CN109929819A - The glucosyltransferase mutain of people a kind of and its application - Google Patents
The glucosyltransferase mutain of people a kind of and its application Download PDFInfo
- Publication number
- CN109929819A CN109929819A CN201910109436.7A CN201910109436A CN109929819A CN 109929819 A CN109929819 A CN 109929819A CN 201910109436 A CN201910109436 A CN 201910109436A CN 109929819 A CN109929819 A CN 109929819A
- Authority
- CN
- China
- Prior art keywords
- people
- seq
- glucosyltransferase
- mutain
- elisa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the glucosyltransferase mutain of people a kind of and its applications, using several Pancreas cancer patients as research case, genetic test is carried out to case and is analyzed, determine the mutain of the glucosyltransferase of people, genetic chip, monoclonal antibody and ELISA kit are prepared according to the glucosyltransferase mutain of the people, impulse is provided for the gene diagnosis of cancer of pancreas, to realize that the diagnosing and treating of cancer of pancreas provides scientific basic.
Description
Technical field
The present invention relates to the glucosyltransferase mutain of a kind of genetic engineering field more particularly to a kind of people and
It is applied.
Background technique
The sugar of glycosyl transferase catalytic activation in vivo is connected to different acceptor molecules, such as albumen, nucleic acid, widow
In sugar, rouge and small molecule, glycosylated product has many biological functions.Glucosyltransferase be in enzyme reaction only
Shift the enzyme of glucosyl group.The study found that the mutation of the glucosyltransferase of people and the generation of cancer of pancreas also have centainly
Relationship, whether detection glucosyltransferase mutate, and the application of the glucosyltransferase to mutation can
With to cancer of pancreas detection and treatment play positive effect.
Summary of the invention
It is an object of that present invention to provide the glucosyltransferase mutain of people a kind of and its applications.
Technical solution of the present invention includes:
In a first aspect, the glucosyltransferase mutain of people a kind of is provided, amino acid sequence such as SEQ ID NO:1 institute
Show.
Second aspect provides a kind of encoding gene of the mutain of the glucosyltransferase of people, nucleotides sequence
Column are as shown in SEQ ID NO:2.
The third aspect provides a kind of genetic chip, comprising: solid phase carrier and fixed nucleotide probe on this carrier；
Grape of the nucleotide probe according to the nucleotide sequence of the glucosyltransferase mutain of people described above, with people
The comparison result of the nucleotide sequence of the sugared normal albumen of glycosyl transferase determines.
Preferably, the nucleotide probe is base sequence shown in SEQ ID NO:3；
The nucleotide probe is base sequence shown in SEQ ID NO:4；
The nucleotide probe is base sequence shown in SEQ ID NO:5.
Fourth aspect provides a kind of reagent, contains the glucosyltransferase for detecting above-mentioned people in the reagent
The primer pair of mutain.
Preferably,
The primer pair includes the combination of following any upstream primers Yu following any downstream primers: upstream primer is such as SEQ ID
In NO:8 ~ NO:31 it is any shown in base sequence；Downstream primer is the alkali as shown in any in SEQ ID NO:32 ~ NO:38
Basic sequence.
5th aspect, provides a kind of monoclonal antibody of the glucosyltransferase mutain of specific recognition people,
It is prepared by above-mentioned reagent, it can be in conjunction with amino acid sequencespecific shown in SEQ ID NO:1.
6th aspect, provides a kind of for detecting the ELISA kit of the glucosyltransferase mutain of people, institute
Stating ELISA kit includes: the ELISA ELISA Plate, ELIAS secondary antibody, sample diluting liquid, coating for being coated with said monoclonal antibody
Buffer, ELISA ELISA Plate cleaning solution, developing solution and terminate liquid.
Preferably, the ELIAS secondary antibody is the Goat anti-Human IgG of diluted HRP horseradish peroxidase-labeled.
The present invention provides the glucosyltransferase mutain of people a kind of and its applications, by several Pancreas cancer patients
As research case, genetic test is carried out to case and is analyzed, determines the mutain of the glucosyltransferase of people, root
Genetic chip, monoclonal antibody and ELISA kit are prepared according to the glucosyltransferase mutain of the people, is cancer of pancreas
Gene diagnosis provide impulse, for realize cancer of pancreas diagnosing and treating scientific basic is provided.
The above description is only an overview of the technical scheme of the present invention, in order to better understand the technical means of the present invention,
And can be implemented in accordance with the contents of the specification, the following is a detailed description of the preferred embodiments of the present invention and the accompanying drawings.
