CN109781974A - The vWF ELISA scinderin enzyme mutant albumen of people a kind of and its application - Google Patents

Abstract

The present invention relates to the vWF ELISA scinderin enzyme mutant albumen of people a kind of and its applications, using several Pancreas cancer patients as research case, genetic test is carried out to case and is analyzed, determine the mutain of the vWF ELISA scinderin enzyme of people, genetic chip, monoclonal antibody and ELISA kit are prepared according to the vWF ELISA scinderin enzyme mutant albumen of the people, impulse is provided for the gene diagnosis of cancer of pancreas, to realize that the diagnosing and treating of cancer of pancreas provides scientific basic.

Description

The vWF ELISA scinderin enzyme mutant albumen of people a kind of and its application

Technical field

The present invention relates to a kind of genetic engineering field more particularly to the vWF ELISA scinderin enzymes of people a kind of Mutain and its application.

Background technique

VWF ELISA (von Willebrand Factor, vWF) is compiled by the galianconism of No. 12 chromosome The glycoprotein of code.Its physiological action is activated together with platelet adhesion and mends in angiorrbagia on plug blood vessel Leak.This process is referred to as blood coagulation.The study found that the vWF ELISA scinderin enzyme (von of people Willebrand factor-cleaving protease, partial) mutation and cancer of pancreas generation also have it is certain Whether relationship, detection vWF ELISA scinderin enzyme mutate, and to the vWF ELISA of mutation The application of scinderin enzyme, can detection to cancer of pancreas and treatment play positive effect.

Summary of the invention

It is an object of that present invention to provide the vWF ELISA scinderin enzyme mutant albumen of people a kind of and its applications.

Technical solution of the present invention includes:

In a first aspect, providing the vWF ELISA scinderin enzyme mutant albumen of people a kind of, amino acid sequence such as SEQ Shown in ID NO:1.

Second aspect provides a kind of encoding gene of the mutain of the vWF ELISA scinderin enzyme of people, Its nucleotide sequence is as shown in SEQ ID NO:2.

The third aspect provides a kind of genetic chip, comprising: solid phase carrier and fixed nucleotide probe on this carrier； The nucleotide probe according to the nucleotide sequence of the vWF ELISA scinderin enzyme mutant albumen of people described above, It is determined with the comparison result of the nucleotide sequence of the normal albumen of vWF ELISA scinderin enzyme of people.

Preferably, the nucleotide probe is base sequence shown in SEQ ID NO:3；

The nucleotide probe is base sequence shown in SEQ ID NO:4；

The nucleotide probe is base sequence shown in SEQ ID NO:5.

Fourth aspect provides a kind of reagent, contains the vWF ELISA for detecting above-mentioned people in the reagent The primer pair of scinderin enzyme mutant albumen.

Preferably,

The primer pair includes the combination of following any upstream primers Yu following any downstream primers: upstream primer is such as SEQ ID In NO:8 ~ NO:12 it is any shown in base sequence；Downstream primer is the alkali as shown in any in SEQ ID NO:13 ~ NO:17 Basic sequence.

5th aspect, provides a kind of list of the vWF ELISA scinderin enzyme mutant albumen of specific recognition people Clonal antibody is prepared by above-mentioned reagent, can be in conjunction with amino acid sequencespecific shown in SEQ ID NO:1.

6th aspect, provides a kind of for detecting the vWF ELISA scinderin enzyme mutant albumen of people ELISA kit, the ELISA kit include: ELISA ELISA Plate, ELIAS secondary antibody, the sample for being coated with said monoclonal antibody Product dilution, coating buffer, ELISA ELISA Plate cleaning solution, developing solution and terminate liquid.

Preferably, the ELIAS secondary antibody is the Goat anti-Human IgG of diluted HRP horseradish peroxidase-labeled.

