CN104611457B - Arm-PCR primer design method for multiple target point gene magnification - Google Patents
Arm-PCR primer design method for multiple target point gene magnification Download PDFInfo
- Publication number
- CN104611457B CN104611457B CN201510095338.4A CN201510095338A CN104611457B CN 104611457 B CN104611457 B CN 104611457B CN 201510095338 A CN201510095338 A CN 201510095338A CN 104611457 B CN104611457 B CN 104611457B
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- arm
- reaction
- gts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention discloses a kind of Arm-PCR primer design methods for multiple target point gene magnification, through the following steps that realize: a, the primer that icubate2.0 online software design small fragment target gene is replaced with LAMP software；B, the cyclic primer sequence before inner primer that LAMP software design goes out is changed the universal linker sequence of Arm-PCR primer into；C, the preparation of Arm-PCR reaction system；D, the setting and operation of Arm-PCR reaction condition；E, the capillary electrophoresis detection of Arm-PCR product.The present invention is more using the primer sets that LAMP software design goes out, be conducive to the screening of multi-primers group, the present invention is used for the Arm-PCR primer design method of multiple target point gene magnification, it can enable the Arm-PCR primer successful design of small fragment target gene, and then Arm-PCR multiple reaction is made to become simple possible.
Description
Technical field
The invention belongs to field of biotechnology, particularly relate to a kind of Arm-PCR for multiple target point gene magnification
Primer design method, this method enables the Arm-PCR primer of small fragment target gene to design, and then makes Arm-PCR multiple reaction
Become simple possible.
Background technique
Amplicon saves multiplex PCR (amplicon rescue multiplex PCR, hereinafter referred to as Arm-PCR) technology,
Its principle is to separately design two pairs of nested primers for each target sequence in multiplex PCR system, allow to be formed 4 kinds of expansions
Increase primer combination；Since each target sequence has 4 kinds of possible amplification modes, so that it is most preferably general to find different target sequences
Amplification condition become simple possible, it is final to realize the high specific to a variety of target genes, highly sensitive synchronous amplification.
LAMP (Loop-Mediated Isothermal Amplification) method is to be invented by Notomi etc. for 2000
A kind of novel constant temperature nucleic acid amplification method.This method uses 4 primers (2 of 6 regions on specifically identification target sequence
Outer primer, 2 inner primers) and Bst archaeal dna polymerase with strand-displacement activity, the exponential expansion of nucleic acid is carried out at 65 DEG C or so
Increase, amplification efficiency is up to 109~1010 copy number magnitudes.
Summary of the invention
It, can be with the purpose of the present invention is to provide a kind of Arm-PCR primer design method for multiple target point gene magnification
Enable the Arm-PCR primer successful design of small fragment target gene, and then Arm-PCR multiple reaction is made to become simple possible.
The present invention is achieved by the following technical solutions: a kind of Arm-PCR primer for multiple target point gene magnification is set
Meter method, through the following steps that realize:
A, the primer of 2.0 online software of icubate design small fragment target gene is replaced with LAMP software: by target gene piece
The sequence of section imports in LAMP software, is adjusted according to the parameter of Arm-PCR design of primers to the parameter in LAMP software；
B, the cyclic primer sequence before inner primer that LAMP software design goes out is changed the universal joint of Arm-PCR primer into
Sequence: the first round primer that 2.0 online software of icubate is designed is divided into export-oriented primer and interior to primer, this and LAMP software
The primer designed is similar, draws so changing the cyclic primer sequence before the inner primer of LAMP software design out into Arm-PCR
The universal linker sequence of object, to be converted into Arm-PCR primer；
C, the preparation of Arm-PCR reaction system；
D, the setting and operation of Arm-PCR reaction condition；
E, the capillary electrophoresis detection of Arm-PCR product: 5 ' of super primer required for being expanded in Arm-PCR second step
End will add fluorescent marker, just can be carried out subsequent capillary electrophoresis detection.