Detailed description of the invention
Fig. 1 is a kind of comparison result schematic diagram that the embodiment of the present invention one provides；
Fig. 2 is a kind of genetic chip layout that the embodiment of the present invention one provides；
Fig. 3 is a kind of colour developing result schematic diagram provided by Embodiment 2 of the present invention；
Fig. 4 is another colour developing result schematic diagram provided by Embodiment 2 of the present invention；
Fig. 5 is a kind of standard curve for protein content that the embodiment of the present invention five provides；
Fig. 6 is a kind of Western blot testing result schematic diagram that the embodiment of the present invention five provides.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
The preparation of embodiment one, genetic chip
It is possible, firstly, to according to be application No. is " 201710429915.8 ", patent name " detection method of mutain a kind of and
Detection method described in the Chinese invention patent of device " determines the coding of the glucosyltransferase mutain of people
Gene, nucleotide sequence is as shown in SEQ ID NO:2；Correspondingly, the glucose glycosyl of people is determined according to the encoding gene
Transferase mutain, amino acid sequence is as shown in SEQ ID NO:1.
Secondly, realizing base as follows according to the glucosyltransferase mutain and its encoding gene of people
Because of the preparation of chip.
1, the design of nucleotide probe
(1) design of nucleotide probe: nucleotide probe is according to the nucleotides sequence of the glucosyltransferase mutain of people
Column determine with the comparison result of the nucleotide sequence of the normal albumen of glucosyltransferase of people, and according to following probe
Design principle, design for people glucosyltransferase mutain specificity nucleotide probe.
Wherein, the principle of nucleotide probe design is as follows:
Nucleotide probe Tm value should be close to the average Tm value of whole gene group, 5 DEG C of fluctuation up and down；
The duplicate single base of nucleotide probe intramolecular is continuously no more than 4；
G+C content is 40%-60%, reduces the specificity that non-specific hybridization guarantees hybridization；
4 bp should be less than with the bases longs of probe molecule internal stability secondary structure pairing in nucleotide probe sequences, this
Sample can guarantee that hybridization efficiency will not be influenced because of the secondary structure of nucleotide probe internal stability；
Similitude through Homology search and other sequences is less than 40%；
Continuously it is no more than 20 bases with the homologous fragment of non-probe alternative sequence by contrast.
Wherein, the corresponding amino acid sequence of glucosyltransferase mutain of people and the glucose glycosyl of people shift
The comparison result of the corresponding amino acid sequence of the normal albumen of enzyme is referring to FIG. 1, wherein, the Query sequence in Fig. 1 is the grape of people
The corresponding amino acid sequence of sugared glycosyl transferase mutain, Sbjct sequence is the normal albumen of glucosyltransferase of people
Corresponding amino acid sequence, the sequence between Query sequence and Sbjct sequence are comparison result, as can be seen from FIG. 1, the Portugal of people
Glucosyltransferase normal albumen of the grape sugar glycosyl transferase mutain relative to people, has occurred slotting at several positions
Enter, it is to be detected in order to specific recognition according to nucleotide sequence shown in SEQ ID NO:2 and the comparison result of Fig. 1
Whether the glucosyltransferase of object is mutated, then when choosing nucleotide probe, it can be according to following several
Any mode in mode designs nucleotide probe:
Choose the insertion nucleotides sequence column-generation nucleotide probe of insertion position；
Before insertion position, and/or, after insertion position, several nucleotide sequences are respectively selected, if by selection
Dry consecutive nucleotides and the insertion nucleotide sequence of insertion position generate nucleotide probe jointly, wherein the nucleotide of generation
The sequencing of adjacent nucleotide and its sequence consensus in the corresponding nucleotide sequence of mutain in probe；
Several nucleotide sequences are selected before insertion position, select several at the starting position of insertion position
Nucleotide sequence generates nucleotide probe；
Several nucleotide sequences are selected after insertion position, select several at the end position of insertion position
Nucleotide sequence generates nucleotide probe.
In the present embodiment, it the nucleotide sequence according to shown in SEQ ID NO:2 and is set according to above-mentioned nucleotide probe
Principle is counted, at least can be designed that following several preferably nucleotide probes in the manner described above:
As shown in SEQ ID NO:3, the nucleotide probe are as follows: taggtaagtc；
As shown in SEQ ID NO:4, the nucleotide probe are as follows: acagtatgct；
As shown in SEQ ID NO:5, the nucleotide probe are as follows: cagtatgcta.
(2) above-mentioned designed nucleotide probe the synthesis of nucleotide probe: is synthesized by nucleotide sequence.