The present invention provides the vWF ELISA scinderin enzyme mutant albumen of people a kind of and its applications, will be several Pancreas cancer patients carry out genetic test to case and analyze, determine that the vWF ELISA of people is cut as research case The mutain for cutting protease, according to the vWF ELISA scinderin enzyme mutant albumen of the people prepare genetic chip, Monoclonal antibody and ELISA kit provide impulse for the gene diagnosis of cancer of pancreas, to realize the diagnosis of cancer of pancreas and controlling It treats and scientific basic is provided.

The above description is only an overview of the technical scheme of the present invention, in order to better understand the technical means of the present invention, And can be implemented in accordance with the contents of the specification, the following is a detailed description of the preferred embodiments of the present invention and the accompanying drawings.

Detailed description of the invention

Fig. 1 is a kind of comparison result schematic diagram that the embodiment of the present invention one provides；

Fig. 2 is a kind of genetic chip layout that the embodiment of the present invention one provides；

Fig. 3 is a kind of colour developing result schematic diagram provided by Embodiment 2 of the present invention；

Fig. 4 is another colour developing result schematic diagram provided by Embodiment 2 of the present invention；

Fig. 5 is a kind of standard curve for protein content that the embodiment of the present invention five provides；

Fig. 6 is a kind of Western blot testing result schematic diagram that the embodiment of the present invention five provides.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

The preparation of embodiment one, genetic chip

It is possible, firstly, to according to be application No. is " 201710429915.8 ", patent name " detection method of mutain a kind of and Detection method described in the Chinese invention patent of device " determines the vWF ELISA scinderin enzyme mutant of people The encoding gene of albumen, nucleotide sequence is as shown in SEQ ID NO:2；Correspondingly, determine people's according to the encoding gene VWF ELISA scinderin enzyme mutant albumen, amino acid sequence is as shown in SEQ ID NO:1.

Secondly, according to the vWF ELISA scinderin enzyme mutant albumen and its encoding gene of people, according to as follows Mode realizes the preparation of genetic chip.

1, the design of nucleotide probe

(1) design of nucleotide probe: nucleotide probe is according to the vWF ELISA scinderin enzyme mutant albumen of people Nucleotide sequence, come with the comparison result of the nucleotide sequence of the normal albumen of vWF ELISA scinderin enzyme of people It determines, and according to the design principle of following probe, designs the vWF ELISA scinderin enzyme mutant egg for people The nucleotide probe of white specificity.

Wherein, the principle of nucleotide probe design is as follows:

Nucleotide probe Tm value should be close to the average Tm value of whole gene group, 5 DEG C of fluctuation up and down；

The duplicate single base of nucleotide probe intramolecular is continuously no more than 4；

G+C content is 40%-60%, reduces the specificity that non-specific hybridization guarantees hybridization；

4 bp should be less than with the bases longs of probe molecule internal stability secondary structure pairing in nucleotide probe sequences, in this way Can guarantee that hybridization efficiency will not be influenced because of the secondary structure of nucleotide probe internal stability；

Similitude through Homology search and other sequences is less than 40%；

Continuously it is no more than 20 bases with the homologous fragment of non-probe alternative sequence by contrast.

Wherein, the blood vessel of vWF ELISA scinderin enzyme mutant the albumen corresponding amino acid sequence and people of people The comparison result of the property corresponding amino acid sequence of the normal albumen of christmas factor scinderin enzyme is referring to FIG. 1, wherein, in Fig. 1 Query sequence be people the corresponding amino acid sequence of vWF ELISA scinderin enzyme mutant albumen, Sbjct sequence It is the corresponding amino acid sequence of the normal albumen of vWF ELISA scinderin enzyme of people, Query sequence and Sbjct sequence Between sequence be comparison result, as can be seen from FIG. 1, the vWF ELISA scinderin enzyme mutant albumen of people relative to The normal albumen of vWF ELISA scinderin enzyme of people, is inserted into, according to SEQ ID NO:2 at several positions Shown in nucleotide sequence and Fig. 1 comparison result, in order to the von Willebrand disease of specific recognition object to be detected Whether factor scinderin enzyme is mutated, then when choosing nucleotide probe, it can be according in following several modes Any mode designs nucleotide probe:

Choose the insertion nucleotides sequence column-generation nucleotide probe of insertion position；

Before insertion position, and/or, after insertion position, several nucleotide sequences are respectively selected, if by selection Dry consecutive nucleotides and the insertion nucleotide sequence of insertion position generate nucleotide probe jointly, wherein the nucleotide of generation The sequencing of adjacent nucleotide and its sequence consensus in the corresponding nucleotide sequence of mutain in probe；

Several nucleotide sequences are selected before insertion position, select several at the starting position of insertion position Nucleotide sequence generates nucleotide probe；

Several nucleotide sequences are selected after insertion position, select several at the end position of insertion position Nucleotide sequence generates nucleotide probe.

In the present embodiment, it the nucleotide sequence according to shown in SEQ ID NO:2 and is set according to above-mentioned nucleotide probe Principle is counted, at least can be designed that following several preferably nucleotide probes in the manner described above:

As shown in SEQ ID NO:3, the nucleotide probe are as follows: tcactaggta；

As shown in SEQ ID NO:4, the nucleotide probe are as follows: cactaggtag；

As shown in SEQ ID NO:5, the nucleotide probe are as follows: accgaggttt.

(2) above-mentioned designed nucleotide probe the synthesis of nucleotide probe: is synthesized by nucleotide sequence.

2, the preparation for the genetic chip whether the vWF ELISA scinderin enzyme of detection people mutates

In order to guarantee the quality of test object sample, it is right also blank control, positive control and feminine gender need to be designed on genetic chip According to.Wherein, the layout of the genetic chip can be at least a kind of layout as shown in Figure 2.In Fig. 2, is blank control, zero For negative control,For positive control,For experimental group.

Wherein, the position of experimental group is the point sample position of nucleotide probe.

Point sample needed for negative internal reference Quality Control probe and positive control for point sample needed for blank control, negative control Positive internal control Quality Control probe design it is as follows:

Blank control: the blank sampling liquid of any genetic fragment is free from as the contamination monitoring index in chip fabrication process.

Negative internal reference Quality Control probe: being one section does not have other genetic fragments of homology with detection gene, as hybridizing The monitor control index of non-specific hybridization in journey, the nucleotide number that negative internal reference Quality Control probe includes can be with nucleotide probes Base number is identical, can also be different.In the embodiment of the present invention, negative internal reference probe sequence needed for genetic chip can be with are as follows: tgatgctgat aattgcat。

Positive internal control Quality Control probe: being one section of other genetic fragment for having homology with detection gene, in the vascular of people In christmas factor scinderin enzyme mutant albumen, select sequence corresponding from nucleotide probe different, and can be with nucleotide The number of probe base is identical, and one section of nucleotide sequence that can also be different from the number of nucleotide probe base is as in the positive Join Quality Control probe.Preferably, nucleotide number positive internal control Quality Control probe identical with the number of nucleotide probe base is chosen. In the embodiment of the present invention, positive internal control probe sequence needed for genetic chip can be with are as follows: acacggatcc.

It should be noted that clicking and entering negative internal reference in the deposition process of genetic chip according to the layout of genetic chip and visiting Needle and positive internal control probe solution；The spotting buffer (10% aqueous trehalose) that reagent used in blank control is 1 times.

The application of embodiment two, genetic chip

1, sample treatment

(1) the blood 1-3 mL of acquisition testing object.

(2) detection pair is added as detected sample processing tube in the 1.5 mL EP pipe for taking DEPC to handle in pipe The 300 μ L of blood of elephant, adds 700 μ L of Trizol, mixes well, be placed at room temperature for 10 min.

(3) chloroform of 140 μ L is added, covers tightly pipe lid, firmly shakes, be placed at room temperature for 3-5 min, be placed in a centrifuge, 12000 r/ min, 4 DEG C of 15 min of centrifugation, it is careful to draw supernatant in centrifuge tube, the supernatant of absorption is transferred to clean centrifugation Guan Zhong.