By taking genetically engineered soybean GTS 40-3-2 NOS terminator and genetically engineered soybean A5547-127 as an example, primer sets be by
LAMP software design, the universal linker sequence of Arm-PCR primer will be changed in it into the cyclic primer of upstream and downstream primer, thus
Be converted into Arm-PCR primer, primer sets include positive outer primer Fo, reversed outer primer Ro, positive inner primer Fi, it is reversed in draw
Object Ri, the first step for Arm-PCR expand；The super upstream primer Fs and downstream primer Rs of 5 ' end ROX labels are used for Arm-
The second step of PCR expands, and joint sequence is identical as the sequence of super primer, and nucleotide sequence difference is as follows:
1.A5547-127 positive outer primer Fo:CACAAGAGTGGATTGATGATCTAG；
The reversed outer primer Ro:CTCATGCAACCTAACAGATGG of A5547-127；
A5547-127 forward direction inner primer
Fi:GCAGTCGTGCAGCAAGTTTTACGGTTGGTTGCTGAGGTTG；
The reversed inner primer of A5547-127
Ri:CGAGTCCTGCGGTCTCAAATGTGCCTATAACAGCAACCACAG；
2.GTS 40-3-2 NOS terminator forward direction outer primer Fo:CAAACATTTGGCAATAAAGTTT；
The reversed outer primer Ro:CTAGTAACATAGATGACACCG of GTS 40-3-2 NOS terminator；
GTS 40-3-2 NOS terminator forward direction inner primer
Fi:GCAGTCGTGCAGCAAGTTTTACAGATTGAATCCTGTTGCC；
The reversed inner primer of GTS 40-3-2 NOS terminator
Ri:CGAGTCCTGCGGTCTCAAATGTTATTTTGTTTTCTATCGCGTATT；
3. super upstream primer Fs:GCAGTCGTGCAGCAAGTTTTAC；
Super downstream primer Fs:CGAGTCCTGCGGTCTCAAATGT；
Arm-PCR reaction is carried out using Arm-PCR detection primer group, is included the following steps: with genetically engineered soybean A5547-
127 and genetically engineered soybean GTS 40-3-2 NOS terminator plasmid be template；Pcr amplification reaction: first is prepared in PCR pipe
Walk reaction system: primer liquid 2.5 μ l, reaction solution Mix 12.5 μ l, genetically engineered soybean A5547-127 and GTS 40-3-2 NOS are whole
Only each 2~5 μ l of sub- plasmid, with sterile deionized water polishing to 25 μ l；When blank control reaction is set, mould is replaced with distilled water
Plate；It is centrifuged after prepared PCR pipe is mixed, and in 95 DEG C of 15min, 94 DEG C of 30s, 60 DEG C of 90s, 72 DEG C of 60s, 15 circulations；
94 DEG C of 15s, 70 DEG C of 90s, 6 circulations；60 DEG C of extension 30min, last 4 DEG C of preservations；Second step PCR reaction system are as follows: super to draw
Thing liquid 1 μ l, reaction solution Mix 12.5 μ l, 1~2 μ l of first step PCR reaction product, with sterile deionized water polishing to 25 μ l；It will
Prepared PCR pipe is centrifuged after mixing, and in 95 DEG C of 15min；94 DEG C of 30s, 60 DEG C of 90s, 72 DEG C of 60s, 30 circulations；60 DEG C are prolonged
Stretch 30min, last 4 DEG C of preservations；As a result judge: passing through capillary electrophoresis detection Arm-PCR amplification.
The beneficial effects of the present invention are: 2.0 open platform of icubate is that online free multiplex PCR reagent design is soft
Part, since 2.0 software of icubate requires the length of target gene, usually in 1000bp or more, in this way for small fragment
Target gene can not just design Arm-PCR primer, and the Arm-PCR primer that 2.0 software design of icubate goes out only has two groups, thus
Limit the screening of multi-primers group.And the primer that LAMP software design goes out also includes 2 outer primers and 2 inner primers, with
The Arm-PCR primer that 2.0 software design of icubate goes out is similar, if by LAMP software design go out in upstream and downstream primer
Cyclic primer changes the universal linker sequence of Arm-PCR primer into, to be converted into Arm-PCR primer.And LAMP software design
Primer sets out are more, are conducive to the screening of multi-primers group, and Arm-PCR primer of the present invention for multiple target point gene magnification is set
Meter method, can enable the Arm-PCR primer successful design of small fragment target gene, and then become Arm-PCR multiple reaction
Simple possible.
Detailed description of the invention
Fig. 1 is the Arm-PCR capillary electrophoresis detection result figure of 1 genetically engineered soybean A5547-127 of embodiment；
Fig. 2 is the Arm-PCR capillary electrophoresis detection result figure of embodiment 1GTS 40-3-2 NOS terminator；
Fig. 3 is the capillary electrophoresis detection result of blank control group.
Specific embodiment
Below in conjunction with Figure of description and specific embodiment, the present invention is further illustrated, and however, it is not limited to this.