2, the preparation for the genetic chip whether glucosyltransferase of detection people mutates
In order to guarantee the quality of test object sample, it is right also blank control, positive control and feminine gender need to be designed on genetic chip
According to.Wherein, the layout of the genetic chip can be at least a kind of layout as shown in Figure 2.In Fig. 2, is blank control, zero
For negative control,For positive control,For experimental group.
Wherein, the position of experimental group is the point sample position of nucleotide probe.
Point sample needed for negative internal reference Quality Control probe and positive control for point sample needed for blank control, negative control
Positive internal control Quality Control probe design it is as follows:
Blank control: the blank sampling liquid of any genetic fragment is free from as the contamination monitoring index in chip fabrication process.
Negative internal reference Quality Control probe: being one section does not have other genetic fragments of homology with detection gene, as hybridizing
The monitor control index of non-specific hybridization in journey, the nucleotide number that negative internal reference Quality Control probe includes can be with nucleotide probes
Base number is identical, can also be different.In the embodiment of the present invention, negative internal reference probe sequence needed for genetic chip can be with are as follows:
tgatgctgat aattgcat。
Positive internal control Quality Control probe: being one section of other genetic fragment for having homology with detection gene, in the glucose of people
In glycosyl transferase mutain, select sequence corresponding from nucleotide probe different, and can be with nucleotide probe base
Number is identical, and one section of nucleotide sequence that can also be different from the number of nucleotide probe base is visited as positive internal control Quality Control
Needle.Preferably, nucleotide number positive internal control Quality Control probe identical with the number of nucleotide probe base is chosen.The present invention is real
It applies in example, positive internal control probe sequence needed for genetic chip can be with are as follows: ttccttttat.
It should be noted that clicking and entering negative internal reference in the deposition process of genetic chip according to the layout of genetic chip and visiting
Needle and positive internal control probe solution；The spotting buffer (10% aqueous trehalose) that reagent used in blank control is 1 times.
The application of embodiment two, genetic chip
1, sample treatment
(1) the blood 1-3 mL of acquisition testing object.
(2) detection pair is added as detected sample processing tube in the 1.5 mL EP pipe for taking DEPC to handle in pipe
The 300 μ L of blood of elephant, adds 700 μ L of Trizol, mixes well, be placed at room temperature for 10 min.
(3) chloroform of 140 μ L is added, covers tightly pipe lid, firmly shakes, be placed at room temperature for 3-5 min, be placed in a centrifuge,
12000 r/ min, 4 DEG C of 15 min of centrifugation, it is careful to draw supernatant in centrifuge tube, the supernatant of absorption is transferred to clean centrifugation
Guan Zhong.
(4) isometric isopropanol is added in the centrifuge tube of supernatant in storing step (3), it is abundant gently overturns centrifuge tube
Liquid is mixed, is placed at room temperature for 10 min, 12000 r/ min, 4 DEG C of 15 min of centrifugation carefully suck all supernatants.
(5) it being cleaned once with the ethyl alcohol of 1 mL 75%, 7500 r/ min are centrifuged 15 min, all supernatants are carefully sucked,
10 μ L DEPC processing water dissolution is added in dry 15 min in super-clean bench.
(6) products therefrom will affect the labeling effciency and chip hybridization knot of probe if the purity of total serum IgE is not high for RNA
Fruit.So purifying total serum IgE using QIAGEN RNeasy Kit.
2, the first chain of cDNA and the second chain one-step synthesis method
(1) 2 μ g RNA is taken to configure following reaction solution in the centrifuge tube of 1.5 mL:
| Total serum IgE | The most 6.5 μ L of 2 μ g |
| T7 Promotor primer | 5 µL |
| RNase-free Water | X µL |
| Total volume | 11.5 µL |
Wherein, the additional amount X μ L of RNase-free Water is to subtract T7 Promotor according to 11.5 μ L of total volume
The 5 μ L of additional amount of primer, then subtract the additional amount of total serum IgE and calculate and get.
(2) 10 min, and 5 min of ice bath are kept the temperature at 65 DEG C, by 5 × First Strand B μ ffer at 65 DEG C
Preheat 5 min.
(3) following cDNA synthetic system is configured:
| 5×First Strand Buffer | 4 µL |
| 0.1 M DTT | 2 µL |
| 10 mM dNTP mix | 1 µL |
| MMLV RT | 1 µL |
| RNase OUT | 0.5 µL |
| Total volume | 8.5 µL |
(4) above-mentioned 8.5 μ L is added after mixing after being denaturalized in the RNA of ice bath.
(5) it is centrifuged after being mixed with pipette tips.
(6) 40 DEG C of 2 h of reaction.
