg gccatggagt cgaccagctc cagcacgggg 60

atgccctcga agtccgggtt ctcctcgtag gagtcgcgcc cagcaccacc ttcctcctcc 120

tcgtcgccct cctcctcact aaactggtag aagcccagcg ggctgacctg cgtggcggcc 180

agatcgtgaa cgcccgaaag atcaagaagt tcttcacagg ctacctggac acgccagtcg 240

tcagctaccc acccttcccg ggcaacgagg ccaactacct gcgggcccag atagcccgca 300

tctcgggctg gagtgacgtg gggcagccgc gtccatggca ggcccggctc gttgcacaca 360

aagtacaggt acttgttggc gcctgagcgg ctctcctcct tggggatcac gggcggcggc 420

ttccatacgg acttagggac gatgtccacg gccttctcct cgtcctcctc gccctcctcc 480

tcgccgtgcg cctccatgac ctcgccacct tccgtcatct cctccacctc ctcctcctct 540

gcctcctcct cgccctcccg gaattccacc tcggccacca ggtagctgcg tttgattccc 600

aggat 605

<210> 10

<211> 489

<212> DNA

<213>people (Homo sapiens)

<400> 10

aggatgtgct gtgtgtgatg cacccagttg gccatggagt cgaccagctc cagcacgggg 60

atgccctcga agtccgggtt ctcctcgtag gagtcgcgcc cagcaccacc ttcctcctcc 120

tcgtcgccct cctcctcact aaactggtag aagcccagcg ggctgacctg cgtggcggcc 180

agattctcgg gctggagtga cgtggggcag ccgcgtccat ggcaggcccg gctcgttgca 240

cacaaagtac aggtacttgt tggcgcctga gcggctctcc tccttgggga tcacgggcgg 300

cggcttccat acggacttag ggacgatgtc cacggccttc tcctcgtcct cctcgccctc 360

ctcctcgccg tgcgcctcca tgacctcgcc accttccgtc atctcctcca cctcctcctc 420

ctctgcctcc tcctcgccct cccggaattc cacctcggcc accaggtagc tgcgtttgat 480

tcccaggat 489

Claims

1. a kind of sgRNA for knocking out RSPH6A gene, which is characterized in that including RSPH6A sgRNA-1 and RSPH6A sgRNA- 2；

The sequence of the RSPH6A sgRNA-1 is as follows:

RSPH6A sgRNA-1:TCTTTCGGGCGTTCACGATC；

RSPH6A sgRNA-1 oligo1:5 '-caccgTCTTTCGGGCGTTCACGATC-3 '；

RSPH6A sgRNA-1 oligo2:5 '-aaacGATCGTGAACGCCCGAAAGAc-3 '；

The sequence of the RSPH6A sgRNA-2 is as follows:

RSPH6A sgRNA-2:GGCCCAGATAGCCCGCATCT；

RSPH6A sgRNA-2 oligo1:5 '-caccgGGCCCAGATAGCCCGCATCT-3 '；

RSPH6A sgRNA-2 oligo2:5 '-aaacAGATGCGGGCTATCTGGGCCc-3 '.

2. a kind of CRISPR/Cas9 system of the double site sgRNA targeting knockout RSPH6A genes, which is characterized in that including right It is required that the DNA sequence dna of the 1 RSPH6A sgRNA-1 and RSPH6A sgRNA-2.

3. the building side of the CRISPR/Cas9 system of double sites sgRNA targeting knockout RSPH6A gene as claimed in claim 2 Method, which comprises the following steps:

4. the CRISPR/Cas9 system of targeting knockout RSPH6A gene knocks out RSPH6A base in preparation as described in Claims 2 or 3 Application in the cell strain of cause.

5. a kind of cell strain for knocking out RSPH6A gene, which is characterized in that the cell strain is with double described in claim 2 The CRISPR/Cas9 system of the site sgRNA targeting knockout RSPH6A gene carries out the RSPH6A in the cell that targeting knockout obtains The cell strain of gene delection.

6. knocking out the cell strain of RSPH6A gene as claimed in claim 5, which is characterized in that the cell strain is A549 cell Strain.

7. knocking out the cell strain of RSPH6A gene as claimed in claim 5, which is characterized in that the specific target of the RSPH6A gene To knockout site are as follows:

AGGATGTGCTGTGTGTGATGCACCCAGTTGGCCATGGAGTCGACCAGCTCCAGCACGGGGATGCCCTCGAAG TCCGGGTTCTCCTCGTAGGAGTCGCGCCCAGCACCACCTTCCTCCTCCTCGTCGCCCTCCTCCTCACTAAACTGGT AGAAGCCCAGCGGGCTGACCTGCGTGGCGGCCAGAT----------------------------------------- --------------TCTCGGGCTGGAGTGACGTGGGGCAGCCGCGTCCATGGCAGGCCCGGCTCGTTGCACACAAA GTACAGGTACTTGTTGGCGCCTGAGCGGCTCTCCTCCTTGGGGATCACGGGCGGCGGCTTCCATACGGACTTAGGG ACGATGTCCACGGCCTTCTCCTCGTCCTCCTCGCCCTCCTCCTCGCCGTGCGCCTCCATGACCTCGCCACCTTCCG TCATCTCCTCCACCTCCTCCTCCTCTGCCTCCTCCTCGCCCTCCCGGAATTCCACCTCGGCCACCAGGTAGCTGCG TTTGATTCCCAGGAT。

8. knocking out the preparation method of the cell strain of RSPH6A gene as claimed in claim 5, which is characterized in that including following step It is rapid:

By the plasmid transfection containing sgRNA to cell strain, the cell strain for knocking out RSPH6A gene is obtained.

9. a kind of identification method of the double site sgRNA targeting knockout RSPH6A genes, which comprises the following steps:

Step A discharges cell genomic dna using alkaline lysis lytic cell；

Step B, using PCR amplification and detected through gel electrophoresis.

10. identification method as claimed in claim 9, which is characterized in that the primer of the PCR amplification are as follows:

hsRSPH6A-jc-F:AGGATGTGCTGTGTGTGATG；

hsRSPH6A-jc-R:ATCCTGGGAATCAAACGC。