Embodiment 1: a kind of Arm-PCR primer design method for multiple target point gene magnification, through the following steps that
It realizes: a, the primer that icubate2.0 online software design small fragment target gene is replaced with LAMP software: by target fragment
Sequence import LAMP software in, the parameter in LAMP software is adjusted according to the parameter of Arm-PCR design of primers；B, will
The cyclic primer sequence before inner primer that LAMP software design goes out changes the universal linker sequence of Arm-PCR primer into:
The first round primer that icubate2.0 online software is designed is divided into export-oriented primer and interior to primer, this goes out with LAMP software design
Primer it is similar, so changing the cyclic primer sequence before inner primer that LAMP software design goes out into Arm-PCR primer logical
With joint sequence, to be converted into Arm-PCR primer；C, the preparation of Arm-PCR reaction system；D, Arm-PCR reaction condition
Setting and operation；E, the capillary electrophoresis detection of Arm-PCR product: super primer required for being expanded in Arm-PCR second step
5 ' end will add fluorescent marker, just can be carried out subsequent capillary electrophoresis detection.
By taking genetically engineered soybean GTS 40-3-2 NOS terminator and genetically engineered soybean A5547-127 as an example, primer sets be by
LAMP software design, the universal linker sequence of Arm-PCR primer will be changed in it into the cyclic primer of upstream and downstream primer, thus
Be converted into Arm-PCR primer, primer sets include positive outer primer Fo, reversed outer primer Ro, positive inner primer Fi, it is reversed in draw
Object Ri, the first step for Arm-PCR expand；The super upstream primer Fs and downstream primer Rs of 5 ' end ROX labels are used for Arm-
The second step of PCR expands, and joint sequence is identical as the sequence of super primer, and nucleotide sequence difference is as follows:
1.A5547-127 positive outer primer Fo:CACAAGAGTGGATTGATGATCTAG；
The reversed outer primer Ro:CTCATGCAACCTAACAGATGG of A5547-127；
A5547-127 forward direction inner primer
Fi:GCAGTCGTGCAGCAAGTTTTACGGTTGGTTGCTGAGGTTG；
The reversed inner primer of A5547-127
Ri:CGAGTCCTGCGGTCTCAAATGTGCCTATAACAGCAACCACAG；
2.GTS 40-3-2 NOS terminator forward direction outer primer Fo:CAAACATTTGGCAATAAAGTTT；
The reversed outer primer Ro:CTAGTAACATAGATGACACCG of GTS 40-3-2 NOS terminator；
GTS 40-3-2 NOS terminator forward direction inner primer
Fi:GCAGTCGTGCAGCAAGTTTTACAGATTGAATCCTGTTGCC；
The reversed inner primer of GTS 40-3-2 NOS terminator
Ri:CGAGTCCTGCGGTCTCAAATGTTATTTTGTTTTCTATCGCGTATT；
3. super upstream primer Fs:GCAGTCGTGCAGCAAGTTTTAC；
Super downstream primer Fs:CGAGTCCTGCGGTCTCAAATGT；
Arm-PCR reaction is carried out using Arm-PCR detection primer group, is included the following steps: with genetically engineered soybean A5547-
127 and genetically engineered soybean GTS 40-3-2 NOS terminator plasmid be template；Pcr amplification reaction: first is prepared in PCR pipe
Walk reaction system: primer liquid 2.5 μ l, reaction solution Mix 12.5 μ l, genetically engineered soybean A5547-127 and GTS 40-3-2 NOS are whole
Only each 2~5 μ l of sub- plasmid, with sterile deionized water polishing to 25 μ l；When blank control reaction is set, mould is replaced with distilled water
Plate；It is centrifuged after prepared PCR pipe is mixed, and in 95 DEG C of 15min, 94 DEG C of 30s, 60 DEG C of 90s, 72 DEG C of 60s, 15 circulations；
94 DEG C of 15s, 70 DEG C of 90s, 6 circulations；60 DEG C of extension 30min, last 4 DEG C of preservations；Second step PCR reaction system are as follows: super to draw
Thing liquid 1 μ l, reaction solution Mix 12.5 μ l, 1~2 μ l of first step PCR reaction product, with sterile deionized water polishing to 25 μ l；It will
Prepared PCR pipe is centrifuged after mixing, and in 95 DEG C of 15min；94 DEG C of 30s, 60 DEG C of 90s, 72 DEG C of 60s, 30 circulations；60 DEG C are prolonged
Stretch 30min, last 4 DEG C of preservations；As a result judge: passing through capillary electrophoresis detection Arm-PCR amplification.