3, aaUTP marks cRNA synthesis
The configuration of NTP:
| 100 mM ATP | 250 µL |
| 100 mM GTP | 250 µL |
| 100 mM CTP | 250 µL |
| 100 mM UTP | 187.5 µL |
| RNase free H2O | 62.5 µL |
| Total volume | 1000 µL |
It is spare to be distributed into 10 pipes, note: 50% PEG(polyethylene glycol) 40 DEG C of 1 min of heat preservation before use.Simultaneously by following operation
Configure Transcription mix；
(1) Transcription mix is configured
| RNase-free Water | 5.7 µL |
| 4×Transcription Buffer | 20 µL |
| NTP | 16 µL |
| 0.1 M DTT | 6 µL |
| 50% PEG | 6.4 µL |
| Aa-UTP(25 mM) | 4 µL |
| Inorganic Pyrophosphatase | 0.6 µL |
| T7 RNA Polymerase | 0.8 µL |
| Total volume | 60 µL |
(2) 60 μ L Transcription mix are added and mix.
(3) 60 DEG C of hot lid in PCR instrument, 40 DEG C of 2 h of reaction.
4, cRNA is purified
QIAGEN RNeasy Mini kit purifies cRNA, and specific method can be found in the operation that QIAGEN company provides with kit
Handbook.
(1) 20 μ LRNase free water are added, 350 μ L Buffer RLT are added and mix well.
(2) 250 μ L dehydrated alcohols are added, Tip mix well.
(3) total 700 solution of the μ L containing total serum IgE are transferred to and cover in the RNeasy pillar in 2 mL centrifuge tubes >=8000
G is centrifuged 15-30 s, discards filtered solution.
(4) >=8000 g centrifuge washing 15-30 ss abandoning is drawn in 500 μ L Buffer RPE to RNeasy mini pillars
Filtered solution is gone to be incited somebody to action again with 500 μ L Buffer RPE in the casing that 2 min of >=8000 g centrifuge washing discards filtered solution and 2 mL
RNeasy mini pillar is transferred in a 1.5 new mL Eppendorf pipes.
(5) water for drawing 30 μ L RNase free stands 1 min, 1 min of >=8000 g centrifugation elution.
(6) it is primary that step (5) are repeated.
5, cRNA concentration mensuration
With spectrophotometric analysis cRNA concentration.Need to measure the light absorption value at 260 nm and 280 nm to determine the concentration of sample
And purity, A260/A280 should close to 2.0 for purer cRNA(ratio 1.9-2.1 can also).
6, cRNA fluorescent marks；
(1) it takes above-mentioned 4 μ g of cRNA and is concentrated into 6.6 μ L.
(2) plus 10 μ L DMSO are mixed.
(3) add the sodium bicarbonate (NaHCO that the 0.3 M pH of 3.4 μ L is 9.03) and mix.
(4) above-mentioned 20 μ L cRNA mixture is added in fluorescent dye Cy3 and is mixed.25 DEG C of 1 h of heat preservation.
(5) 25 DEG C of 15 min of heat preservation after adding the 4 M Hydroxylamine of 9 μ L to mix.
7, fluorescent marker cRNA Sample Purification on Single
The process that specific steps are purified with cRNA in the step 4 of the present embodiment, this step are not repeating.
8, cRNA sample fragment and 4 × 44K of chip hybridization microarrays.
(1) according to the form below prepares fragmentation mixed liquor and then carries out fragmentation in 60 DEG C of 30 min of warm bath.
| Cy3 cRNA green fluorescence | 875 ng |
| 10×Blocking Agent | 11 µL |
| 25×Fragmentation Buffer | 2.2 µL |
| Nuclease-free water | X µL |
| Total volume | 55 µL |
(2) 55 μ L 2 × GEx Hybridization Buffer are added.
(3) it takes 100 μ L hybridization solutions to be added drop-wise on chip ware, while is added dropwise respectively in sky as shown in Figure 2 by chip layout
On white, negative, positive, experimental group position.It covers chip and is sealed in hybridizing box, 60 DEG C of rollings hybridize 16 h.
9, chip washs
Washing lotion 1(1 L) configuration:
| DEPC-H2O | 700 mL |
| 20×SSPE | 300 mL |
| 20% N-Lauroylsarcosine | 0.25 mL |
Washing lotion 2(1 L) configuration:
| DEPC-H2O | 997 mL |
| 20×SSPE | 3.0 mL |
| 20% N-Lauroylsarcosine | 0.25 mL |
Washing lotion 3:Stabilization and Drying Solution
(1) it takes out chip and washs 1 min in washing lotion 1；
(2) chip is put into washing lotion 2 again and washs 1 min(37 DEG C)；
(3) chip is finally washed into 30 s in washing lotion 3.