(4) isometric isopropanol is added in the centrifuge tube of supernatant in storing step (3), it is abundant gently overturns centrifuge tube Liquid is mixed, is placed at room temperature for 10 min, 12000 r/ min, 4 DEG C of 15 min of centrifugation carefully suck all supernatants.

(5) it being cleaned once with the ethyl alcohol of 1 mL 75%, 7500 r/ min are centrifuged 15 min, all supernatants are carefully sucked, 10 μ L DEPC processing water dissolution is added in dry 15 min in super-clean bench.

(6) products therefrom will affect the labeling effciency and chip hybridization knot of probe if the purity of total serum IgE is not high for RNA Fruit.So purifying total serum IgE using QIAGEN RNeasy Kit.

2, the first chain of cDNA and the second chain one-step synthesis method

(1) 2 μ g RNA is taken to configure following reaction solution in the centrifuge tube of 1.5 mL:

Total serum IgE	The most 6.5 μ L of 2 μ g
		T7 Promotor primer	5 µL
RNase-free Water	X µL
		Total volume	11.5 µL

Wherein, the additional amount X μ L of RNase-free Water is to subtract T7 Promotor according to 11.5 μ L of total volume The 5 μ L of additional amount of primer, then subtract the additional amount of total serum IgE and calculate and get.

(2) 10 min, and 5 min of ice bath are kept the temperature at 65 DEG C, by 5 × First Strand B μ ffer at 65 DEG C Preheat 5 min.

(3) following cDNA synthetic system is configured:

5×First Strand Buffer	4 µL
		0.1 M DTT	2 µL
10 mM dNTP mix	1 µL
		MMLV RT	1 µL
RNase OUT	0.5 µL
		Total volume	8.5 µL

(4) above-mentioned 8.5 μ L is added after mixing after being denaturalized in the RNA of ice bath.

(5) it is centrifuged after being mixed with pipette tips.

(6) 40 DEG C of 2 h of reaction.

3, aaUTP marks cRNA synthesis

The configuration of NTP:

100 mM ATP	250 µL
		100 mM GTP	250 µL
100 mM CTP	250 µL
		100 mM UTP	187.5 µL
RNase free H2O	62.5 µL
		Total volume	1000 µL

It is spare to be distributed into 10 pipes, note: 50% PEG(polyethylene glycol) 40 DEG C of 1 min of heat preservation before use.Simultaneously by following operation Configure Transcription mix；

(1) Transcription mix is configured

RNase-free Water	5.7 µL
		4×Transcription Buffer	20 µL
NTP	16 µL
		0.1 M DTT	6 µL
50% PEG	6.4 µL
		Aa-UTP(25 mM)	4 µL
Inorganic Pyrophosphatase	0.6 µL
		T7 RNA Polymerase	0.8 µL
Total volume	60 µL

(2) 60 μ L Transcription mix are added and mix.

(3) 60 DEG C of hot lid in PCR instrument, 40 DEG C of 2 h of reaction.

4, cRNA is purified

QIAGEN RNeasy Mini kit purifies cRNA, and specific method can be found in the operation that QIAGEN company provides with kit Handbook.

(1) 20 μ LRNase free water are added, 350 μ L Buffer RLT are added and mix well.

(2) 250 μ L dehydrated alcohols are added, Tip mix well.

(3) total 700 solution of the μ L containing total serum IgE are transferred to and cover in the RNeasy pillar in 2 mL centrifuge tubes >=8000 G is centrifuged 15-30 s, discards filtered solution.

(4) >=8000 g centrifuge washing 15-30 ss abandoning is drawn in 500 μ L Buffer RPE to RNeasy mini pillars Filtered solution is gone to be incited somebody to action again with 500 μ L Buffer RPE in the casing that 2 min of >=8000 g centrifuge washing discards filtered solution and 2 mL RNeasy mini pillar is transferred in a 1.5 new mL Eppendorf pipes.

(5) water for drawing 30 μ L RNase free stands 1 min, 1 min of >=8000 g centrifugation elution.

(6) it is primary that step (5) are repeated.

5, cRNA concentration mensuration

With spectrophotometric analysis cRNA concentration.Need to measure the light absorption value at 260 nm and 280 nm to determine the concentration of sample And purity, A260/A280 should close to 2.0 for purer cRNA(ratio 1.9-2.1 can also).

6, cRNA fluorescent marks；

(1) it takes above-mentioned 4 μ g of cRNA and is concentrated into 6.6 μ L.

(2) plus 10 μ L DMSO are mixed.

(3) add the sodium bicarbonate (NaHCO that the 0.3 M pH of 3.4 μ L is 9.0₃) and mix.

(4) above-mentioned 20 μ L cRNA mixture is added in fluorescent dye Cy3 and is mixed.25 DEG C of 1 h of heat preservation.

(5) 25 DEG C of 15 min of heat preservation after adding the 4 M Hydroxylamine of 9 μ L to mix.

7, fluorescent marker cRNA Sample Purification on Single

The process that specific steps are purified with cRNA in the step 4 of the present embodiment, this step are not repeating.

8, cRNA sample fragment and 4 × 44K of chip hybridization microarrays.

(1) according to the form below prepares fragmentation mixed liquor and then carries out fragmentation in 60 DEG C of 30 min of warm bath.

Cy3 cRNA green fluorescence	875 ng
		10×Blocking Agent	11 µL
25×Fragmentation Buffer	2.2 µL
		Nuclease-free water	X µL
Total volume	55 µL

(2) 55 μ L 2 × GEx Hybridization Buffer are added.

(3) it takes 100 μ L hybridization solutions to be added drop-wise on chip ware, while is added dropwise respectively in sky as shown in Figure 2 by chip layout On white, negative, positive, experimental group position.It covers chip and is sealed in hybridizing box, 60 DEG C of rollings hybridize 16 h.

9, chip washs

Washing lotion 1(1 L) configuration:

DEPC-H2O	700 mL
		20×SSPE	300 mL
20% N-Lauroylsarcosine	0.25 mL

Washing lotion 2(1 L) configuration:

DEPC-H2O	997 mL
		20×SSPE	3.0 mL
20% N-Lauroylsarcosine	0.25 mL

Washing lotion 3:Stabilization and Drying Solution

(1) it takes out chip and washs 1 min in washing lotion 1；

(2) chip is put into washing lotion 2 again and washs 1 min(37 DEG C)；

(3) chip is finally washed into 30 s in washing lotion 3.

10, chip scanning

Chip is scanned in scanner, determines that the vWF ELISA of test object cuts egg according to scanning result Whether white zymoprotein is mutated.Please refer to Fig. 3 and Fig. 4, in result shown in Fig. 3, negative control redgreen fluorescence is positive Control is green fluorescence, shows that the sample quality of acquisition testing object is that there is no problem, and experimental group is green fluorescence, then Show that the vWF ELISA scinderin zymoprotein of test object is mutated.It is negative right in result shown in Fig. 4 According to for colorless fluorescent, positive control is green fluorescence, shows that the sample quality of acquisition testing object is that there is no problem, and tests Group redgreen fluorescence, then showing that the vWF ELISA scinderin zymoprotein of test object does not mutate.

Embodiment three, specific recognition people vWF ELISA scinderin enzyme mutant albumen monoclonal antibody Preparation

1, the determination of reagent

Contain the primer pair for detecting the vWF ELISA scinderin enzyme mutant albumen of above-mentioned people in the reagent.

Wherein, according to the ORF(such as SEQ ID NO:6 institute of the normal albumen of vWF ELISA scinderin enzyme of people Show), it can determine corresponding base sequence (such as SEQ of ORF of the normal albumen of vWF ELISA scinderin enzyme of people Shown in ID NO:7).