In the present embodiment: the Arm- of genetically engineered soybean A5547-127 and genetically engineered soybean GTS 40-3-2 NOS terminator
PCR primer expand and detected with Capillary Electrophoresis: Fig. 1 is the Arm-PCR capillary of genetically engineered soybean A5547-127
Electrophoresis detection result；Fig. 2 is the Arm-PCR capillary electrophoresis detection result of GTS 40-3-2 NOS terminator；Fig. 3 is blank pair
According to the capillary electrophoresis detection result of group.The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention
And be not restricted to the described embodiments, other any changes made without departing from the spirit and principles of the present invention are repaired
Decorations, combination, simplify substitution, should be equivalent substitute mode, are included within the scope of the present invention.
Claims (1)
1. a kind of Arm-PCR primer design method for multiple target point gene magnification, it is characterised in that: described to be used for multiple target point base
The Arm-PCR primer design method of gene-amplification is through the following steps that realize:
A, the primer of icubate2.0 online software design small fragment target gene is replaced with LAMP software: by the sequence of target fragment
Column import in LAMP software, are adjusted according to the parameter of Arm-PCR design of primers to the parameter in LAMP software；
B, the cyclic primer sequence before inner primer that LAMP software design goes out is changed the universal joint sequence of Arm-PCR primer into
Column, to be converted into Arm-PCR primer；
C, the preparation of Arm-PCR reaction system；
D, the setting and operation of Arm-PCR reaction condition；
E, the capillary electrophoresis detection of Arm-PCR product；
Primer sets include positive outer primer Fo, reversed outer primer Ro, positive inner primer Fi, reversed inner primer Ri, are used for Arm-PCR
The first step amplification；Second step of the super upstream primer Fs and downstream primer Rs of 5 ' end ROX labels for Arm-PCR expands；
Carry out Arm-PCR reaction using Arm-PCR detection primer group, include the following steps: with genetically engineered soybean A5547-127 and
The plasmid of genetically engineered soybean GTS 40-3-2NOS terminator is template；Pcr amplification reaction: first step reaction is prepared in PCR pipe
System: primer liquid 12.5 μ l of 2.5 μ l, reaction solution Mix, genetically engineered soybean A5547-127 and GTS 40-3-2NOS terminator matter
Each 2~5 μ l of grain, with sterile deionized water polishing to 25 μ l；When blank control reaction is set, template is replaced with distilled water；It will match
The PCR pipe made is centrifuged after mixing, and in 95 DEG C of 15min, 94 DEG C of 30s, 60 DEG C of 90s, 72 DEG C of 60s, 15 circulations；94 DEG C of 15s,
70 DEG C of 90s, 6 circulations；60 DEG C of extension 30min, last 4 DEG C of preservations；Second step PCR reaction system are as follows: super 1 μ l of primer liquid,
12.5 μ l of reaction solution Mix, 1~2 μ l of first step PCR reaction product, with sterile deionized water polishing to 25 μ l；It will be prepared
PCR pipe is centrifuged after mixing, and in 95 DEG C of 15min；94 DEG C of 30s, 60 DEG C of 90s, 72 DEG C of 60s, 30 circulations；60 DEG C of extension 30min,
Last 4 DEG C of preservations；As a result judge: passing through capillary electrophoresis detection Arm-PCR amplification；
The nucleotide sequence difference of primer is as follows:
1) A5547-127 forward direction outer primer Fo:CACAAGAGTGGATTGATGATCTAG；
The reversed outer primer Ro:CTCATGCAACCTAACAGATGG of A5547-127；
A5547-127 forward direction inner primer
Fi:GCAGTCGTGCAGCAAGTTTTACGGTTGGTTGCTGAGGTTG；
The reversed inner primer of A5547-127
Ri:CGAGTCCTGCGGTCTCAAATGTGCCTATAACAGCAACCACAG；
2) GTS 40-3-2NOS terminator forward direction outer primer Fo:CAAACATTTGGCAATAAAGTTT；
The reversed outer primer Ro:CTAGTAACATAGATGACACCG of GTS 40-3-2NOS terminator；
GTS 40-3-2NOS terminator forward direction inner primer
Fi:GCAGTCGTGCAGCAAGTTTTACAGATTGAATCCTGTTGCC；
The reversed inner primer of GTS 40-3-2NOS terminator
Ri:CGAGTCCTGCGGTCTCAAATGTTATTTTGTTTTCTATCGCGTATT；
3) super upstream primer Fs:GCAGTCGTGCAGCAAGTTTTAC；
Super downstream primer Fs:CGAGTCCTGCGGTCTCAAATGT.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095338.4A CN104611457B (en) | 2015-03-04 | 2015-03-04 | Arm-PCR primer design method for multiple target point gene magnification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510095338.4A CN104611457B (en) | 2015-03-04 | 2015-03-04 | Arm-PCR primer design method for multiple target point gene magnification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611457A CN104611457A (en) | 2015-05-13 |
