CN109897893A - A method of improving DNA exo+ polymerase PCR amplification efficiency and amplification length - Google Patents

Abstract

Invention describes a kind of methods for improving high-fidelity DNA polymerase PCR amplification efficiency.For this method by being added Triton X-100 in PCR high fidelity enzyme reaction system, the methods of hypromellose and magnesium chloride buffer improve the amplification efficiency of high-fidelity DNA polymerase.The method increase the amplification length of common high-fidelity DNA polymerase, amplification rate, amplification efficiency has very easy to be quick, advantageous the advantages of using.

Description

A method of improving DNA exo+ polymerase PCR amplification efficiency and amplification length

Technical field

Even if this method is related to a kind of amplification of high-fidelity DNA polymerase, by improving the anti-of high-fidelity DNA polymerase Buffer and load procedure are answered, can be realized the maximum DNA amplification efficiency of high-fidelity DNA polymerase

Background technique

PCR is the very common technology of modern molecular biology technique, has thus also been derived many by the technology Technical method and improvement application technology are used.PCR is a kind of method of gene DNA fragment using polymeric enzymatic amplification, continuous It, can be with the help of polymerase, in conjunction with target by the targeting primer of engineer during heating and annealing cooling DNA and have targeting only amplification the proprietary segment of purpose.Using the technology, can the greatly target gene of Study on Acceleration it is dense Degree, facilitates the handling and operation of the DNA fragmentation in downstream.

During modern molecular biology gene magnification, we often face the hardship for having to expand long segment It is angry.These long segments are often longer than 10 or even 20 kbp or more, and the nucleic acid of these sequences is often rich in high GC content, The complexity of sequence is high.During extracting DNA, how template is impure, we also tend to need the mistake in face of template complex Journey.In such template, in some instances it may even be possible to which there are some factors for inhibiting archaeal dna polymerase function, and amplification efficiency is caused to decline.

Currently, we rely primarily on improved PCR polymerase and carry out the amplification of DNA long segment, if DNA piece Section is too long, will greatly affect the efficiency of amplification, and the process of amplification is easy to interrupt, and enzyme is easy to split away off from template.And such as One PCR enzyme of fruit has secured, and how to be directed to enzyme that this is fixed and optimizes reaction condition, further increases its amplification ability, Increase amplification length, is also a problem including the GC template complex region across overlength.In addition, during DNA cloning, The fidelity of DNA cloning sequence is sometimes required very high.Certain archaeal dna polymerases have powerful 3-5 ' calibration function, can be with For the very high experiment demand of some fidelities.But the archaeal dna polymerase for possessing powerful calibration function simultaneously, due to expanding During need ceaselessly to carry out sequence calibration, but often expand very slow, cause amplification efficiency not high.This DNA high is protected True enzyme is also to universal not high, the amplification length also out of strength to the processing of various complex sequences of the compatibility of various reaction conditions Subtract greatly.So for the reaction condition of this kind of polymerase, they high amplification efficiency and amplification length, and value how are mentioned again Us are obtained further to consider the problems of.

A set of amplification condition for high-fidelity DNA polymerase has been groped in this laboratory, the experiment condition by optimization and Amplification condition is capable of the template of relatively effective amplification long segment and complicated G/C content, to some more complicated DNA samples, Also there is stronger compatibility.

Summary of the invention

Purpose is how to further increase high-fidelity DNA to solve during utilizing high-fidelity DNA polymerase to expand The vigor of polymerase solves high-fidelity DNA polymerase amplification template complex and long segment problem encountered.

Detailed description of the invention

Common PCR process is compared, we expand the target fragment NCBI reference of reference gene and long high GC content Sequence number AF493800 is as reference.The primer of reference gene are as follows: 5 ' ccacctcttcgagcaggtgatt and 5 ' ctacgatttgtttttggttttt.Amplification program is 95 degree of denaturation 5min, and the cycle stage is 95 degree and is denaturalized 30 seconds, 55 degree of annealing 30 seconds, 72 degree extended 30 seconds, and totally 35 circulations, finally extend 72 degree 10 minutes, 16 degree of lower stoppings.For long segment high GC content Target gene, our extension increasing sequences are AF493800, primer 5 ' AGAAAGCTCACTCCTCTTC and 5 ' GCATTTTCTCTTGCCAAAGGCAG amplification condition is 95 degree and is denaturalized 5 minutes that the cycle stage is 95 degree and is denaturalized 45 seconds that 60 degree are moved back Fire 45 seconds, 72 degree extension of time are respectively 120 seconds, expand 34 circulations, finally extend all be 72 degree 10 minutes, 16 degree stoppings instead It answers.EB dyes testing result as schemed under 1.2% Ago-Gel.

We have found that the formula and reaction condition of the PCR buffer by improvement, can greatly increase the amplification effect of PCR Rate, even if in the template of high GC content under the requirement of long pcr amplification product, also better effect can be reached than original method.Figure 1 high fidelity enzyme PCR reference gene electrophoresis, the long target gene electrophoresis of Fig. 2 high fidelity enzyme.

Specific embodiment

Amplification condition by the high-fidelity DNA polymerase groped: in the system of amplification, it is with the amplification system of 20ul Example, the Triton X-100 that 0.5ul is added enter in PCR reaction solution, additionally incorporate the hypromellose chlorine of micro 0.5ul Change magnesium buffer.The formula of hypromellose magnesium chloride buffer is to contain hydroxypropyl methylcellulose in the deionized water of 1L 15 grams, 10 grams of magnesium chloride of element.Before PCR experiment, the buffering of hypromellose magnesium chloride buffer and PCR is first added on ice Liquid is pre-mixed, and is then pre-mixed again with the reaction enzymes of PCR.When last PCR, by buffer and DNA profiling, primer etc. It is mixed.Other amplification conditions are all arranged according to template.The reaction condition of its design of primers and high fidelity enzyme and just The amplification condition of normal high-fidelity DNA polymerase is consistent.

Claims (2)

1. a kind of method of improved exo+ polymerase PCR.This method is added to a kind of ingredient especially, energy in buffer Enough ensure high fidelity enzyme during PCR, even if there can be more powerful amplification energy in face of template complex and overlength segment Power.

2. being chatted according in claims 1, during high-fidelity PCR amplification, hypromellose chlorination is first added The buffer of magnesium buffer and PCR are pre-mixed, and are then pre-mixed again with the reaction enzymes of PCR, when last PCR, then will Buffer and DNA profiling, primer etc. are mixed.