10, chip scanning
Chip is scanned in scanner, the glucosyltransferase albumen for determining test object according to scanning result is
It is no to be mutated.Please refer to Fig. 3 and Fig. 4, in result shown in Fig. 3, negative control redgreen fluorescence, positive control is green
Fluorescence shows that the sample quality of acquisition testing object is that there is no problem, and experimental group is green fluorescence, then showing detection pair
The glucosyltransferase albumen of elephant is mutated.In result shown in Fig. 4, negative control is colorless fluorescent, positive right
According to for green fluorescence, showing that the sample quality of acquisition testing object is that there is no problem, and experimental group redgreen fluorescence, then table
The glucosyltransferase albumen of bright test object does not mutate.
Embodiment three, specific recognition people glucosyltransferase mutain monoclonal antibody preparation
1, the determination of reagent
Contain the primer pair for detecting the glucosyltransferase mutain of above-mentioned people in the reagent.
Wherein, according to the ORF(of the normal albumen of the glucosyltransferase of people as shown in SEQ ID NO:6), it can be true
Make the corresponding base sequence of ORF of the normal albumen of glucosyltransferase of people (as shown in SEQ ID NO:7).
It is possible to further according to base sequence (such as SEQ ID NO:2 of the glucosyltransferase mutain of people
It is shown), and the corresponding base sequence of ORF (such as SEQ ID of the normal albumen of glucosyltransferase according to the people of people
Shown in NO:7), the primer pair designed includes the combination of following any upstream primers Yu following any downstream primers: upstream
Primer is the base sequence as shown in any in SEQ ID NO:8 ~ NO:31；Downstream primer is such as SEQ ID NO:32 ~ NO:
In 38 it is any shown in base sequence:
As shown in SEQ ID NO:8: aatctcaactaagaaaaagattgctaatgc
As shown in SEQ ID NO:9: attatgcatcttgctgtatccaggccttat
As shown in SEQ ID NO:10: tcttatagactatggacattttcaatataa
As shown in SEQ ID NO:11: ttctgtgagtcttggctttgctttgtgggg
As shown in SEQ ID NO:12: tgttcttggaatatcttgtgactgcgacct
As shown in SEQ ID NO:13: cctagggtcactggcattttgcttagctat
As shown in SEQ ID NO:14: aaattataaacagatggaactttaccacgc
As shown in SEQ ID NO:15: cttgccatttttttgctttttacttggcaa
As shown in SEQ ID NO:16: gtgttttaaaaaaggcctcaaaggaaaggg
As shown in SEQ ID NO:17: gtttgtgttgctagttaagctagcttgtat
As shown in SEQ ID NO:18: tgttgtggcttccttcgttctctgctggct
As shown in SEQ ID NO:19: gccattctttacagaaagggaacaaaccct
As shown in SEQ ID NO:20: gcaggttctaagaagactcttcccggttga
As shown in SEQ ID NO:21: tcgtggattatttgaggataaagtagccaa
As shown in SEQ ID NO:22: tatttggtgcagcttcaatgtctttctgaa
As shown in SEQ ID NO:23: gattaaggatattttgccacgtcacatcca
As shown in SEQ ID NO:24: attaataatgagcttttgttttacgttttt
As shown in SEQ ID NO:25: gagcctgcttcctgcatgcataaaattaat
As shown in SEQ ID NO:26: acttcagccctcttccaaaggattcaaatt
As shown in SEQ ID NO:27: tacactggttagctgtgcgctatcattctt
As shown in SEQ ID NO:28: tttattttctttccaagtacatgaaaaatc
As shown in SEQ ID NO:29: cattctcttggtgtcactaccagtctgctt
As shown in SEQ ID NO:30: agttttaagtgaaattccttttatgtctac
As shown in SEQ ID NO:31: ttggtttttacttgtgtcaacattt
As shown in SEQ ID NO:32: ctagaacaaatattgtataattctggaaag
As shown in SEQ ID NO:33: aaatgtaaaacatggaagatatttcctcac
As shown in SEQ ID NO:34: agaaatggaaaaggatttcaactgcagttc
As shown in SEQ ID NO:35: ttcttcagaagtcttttcaaatattgaaaa
As shown in SEQ ID NO:36: ggaagttacacaagctataaaaaatgccat
As shown in SEQ ID NO:37: tgttgtcacaacagagggcattaggagttc
As shown in SEQ ID NO:38: atccttcaatagaagaggtagcat
In the present embodiment, the primer of the glucosyltransferase mutain in reagent containing one for detecting above-mentioned people
It is right.
For the primer pair (primer (F) and primer (R)) of each combination producing, following PCR amplification steps are executed.
2, the DNA of test object is that template carries out PCR amplification
| 10×Buffer | 5 uL |
| dNTP | 2 uL |
| Ex Taq | 1 uL |
| ddH2O | 5 uL |
| Template DNA | 1 uL |
| Primer (F) | 3 uL |
| Primer (R) | 3 uL |
| Total system | 20 uL |
PCR amplification is carried out by template of the DNA of test object, the glucosyltransferase mutating protein gene for obtaining people is complete
Segment, and connect pMD19-T Vector(Takara company), it is sequenced.Then antibody is prepared by special biotech firm,
It is a kind of humanization or Chimeric antibodies.Wherein, the monoclonal antibody prepared can be with amino acid sequence shown in SEQ ID NO:1
Column specific binding.The antibody of preparation is measured into content using ELISA method.
Example IV, the ELISA kit of glucosyltransferase mutain for detecting people
In the present embodiment, the composition of ELISA kit are as follows: be coated with monoclonal antibody described in embodiment three ELISA ELISA Plate,
ELIAS secondary antibody, sample diluting liquid, coating buffer, ELISA ELISA Plate cleaning solution, developing solution and terminate liquid.
Wherein, the parameter of above-mentioned each composition can be at least a kind of following parameter:
ELISA ELISA Plate can be the ELISA enzyme mark in 96 holes；
ELIAS secondary antibody can be diluted HRP(horseradish peroxidase) label Goat anti-Human IgG；Wherein, extension rate can
To be 8000 times.
Coating buffer can be 1 × PBS, pH:7.4；
ELISA ELISA Plate cleaning solution can be 1 × PBS solution containing 0.05% Tween-20；
Developing solution can be 3,3 ', 5,5 '-tetramethyl benzidines；
Terminate liquid can be the sulfuric acid solution of 2 mol/L.
Embodiment five
Research method: choosing men and women's Pancreas cancer patients totally 20, detects as test object, and using ELISA kit
Whether the glucosyltransferase albumen of 20 patients is mutated.
By taking wherein a certain position patient as an example, the detection method to the patient includes:
A, monoclonal antibody prepared by embodiment three is diluted using the coating buffer, for example, being diluted to 2.0 ug/
ML, and the monoclonal antibody after dilution is loaded into the hole of ELISA ELISA Plate, it is incubated at room temperature 1-2 h.
B, the glucosyltransferase albumen of patient is diluted to various concentration gradient using sample diluting liquid, and will not
Glucosyltransferase albumen with concentration gradient is loaded respectively into the hole of ELISA ELISA Plate, and is incubated at room temperature 1-2 h；
C, the liquid in each hole is got rid of, the ELISA ELISA Plate cleaning solution is added, washs and dries；
D, the ELIAS secondary antibody is added, and is incubated at room temperature 1-2 h；
E, the liquid in each hole is got rid of, ELISA ELISA Plate cleaning solution is added, washs and dries；
F, the developing solution is added, room temperature, which is protected from light, is incubated for 10-20 min, and the terminate liquid is added and terminates reaction；
G, it is the light absorption value at 450 nm that wavelength is measured in microplate reader.
H, make standard curve: using standard concentration as abscissa, the light absorption value of standard items measurement is ordinate, makees bid
Directrix curve；Calculate standard curve regression coefficient R2, work as R2This measurement is effective when > 0.99；Wherein it is possible to use ELISA Calc
The Software on Drawing standard curve can know regression coefficient R according to the ELISA Calc software2=0.99965, therefore, this survey
It is fixed effective.The wavelength that will test, which substitutes into standard curve for the light absorption value at 450 nm, can acquire the glucose glycosyl of patient
The concentration of transferase protein.Utilize glucosyltransferase albumen in the ELISA method detection patient serum sample of foundation
Content.And it is identified with Western blot.Referring to FIG. 5, corresponding to the standard curve of light absorption value for the patient.Wherein, X
Axis is light absorption value, and Y-axis is corresponding concentration.
I, Western blot is identified
1, glue
(1) it cleans glass plate and dries；
(2) reference molecule cloning process prepares SDS-PAGE glue:
A. lower layer's separation gel prepares system (Total Volum:15 mL)
| ddH2O | 5.9 mL |
| 30% acrylamide mixed liquor | 5.9 mL |
| 1.5 mol/L Tris(PH 8.8) | 3.8 mL |
| 10% SDS | 0.15 mL |
| 10% ammonium persulfate | 0.15 mL |
| TEMED | 0.006 mL |
B. upper layer spacer gel concentration preparation system (Total Volum:8 mL)
| ddH2O | 5.5 mL |
| 30% acrylamide mixed liquor | 1.3 mL |
| 1.0 mol/L Tris(PH 6.8) | 1.0 mL |
| 10% SDS | 0.08 mL |
| 10% ammonium persulfate | 0.08 mL |
| TEMED | 0.008 mL |
(3) lower layer's separation gel of respective volume is added in each offset plate, adds the sterile ddH of 1 mL2O flattens separation gel,
After gelling to be separated is solid, remaining moisture in plastic plate is blotted with filter paper, upper layer is then added, glue is concentrated, waited after being inserted into comb
Upper layer concentration gelling is solid.
2, albumen loading electrophoresis:
(1) comb is pulled up, duct label is carried out, 5 × SDS electrophoretic buffer is added, then to SDS- is added in protein sample
PAGE albumen sample-loading buffer (5 ×), boiling water bath heat 3-5 min, loading；
(2) electrophoresis first is carried out with 80 V voltages, after running concentration glue to band, uses 100 V voltages instead and run about 100 min.
3, transferring film and incubation:
(1) first pvdf membrane is activated in methyl alcohol about 30 s.Gel, foam-rubber cushion and pvdf membrane are delayed in electrotransfer in advance respectively
30 min are balanced in fliud flushing.It is clipped by filter paper-glue-film-filter paper sequence, is put into transferring film device according to principle of the black flour to black flour
In, it is added refrigerator (ice bag), about 120 min is run with the electric current of 150 mA in ice；
(2) it takes the film out, is put into 5% skim milk at once after the completion of, gently room temperature closes 1 h on shaking table；
(3) PBST cleaning closed film, cleans 3 times, every time 10 min；
(4) primary antibody for being diluted to corresponding multiple is added, 4 DEG C of shaking tables are incubated overnight；
(5) primary antibody is recycled, PBST is cleaned film 3 times, 10 min every time；
(6) secondary antibody (being diluted with 3% milk with 1:5000-1:10000) is incubated at room temperature 2 h of film；
(7) film 3 times are cleaned with PBST, every time 10 min；
(8) it after Pierce ECL Western Blotting Substrate kit A, B liquid mixes in equal volume, drips dropwise
It is added on pvdf membrane；
(9) exposure image in FluorChem E FE0511, experiment are analyzed with Image J.
Wherein, primary antibody is the glucosyltransferase mutain monoclonal antibody of the standby people of corporation, and secondary antibody is peppery
The Goat anti-Human IgG of root peroxidase labelling.
J, Western blot Analysis of test results: showing according to Western blot experimental procedure as a result, such as Fig. 6 institute
Show, wherein the Marker in Fig. 6 is used to characterize the size of labelled protein.It is only attached in 34 KD of experimental group compared with blank control
Closely there is obvious band, wherein the molecular weight of glucosyltransferase mutain is about 34 KD, shows the patient's
Glucosyltransferase albumen is implicitly present in mutation.
According to the studies above method, the probability that glucosyltransferase albumen mutates in 20 patients is 46%, by
This can determine that the abrupt climatic change of glucosyltransferase albumen there is certain guide to make the gene diagnosis of cancer of pancreas
With.
The above is only a preferred embodiment of the present invention, it is not intended to restrict the invention, it is noted that for this skill
For the those of ordinary skill in art field, without departing from the technical principles of the invention, can also make it is several improvement and
Modification, these improvements and modifications also should be regarded as protection scope of the present invention.
Claims (9)
1. the glucosyltransferase mutain of people a kind of, which is characterized in that its amino acid sequence such as SEQ ID NO:1 institute
Show.
2. a kind of encoding gene of the glucosyltransferase mutain of people, which is characterized in that its nucleotide sequence such as SEQ
Shown in ID NO:2.
3. a kind of genetic chip characterized by comprising solid phase carrier and fixed nucleotide probe on this carrier；It is described
The nucleotide sequence of the nucleotide probe glucosyltransferase mutain of people according to claim 2, the Portugal with people
The comparison result of the nucleotide sequence of the normal albumen of grape sugar glycosyl transferase determines.
4. genetic chip according to claim 3, which is characterized in that
The nucleotide probe is base sequence shown in SEQ ID NO:3；
The nucleotide probe is base sequence shown in SEQ ID NO:4；
The nucleotide probe is base sequence shown in SEQ ID NO:5.
5. a kind of reagent, which is characterized in that turn in the reagent containing the glucose glycosyl for detecting people described in claim 1
Move the primer pair of enzyme mutant albumen.
6. reagent according to claim 5, which is characterized in that
The primer pair includes the combination of following any upstream primers Yu following any downstream primers: upstream primer is such as SEQ ID
In NO:8 ~ NO:31 it is any shown in base sequence；Downstream primer is the alkali as shown in any in SEQ ID NO:32 ~ NO:38
Basic sequence.
7. a kind of monoclonal antibody of the glucosyltransferase mutain of specific recognition people, which is characterized in that by such as
Reagent described in claim 5 or 6 is prepared, can be in conjunction with amino acid sequencespecific shown in SEQ ID NO:1.
8. a kind of for detecting the ELISA kit of the glucosyltransferase mutain of people, which is characterized in that described
ELISA kit includes: to be coated with ELISA ELISA Plate, ELIAS secondary antibody, the sample dilution of monoclonal antibody described in claim 7
Liquid, coating buffer, ELISA ELISA Plate cleaning solution, developing solution and terminate liquid.
9. according to claim 8 for detecting the ELISA reagent of the antibody of the glucosyltransferase mutain of people
Box, which is characterized in that the ELIAS secondary antibody is the Goat anti-Human IgG of diluted HRP horseradish peroxidase-labeled.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910109436.7A CN109929819A (en) | 2019-02-10 | 2019-02-10 | The glucosyltransferase mutain of people a kind of and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910109436.7A CN109929819A (en) | 2019-02-10 | 2019-02-10 | The glucosyltransferase mutain of people a kind of and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109929819A true CN109929819A (en) | 2019-06-25 |
Family
ID=66985495
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910109436.7A Withdrawn CN109929819A (en) | 2019-02-10 | 2019-02-10 | The glucosyltransferase mutain of people a kind of and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109929819A (en) |
-
2019
- 2019-02-10 CN CN201910109436.7A patent/CN109929819A/en not_active Withdrawn
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109929819A (en) | The glucosyltransferase mutain of people a kind of and its application | |
| CN109182322A (en) | The Peptidyl prolyl cis-trans isomerases mutain of people a kind of and its application | |
| CN108424888A (en) | 1 mutain of serine palmitoyltransferase of people a kind of and its application | |
| CN108866024A (en) | ATP dependenc RNA unwindase DDX12 mutain and its application | |
| CN108559741A (en) | The imidazolone propionase mutain of people a kind of and its application | |
| CN109251918A (en) | The uroporphyrinogen decarboxylase mutain of people a kind of and its application | |
| CN108424902A (en) | The uroporphyrinogen decarboxylase mutain of people and its application | |
| CN109251903A (en) | The sub- compound subunit 10 mutain of 1 β of nadh dehydrogenase [coenzyme] and its application | |
| CN109022388A (en) | The ribonuclease P protein protomer P30 mutain of people a kind of and its application | |
| CN108424447A (en) | 1 mutain of cytochrome b-c1 complex subunits of people a kind of and application | |
| CN109781974A (en) | The vWF ELISA scinderin enzyme mutant albumen of people a kind of and its application | |
| CN108359657A (en) | The mannosidase β samples mutain of people a kind of and its application | |
| CN109824773A (en) | 8 albuminoid 3 of epidermal growth factor receptor kinase substrate of people is mutated and application | |
| CN109207449A (en) | The tRNA transmethylase mutain of people a kind of and its application | |
| CN108949715A (en) | 1 mutain of glutathione s-transferase κ of people a kind of and its application | |
| CN108795901A (en) | Receptor type tyrosine phosphoprotein phosphatase O hypotypes b precursors mutain and its application | |
| CN108795896A (en) | 1 mutain of tRNA transmethylases of people a kind of and its application | |
| CN109022391A (en) | Platelet-activating factor acetylhydrolase IB subunit γ mutain and its application | |
| CN108424885A (en) | The tRNA N6 adenosines threonyl Carbamoyl transferase mutains of people and its application | |
| CN108362888A (en) | The mannose transferase mutain of people a kind of and its application | |
| CN108424889A (en) | The 1 precursor mutain of albumen O- glucosyltransferases of people a kind of and its application | |
| CN109182323A (en) | Aldose -1- epimerase the mutain of people a kind of and its application | |
| CN109182289A (en) | The mitochondrial inner membrane translocase Tim17B mutain of people a kind of and application | |
| CN109251904A (en) | Nadh dehydrogenase (ubiquinone) 1, α/β Asia complex mutation albumen and its application | |
| CN108410828A (en) | 1 mutain of dehydrogenase SDR family members of people a kind of and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190625 |
|
| WW01 | Invention patent application withdrawn after publication |