| CN104611457B true CN104611457B (en) | 2019-05-10 |
Family
ID=53146104
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510095338.4A Active CN104611457B (en) | 2015-03-04 | 2015-03-04 | Arm-PCR primer design method for multiple target point gene magnification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611457B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106048049A (en) * | 2016-07-18 | 2016-10-26 | 山东农业大学 | LAMP primer group for detecting transgenic soybean GTS 40-3-2 and detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634590A (en) * | 2012-01-16 | 2012-08-15 | 广州迪澳生物科技有限公司 | LAMP (Loop-Mediated Isothermal Amplification) detection primer group, detection kit and detection method of transgenic soybean A5547-127 and derived varieties thereof |
| CN102649976A (en) * | 2012-01-19 | 2012-08-29 | 广州迪澳生物科技有限公司 | LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT2271767T (en) * | 2008-04-03 | 2016-08-18 | Cb Biotechnologies Inc | Amplicon rescue multiplex polymerase chain reaction for amplificaton of multiple targets |
-
2015
- 2015-03-04 CN CN201510095338.4A patent/CN104611457B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634590A (en) * | 2012-01-16 | 2012-08-15 | 广州迪澳生物科技有限公司 | LAMP (Loop-Mediated Isothermal Amplification) detection primer group, detection kit and detection method of transgenic soybean A5547-127 and derived varieties thereof |
| CN102649976A (en) * | 2012-01-19 | 2012-08-29 | 广州迪澳生物科技有限公司 | LAMP (Loop-mediated isothermal amplification) detection primer set of transgenic soybeans GTS 40-3-2 as well as derived varieties thereof, kit and detection method |
Non-Patent Citations (1)
| Title |
|---|
| Simultaneous ampli fi cation and identi fi cation of 25 human papillomavirus types with templex technology;Han J等;《Journal of Clinical Microbiology》;20061231;第44卷(第11期);4157-4162 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611457A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103255227B (en) | Primer-mediated cyclized constant-temperature nucleic acid rolling circle amplification method and kit | |
| DK2699698T3 (en) | OSCILLING AMPLIFICATION REACTION FOR NUCLEIC ACIDS | |
| CA2880687C (en) | Digital to biological converter | |
| CN101903104A (en) | Integrated microfluidic device and methods | |
| JP2016516437A5 (en) | ||
| CN105463585A (en) | Method for constructing sequencing library based on single-stranded DNA molecule, and applications thereof | |
| CN104120080B (en) | A kind of α-globin gene mutation detection kit and preparation method thereof and application | |
| CN113039284A (en) | Visual and modular detection of nucleic acids using enzyme-assisted nanotechnology | |
| CN103276074A (en) | Method for synthesizing short single strand deoxyribonucleotide probe | |
| CN104611457B (en) | Arm-PCR primer design method for multiple target point gene magnification | |
| CN103866048B (en) | The HRM discrimination method of Muscovy duck parvovirus and goose parvovirus, test kit and primer sets | |
| CN102260733A (en) | Acceleration primer design method, target molecule detection method and reagent kit for detection | |
| CN103998625B (en) | For the method and system of Viral diagnosis | |
| CN105986043A (en) | Method for quickly detecting nucleic acid of H5 subtype highly pathogenic avian influenza virus | |
| CN105986044A (en) | Universal method for quickly detecting nucleic acid of avian influenza virus | |
| CN102453771A (en) | Duck viral hepatitis type 1 RT-LAMP detection kit and detection method thereof | |
| CN107406891A (en) | Pcr method | |
| CN105886494B (en) | A kind of amplification influenza A virus full-length genome kit and preparation method and application | |
| CN112534062A (en) | Cleavable partner primers and methods of amplifying nucleic acid sequences using the same | |
| CN105368800B (en) | A kind of thermal starting Taq DNA polymerase and preparation method thereof | |
| CN109266723A (en) | Rare mutation detection method, its kit and application | |
| CN108642147A (en) | A kind of method of fast-amplifying nucleic acid | |
| CN109897893A (en) | A method of improving DNA exo+ polymerase PCR amplification efficiency and amplification length | |
| CN104531901A (en) | PCR detection method for detecting four kinds of poultry respiratory disease pathogens simultaneously | |
| CN106191314B (en) | LAMP detection kit, detection method and application of DNA virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |