CN109897868A - A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish - Google Patents
A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish Download PDFInfo
- Publication number
- CN109897868A CN109897868A CN201910158021.9A CN201910158021A CN109897868A CN 109897868 A CN109897868 A CN 109897868A CN 201910158021 A CN201910158021 A CN 201910158021A CN 109897868 A CN109897868 A CN 109897868A
- Authority
- CN
- China
- Prior art keywords
- gene
- pcr
- zebra fish
- mir196a
- embryo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000252212 Danio rerio Species 0.000 title claims abstract description 67
- 108091054189 miR-196a stem-loop Proteins 0.000 title claims abstract description 46
- 238000000034 method Methods 0.000 title claims abstract description 25
- 238000003209 gene knockout Methods 0.000 title claims abstract description 23
- 238000012224 gene deletion Methods 0.000 title claims abstract description 15
- 238000009395 breeding Methods 0.000 title claims abstract description 12
- 230000001488 breeding effect Effects 0.000 title claims abstract description 12
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 48
- 210000001161 mammalian embryo Anatomy 0.000 claims abstract description 43
- 108091033409 CRISPR Proteins 0.000 claims abstract description 13
- 238000000338 in vitro Methods 0.000 claims abstract description 13
- 238000002347 injection Methods 0.000 claims abstract description 5
- 239000007924 injection Substances 0.000 claims abstract description 5
- 238000004519 manufacturing process Methods 0.000 claims abstract description 5
- 238000010354 CRISPR gene editing Methods 0.000 claims abstract 3
- 108020005004 Guide RNA Proteins 0.000 claims description 36
- 108020004414 DNA Proteins 0.000 claims description 33
- 238000006243 chemical reaction Methods 0.000 claims description 33
- 239000000047 product Substances 0.000 claims description 24
- 230000035772 mutation Effects 0.000 claims description 23
- 238000001514 detection method Methods 0.000 claims description 20
- 238000012408 PCR amplification Methods 0.000 claims description 19
- 238000000520 microinjection Methods 0.000 claims description 17
- 238000004925 denaturation Methods 0.000 claims description 14
- 230000036425 denaturation Effects 0.000 claims description 14
- 238000001962 electrophoresis Methods 0.000 claims description 13
- 239000000499 gel Substances 0.000 claims description 12
- 238000007480 sanger sequencing Methods 0.000 claims description 12
- 238000013518 transcription Methods 0.000 claims description 12
- 230000035897 transcription Effects 0.000 claims description 12
- 238000000746 purification Methods 0.000 claims description 11
- 238000012163 sequencing technique Methods 0.000 claims description 11
- 238000011144 upstream manufacturing Methods 0.000 claims description 11
- 230000003321 amplification Effects 0.000 claims description 10
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 10
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 9
- 239000012634 fragment Substances 0.000 claims description 9
- FAPWRFPIFSIZLT-UHFFFAOYSA-M Sodium chloride Chemical compound [Na+].[Cl-] FAPWRFPIFSIZLT-UHFFFAOYSA-M 0.000 claims description 8
- 230000004087 circulation Effects 0.000 claims description 8
- 210000002257 embryonic structure Anatomy 0.000 claims description 8
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 8
- 238000011161 development Methods 0.000 claims description 7
- 230000018109 developmental process Effects 0.000 claims description 7
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 6
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 claims description 6
- 238000005119 centrifugation Methods 0.000 claims description 6
- 230000009514 concussion Effects 0.000 claims description 6
- 235000013601 eggs Nutrition 0.000 claims description 6
- 230000004720 fertilization Effects 0.000 claims description 6
- 239000013612 plasmid Substances 0.000 claims description 6
- 238000011084 recovery Methods 0.000 claims description 6
- 239000006228 supernatant Substances 0.000 claims description 6
- 238000012360 testing method Methods 0.000 claims description 6
- 238000004458 analytical method Methods 0.000 claims description 5
- 230000015572 biosynthetic process Effects 0.000 claims description 5
- 238000012217 deletion Methods 0.000 claims description 5
- 230000037430 deletion Effects 0.000 claims description 5
- 238000003786 synthesis reaction Methods 0.000 claims description 5
- 241000251468 Actinopterygii Species 0.000 claims description 4
- 238000013461 design Methods 0.000 claims description 4
- 238000002474 experimental method Methods 0.000 claims description 4
- 238000000605 extraction Methods 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 4
- 239000011780 sodium chloride Substances 0.000 claims description 4
- 229920000936 Agarose Polymers 0.000 claims description 3
- 238000010453 CRISPR/Cas method Methods 0.000 claims description 3
- 102000053602 DNA Human genes 0.000 claims description 3
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 3
- 102000035195 Peptidases Human genes 0.000 claims description 3
- 108091005804 Peptidases Proteins 0.000 claims description 3
- 238000011530 RNeasy Mini Kit Methods 0.000 claims description 3
- 230000002902 bimodal effect Effects 0.000 claims description 3
- 238000005336 cracking Methods 0.000 claims description 3
- 238000005520 cutting process Methods 0.000 claims description 3
- 230000029087 digestion Effects 0.000 claims description 3
- 235000019441 ethanol Nutrition 0.000 claims description 3