It is possible to further according to the base sequence of the vWF ELISA scinderin enzyme mutant albumen of people (such as Shown in SEQ ID NO:2), and it is corresponding according to the ORF of the normal albumen of vWF ELISA scinderin enzyme of the people of people Base sequence (as shown in SEQ ID NO:7), the primer pair designed includes following any upstream primers and following The combination of one downstream primer: upstream primer is the base sequence as shown in any in SEQ ID NO:8 ~ NO:12；Downstream primer For the base sequence as shown in any in SEQ ID NO:13 ~ NO:17:

As shown in SEQ ID NO:8: ggtgctccaaatatcacagccaacctcacc

As shown in SEQ ID NO:9: tcgtccctgctgagcgtctgtgggtggagc

As shown in SEQ ID NO:10: cagaccatcaaccctgaggacgacacggat

As shown in SEQ ID NO:11: cctggccatgctgacctggtcctctatatc

As shown in SEQ ID NO:12: ctgacctggtcctctatatcact

As shown in SEQ ID NO:13: ctgtgcccaatctcatgggcaatggtgact

As shown in SEQ ID NO:14: cccaggtcgaagccagtgtcctcggtaatg

As shown in SEQ ID NO:15: aggcagctccaggttggggagcaggcaccg

As shown in SEQ ID NO:16: cccagctgggtgacgacccgcacctgccgg

As shown in SEQ ID NO:17: ttaccatcaggcaactccaggtcaaacct

In the present embodiment, it is used to detect the vWF ELISA scinderin enzyme mutant of above-mentioned people in reagent containing one The primer pair of albumen.

For the primer pair (primer (F) and primer (R)) of each combination producing, following PCR amplification steps are executed.

2, the DNA of test object is that template carries out PCR amplification

10×Buffer	5 uL
		dNTP	2 uL
Ex Taq	1 uL
		ddH2O	5 uL
Template DNA	1 uL
		Primer (F)	3 uL
Primer (R)	3 uL
		Total system	20 uL

PCR amplification is carried out by template of the DNA of test object, obtains the vWF ELISA scinderin enzyme mutant egg of people The white complete segment of gene, and connect pMD19-T Vector(Takara company), it is sequenced.Then by special biotech firm Antibody is prepared, is a kind of humanization or Chimeric antibodies.Wherein, the monoclonal antibody prepared can with shown in SEQ ID NO:1 Amino acid sequencespecific combine.The antibody of preparation is measured into content using ELISA method.

Example IV, the ELISA kit of vWF ELISA scinderin enzyme mutant albumen for detecting people

In the present embodiment, the composition of ELISA kit are as follows: be coated with monoclonal antibody described in embodiment three ELISA ELISA Plate, ELIAS secondary antibody, sample diluting liquid, coating buffer, ELISA ELISA Plate cleaning solution, developing solution and terminate liquid.

Wherein, the parameter of above-mentioned each composition can be at least a kind of following parameter:

ELISA ELISA Plate can be the ELISA enzyme mark in 96 holes；

ELIAS secondary antibody can be diluted HRP(horseradish peroxidase) label Goat anti-Human IgG；Wherein, extension rate can To be 8000 times.

Coating buffer can be 1 × PBS, pH:7.4；

ELISA ELISA Plate cleaning solution can be 1 × PBS solution containing 0.05% Tween-20；

Developing solution can be 3,3 ', 5,5 '-tetramethyl benzidines；

Terminate liquid can be the sulfuric acid solution of 2 mol/L.

Embodiment five

Research method: choosing men and women's Pancreas cancer patients totally 20, detects as test object, and using ELISA kit Whether the vWF ELISA scinderin zymoprotein of 20 patients is mutated.

By taking wherein a certain position patient as an example, the detection method to the patient includes:

A, monoclonal antibody prepared by embodiment three is diluted using the coating buffer, for example, being diluted to 2.0 ug/ ML, and the monoclonal antibody after dilution is loaded into the hole of ELISA ELISA Plate, it is incubated at room temperature 1-2 h.

B, the vWF ELISA scinderin zymoprotein of patient is diluted to various concentration using sample diluting liquid Gradient, and the vWF ELISA scinderin zymoprotein of various concentration gradient is loaded respectively to ELISA ELISA Plate Kong Zhong, and it is incubated at room temperature 1-2 h；

C, the liquid in each hole is got rid of, the ELISA ELISA Plate cleaning solution is added, washs and dries；

D, the ELIAS secondary antibody is added, and is incubated at room temperature 1-2 h；

E, the liquid in each hole is got rid of, ELISA ELISA Plate cleaning solution is added, washs and dries；

F, the developing solution is added, room temperature, which is protected from light, is incubated for 10-20 min, and the terminate liquid is added and terminates reaction；

G, it is the light absorption value at 450 nm that wavelength is measured in microplate reader.

H, make standard curve: using standard concentration as abscissa, the light absorption value of standard items measurement is ordinate, makees bid Directrix curve；Calculate standard curve regression coefficient R², work as R²This measurement is effective when > 0.99；Wherein it is possible to use ELISA Calc The Software on Drawing standard curve can know regression coefficient R according to the ELISA Calc software²=0.99898, therefore, this survey It is fixed effective.The wavelength that will test, which substitutes into standard curve for the light absorption value at 450 nm, can acquire the vascular blood friend of patient The concentration of the sub- scinderin zymoprotein of the cause of disease.Patient serum sample medium vessels hemophilia is detected using the ELISA method of foundation The content of factor scinderin zymoprotein.And it is identified with Western blot.Referring to FIG. 5, corresponding to extinction for the patient The standard curve of value.Wherein, X-axis is light absorption value, and Y-axis is corresponding concentration.

I, Western blot is identified

1, glue

(1) it cleans glass plate and dries；

(2) reference molecule cloning process prepares SDS-PAGE glue:

A. lower layer's separation gel prepares system (Total Volum:15 mL)

ddH2O	5.9 mL
		30% acrylamide mixed liquor	5.9 mL
1.5 mol/L Tris(PH 8.8)	3.8 mL
		10% SDS	0.15 mL
10% ammonium persulfate	0.15 mL
		TEMED	0.006 mL

B. upper layer spacer gel concentration preparation system (Total Volum:8 mL)

ddH2O	5.5 mL
		30% acrylamide mixed liquor	1.3 mL
1.0 mol/L Tris(PH 6.8)	1.0 mL
		10% SDS	0.08 mL
10% ammonium persulfate	0.08 mL
		TEMED	0.008 mL

(3) lower layer's separation gel of respective volume is added in each offset plate, adds the sterile ddH of 1 mL₂O flattens separation gel, After gelling to be separated is solid, remaining moisture in plastic plate is blotted with filter paper, upper layer is then added, glue is concentrated, waited after being inserted into comb Upper layer concentration gelling is solid.

2, albumen loading electrophoresis:

(1) comb is pulled up, duct label is carried out, 5 × SDS electrophoretic buffer is added, then to SDS- is added in protein sample PAGE albumen sample-loading buffer (5 ×), boiling water bath heat 3-5 min, loading；

(2) electrophoresis first is carried out with 80 V voltages, after running concentration glue to band, uses 100 V voltages instead and run about 100 min.

3, transferring film and incubation:

(1) first pvdf membrane is activated in methyl alcohol about 30 s.Gel, foam-rubber cushion and pvdf membrane are delayed in electrotransfer in advance respectively 30 min are balanced in fliud flushing.It is clipped by filter paper-glue-film-filter paper sequence, is put into transferring film device according to principle of the black flour to black flour In, it is added refrigerator (ice bag), about 120 min is run with the electric current of 150 mA in ice；

(2) it takes the film out, is put into 5% skim milk at once after the completion of, gently room temperature closes 1 h on shaking table；

(3) PBST cleaning closed film, cleans 3 times, every time 10 min；

(4) primary antibody for being diluted to corresponding multiple is added, 4 DEG C of shaking tables are incubated overnight；

(5) primary antibody is recycled, PBST is cleaned film 3 times, 10 min every time；

(6) secondary antibody (being diluted with 3% milk with 1:5000-1:10000) is incubated at room temperature 2 h of film；

(7) film 3 times are cleaned with PBST, every time 10 min；

(8) it after Pierce ECL Western Blotting Substrate kit A, B liquid mixes in equal volume, drips dropwise It is added on pvdf membrane；

(9) exposure image in FluorChem E FE0511, experiment are analyzed with Image J.

Wherein, primary antibody is that the vWF ELISA scinderin enzyme mutant protein monoclonal of the standby people of corporation is anti- Body, secondary antibody are the Goat anti-Human IgGs of horseradish peroxidase-labeled.

J, Western blot Analysis of test results: showing according to Western blot experimental procedure as a result, such as Fig. 6 institute Show, wherein the Marker in Fig. 6 is used to characterize the size of labelled protein.It is only attached in 25 KD of experimental group compared with blank control Closely there is obvious band, wherein the molecular weight of vWF ELISA scinderin enzyme mutant albumen is about 25 KD, table The vWF ELISA scinderin zymoprotein of the bright patient is implicitly present in mutation.

According to the studies above method, 20 patient's medium vessels christmas factor scinderin zymoproteins mutate general Rate is 40%, it is possible thereby to determine, the gene of the abrupt climatic change of vWF ELISA scinderin zymoprotein to cancer of pancreas Diagnosis has certain impulse.

The above is only a preferred embodiment of the present invention, it is not intended to restrict the invention, it is noted that for this skill For the those of ordinary skill in art field, without departing from the technical principles of the invention, can also make it is several improvement and Modification, these improvements and modifications also should be regarded as protection scope of the present invention.

Claims (9)

1. the vWF ELISA scinderin enzyme mutant albumen of people a kind of, which is characterized in that its amino acid sequence such as SEQ Shown in ID NO:1.

2. a kind of encoding gene of the vWF ELISA scinderin enzyme mutant albumen of people, which is characterized in that its nucleosides Acid sequence is as shown in SEQ ID NO:2.

3. a kind of genetic chip characterized by comprising solid phase carrier and fixed nucleotide probe on this carrier；It is described The nucleotides sequence of the nucleotide probe vWF ELISA scinderin enzyme mutant albumen of people according to claim 2 Column are determined with the comparison result of the nucleotide sequence of the normal albumen of vWF ELISA scinderin enzyme of people.

4. genetic chip according to claim 3, which is characterized in that

The nucleotide probe is base sequence shown in SEQ ID NO:3；

The nucleotide probe is base sequence shown in SEQ ID NO:4；

The nucleotide probe is base sequence shown in SEQ ID NO:5.

5. a kind of reagent, which is characterized in that contain the von Willebrand disease for detecting people described in claim 1 in the reagent The primer pair of factor scinderin enzyme mutant albumen.

6. reagent according to claim 5, which is characterized in that

The primer pair includes the combination of following any upstream primers Yu following any downstream primers: upstream primer is such as SEQ ID In NO:8 ~ NO:12 it is any shown in base sequence；Downstream primer is the alkali as shown in any in SEQ ID NO:13 ~ NO:17 Basic sequence.

7. a kind of monoclonal antibody of the vWF ELISA scinderin enzyme mutant albumen of specific recognition people, feature It is, is prepared by reagent such as described in claim 5 or 6, it can be special with amino acid sequence shown in SEQ ID NO:1 Property combine.

8. a kind of for detecting the ELISA kit of the vWF ELISA scinderin enzyme mutant albumen of people, feature Be, the ELISA kit include: the ELISA ELISA Plate for being coated with monoclonal antibody described in claim 7, ELIAS secondary antibody, Sample diluting liquid, coating buffer, ELISA ELISA Plate cleaning solution, developing solution and terminate liquid.

9. being used to detect the antibody of the vWF ELISA scinderin enzyme mutant albumen of people according to claim 8 ELISA kit, which is characterized in that the ELIAS secondary antibody is the Goat anti-Human of diluted HRP horseradish peroxidase-labeled IgG。