- 230000002068 genetic effect Effects 0.000 claims description 3
- 230000012447 hatching Effects 0.000 claims description 3
- 238000009396 hybridization Methods 0.000 claims description 3
- 239000007788 liquid Substances 0.000 claims description 3
- 238000002156 mixing Methods 0.000 claims description 3
- 235000019833 protease Nutrition 0.000 claims description 3
- 239000012264 purified product Substances 0.000 claims description 3
- 238000000197 pyrolysis Methods 0.000 claims description 3
- 239000000376 reactant Substances 0.000 claims description 3
- 238000004064 recycling Methods 0.000 claims description 3
- 230000004083 survival effect Effects 0.000 claims description 3
- 238000012546 transfer Methods 0.000 claims description 3
- 239000003643 water by type Substances 0.000 claims description 3
- 238000007689 inspection Methods 0.000 claims description 2
- 239000000203 mixture Substances 0.000 claims description 2
- CSNNHWWHGAXBCP-UHFFFAOYSA-L Magnesium sulfate Chemical compound [Mg+2].[O-][S+2]([O-])([O-])[O-] CSNNHWWHGAXBCP-UHFFFAOYSA-L 0.000 claims 2
- 238000000137 annealing Methods 0.000 claims 2
- 239000000284 extract Substances 0.000 claims 2
- 108020004999 messenger RNA Proteins 0.000 claims 2
- 241000448255 Congiopodus peruvianus Species 0.000 claims 1
- 229910052943 magnesium sulfate Inorganic materials 0.000 claims 1
- 235000019341 magnesium sulphate Nutrition 0.000 claims 1
- 238000005516 engineering process Methods 0.000 abstract description 7
- 230000030279 gene silencing Effects 0.000 abstract description 5
- 238000010362 genome editing Methods 0.000 abstract description 4
- 238000003205 genotyping method Methods 0.000 abstract description 4
- 230000008569 process Effects 0.000 abstract description 4
- 108091027544 Subgenomic mRNA Proteins 0.000 abstract description 3
- 230000001276 controlling effect Effects 0.000 abstract description 2
- 230000000968 intestinal effect Effects 0.000 abstract description 2
- 210000000936 intestine Anatomy 0.000 abstract description 2
- 230000009456 molecular mechanism Effects 0.000 abstract description 2
- 230000007170 pathology Effects 0.000 abstract description 2
- 230000001105 regulatory effect Effects 0.000 abstract description 2
- 238000012827 research and development Methods 0.000 abstract description 2
- 230000001225 therapeutic effect Effects 0.000 abstract description 2
- 230000014509 gene expression Effects 0.000 description 7
- 210000004027 cell Anatomy 0.000 description 6
- 230000008859 change Effects 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 238000003780 insertion Methods 0.000 description 3
- 230000037431 insertion Effects 0.000 description 3
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000001816 cooling Methods 0.000 description 2
- 230000002255 enzymatic effect Effects 0.000 description 2
- 238000010363 gene targeting Methods 0.000 description 2
- 238000003384 imaging method Methods 0.000 description 2
- 108010042407 Endonucleases Proteins 0.000 description 1
- 102000004533 Endonucleases Human genes 0.000 description 1
- 241000997865 Histrio histrio Species 0.000 description 1
- 208000026350 Inborn Genetic disease Diseases 0.000 description 1
- 208000005016 Intestinal Neoplasms Diseases 0.000 description 1
- 241000203121 Orthopristis chrysoptera Species 0.000 description 1
- 238000010171 animal model Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000005034 decoration Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000013401 experimental design Methods 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 230000035558 fertility Effects 0.000 description 1
- 231100000221 frame shift mutation induction Toxicity 0.000 description 1
- 230000037433 frameshift Effects 0.000 description 1
- 208000016361 genetic disease Diseases 0.000 description 1
- 230000006801 homologous recombination Effects 0.000 description 1
- 238000002744 homologous recombination Methods 0.000 description 1
- 230000008676 import Effects 0.000 description 1
- 230000002779 inactivation Effects 0.000 description 1
- 201000009019 intestinal benign neoplasm Diseases 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 108010008359 protein kinase C lambda Proteins 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 210000000130 stem cell Anatomy 0.000 description 1
- 230000009182 swimming Effects 0.000 description 1
- 230000008685 targeting Effects 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
Abstract
The present invention relates to gene Knockout fields, especially disclose a kind of method of gene knockout breeding mir196a Gene Deletion zebra fish, pass through CRISPR/Cas9 gene editing technology, suitable target practice site is designed on the mir196a gene of zebra fish, the specific sgRNA and Cas9-mRNA synthesized in vitro, micro- co-injection enters zebra fish one into the cell, after Embryo Culture 36 hours, genotyping is carried out by choosing embryo, to confirm the validity in selected site.The present invention can be more efficient and more accurately knocks out specific gene in organism genome, and production is simple, at low cost, and can shear simultaneously to sites multiple on target gene, any number of individual gene of silencing.And mir196a gene is fallen in interference, and its function is studied by science of heredity means, help further to disclose the whole process and the molecular mechanism for regulating and controlling these processes that Intestinal Morphology occurs, medically be had a very important significance in the understanding of intestines problem pathology and the research and development of new therapeutic scheme.
Description
Technical field
The present invention relates to gene knockout fields, especially disclose a kind of gene knockout breeding mir196a Gene Deletion
The method of zebra fish.
Background technique
Mir196a gene is located on the 23rd chromosome of zebra fish, and for the gene distribution in hoxc gene family, stem ring area is complete
Long 106bp, mature mir196a are 22nt, 5 ' UAGGUAGUUUCAUGUUGUUGGG-3 ' of sequence, the seed sequence of gene
It is classified as AGGTAGT, while by high-flux sequence, finding mir196a high expression in enteron aisle.
Gene, signal path in zebra fish and human intestine's growth course have high homology, and mir196a gene exists
Sequence in people, pig, mouse and zebra fish is identical, analyzes by high-flux sequence, finds mir196a table in chitling road
It is especially high up to measuring.Moreover, zebra fish is small with individual compared with other animal models, be easy to raise, development is fast, fertility
By force, in vitro fertilization, vitro Development of Embryos and it is transparent the advantages that.
By CRISPR/Cas9 gene editing technology, suitable target practice position is designed on the mir196a gene of zebra fish
Point, the specific sgRNA synthesized in vitro (final concentration 20ng/ μ L) and Cas9-mRNA (final concentration 150ng/ μ L), micro- total note
It injects into zebra fish one into the cell, after Embryo Culture 36h, passes through and choose embryo's progress genotyping, identify set target practice position
The validity of point.
Gene targeting originates from late 1980s, is a kind of by studying genome progress pointed decoration
The important method means of gene function, it can also be used to treat the various genetic diseases of the mankind.The technology mainly utilizes missing
Mutation, inactivation of gene, chromosome large fragment delete and foreign gene import etc. modes come change biology hereditary information, and
Mutant character is expressed after stablizing heredity in system genitale, to study work of the specific gene in growth and development process in organism
With so this kind of technological means has become modern molecular biology research hotspot.Traditional gene targeting is built upon embryo
On tire stem cell (ESC) and the basis of homologous recombination technique, therefore Knockout technology efficiency is extremely low.It is a kind of completely new at the beginning of 2013
Artificial endonucleases clustered regularly interspaced short palindromic repeats
(CRISPR)/CRISPR-associated (Cas) 9, can the more efficient and more accurately specific base of silencing in organism genome
Cause, and production is simple, at low cost, and can shear simultaneously to sites multiple on target gene, any number of single base of silencing
Cause, but the technology haves the defects that certain simultaneously, and off-target rate is relatively high.
Summary of the invention
It is an object of the present invention to overcome the above-mentioned technical problems, and to provide a kind of gene knockout breeding mir196a genes to lack
The method of mistake type zebra fish has found suitable target practice site, by CRISPR/Cas9 gene editing technology, selects
Mir196a Gene Deletion zebra fish.
The technical solution for solving above-mentioned technical problem is as follows:
Step 1), design CRISPR/Cas9 gene knockout target site and detection primer
Zebra fish is inquired on National Center for Biotechnology Information (NCBI)
The genomic dna sequence of mir196a gene, in website SMART (http://smart.embl-heidelberg.de/) on point
Analyse its functional domain, according to CRISPR/Cas knock out principle, in website The ZiFiT Targeter (http:// zifit.partners.org/ZiFiT/) on design mir196a gene target site.The selection of target spot must comply with this standard:
The selection of middle target site 1 (being transcribed using SP6 promoter) follows following standard: 5 '-(N) 20-NGG-3 ', guarantees target site
3 ' end be NGG, the selection of target site 2 follows following standard: 5 '-GG- (N) 18-NGG-3 '.The wherein GG dinucleotides at 5 ' ends
It is a part of T7 promoter, can be not limited when designing target site, but it must be ensured that 3 ' ends of target site are NGG.
It the selection position of target spot must be in the structural domain of gene, to ensure that insertion or the missing of target site base can influence
The total domain of mir196a gene, thus to change the expression of gene.
Two pairs of specific target sites PCR primers are as follows:
F1 (target site a forward primer, utilize SP6 promoter transcription):
GCGATTTAGGTGACACTATATAGCCCGTCCAGCTGATGCGGTTTTAGAGCTAGAAATAG
F2 (target site b forward primer, utilize T7 promoter transcription):
GCGTAATACGACTCACTATAGGCCGTTCATTTCCGCCAAATTACCGTTTTAGAGCTAGAAATAG
R (shared reverse primer): AAGCACCGACTCGGTGCCACT
PCR detection primer
PCR detection primer upstream and downstream primer is located at the upstream and downstream of mir196a:
F(5’-CAATACCCTTAACCGAACTGA-3’)
R(5’-TCATTTACAATGCCATTTGC-3
Step 2), gRNA are synthesized in vitro:
A carries out PCR by following specific primer, amplifies and close for specificity gRNA using the DNA of synthesis as template
At double-stranded DNA.
Positive specific target sites primers F 1 (SP6 promoter) or F2 (T7 promoter): T7 SP6 promoter 20pb target
The upstream sequence 20bp gRNA skeleton；The downstream reverse primer R:20bp gRNA skeleton
PCR reaction system (25 μ L) is as follows:
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 3min of initial denaturation,
(95 DEG C of 15s of denaturation, anneal 58 DEG C of 15s, extends 72 DEG C of 15s) 32 circulations, then 72 DEG C of 5min.To after reaction, be centrifuged PCR
Product takes 1 μ L sample point sample in carrying out electrophoresis, gel imaging system shooting result on 1.5% Ago-Gel.
D detects after determining that band is correct, carries out Ago-Gel DNA recycling, purification and recovery PCR product.
E measures the DNA concentration (reaching 1 μ g as far as possible) of purifying, then using this DNA as template, is turned in vitro with 20 μ L systems
Record synthesizes specificity gRNA.Tip head used in transcription experiment, EP pipe is the processed RNase-Free product of DEPC, specifically
It operates as follows.
It is transcribed in vitro reaction system (20 μ L):
Reactant is all added in the EP pipe of 0.2mL RNase-Free, after mixing, in 37 DEG C of water-bath 2h；
After the water bath is over, 1 μ L DNA enzymatic is added into transcription system, is placed in 37 DEG C of water-baths and reacts 30min, to disappear
Change DNA profiling, then takes 1 μ L sample, carry out electrophoresis with prepared 1.5% Ago-Gel, to detect transcription result, if
Transcription product size is consistent with expected, then illustrates to transcribe successfully；F), the purifying of specific gRNA
Successful gRNA is transcribed with RNeasy Mini kit kits, is stored in -20 DEG C.It draws after purification
1 μ L of gRNA solution carries out agarose gel electrophoresis, to examine purified product, and measures the gRNA concentration after purifying.
The microinjection of step 3), zebrafish embryo
Within after fertilization 30min, embryo transfer is drawn to the dedicated culture of microinjection for using agarose production with suction pipe
In ware.
Before carrying out microinjection, Cas9mRNA and gRNA are made into mixed liquor, mixed well, makes the end of Cas9mRNA
Concentration is the final concentration of 20ng/ μ L of 150ng/ μ L, gRNA.About 1nL Cas9mRNA and gRNA mixed liquor are injected in one cell stage
Fertilized eggs in.The fertilized eggs injected are placed in E3 water (5mmol/L NaCl, 0.33mmol/L CaCl2,0.33mmol/L
MgSO4,0.17mmol/L KCl) in, 28 DEG C of hatchings.Embryonic phenotypes are observed under Stereo microscope, screen the embryo of normal development
Tire is used for target position point mutation analysis.
Microinjection system is as follows:
The validity of step 4), Sanger sequencing detection target site:
After carrying out microinjection to zebrafish embryo, the normal body early embryo of individual developmental is selected, its mir196a is detected
Gene can confirm whether the target site of this time selection is effective with the presence or absence of mutation in advance, and whether microinjection operation standardizes.
A, zebra fish genome is extracted
Zebrafish embryo be fertilized 36 hours after (36hpf), respectively collect wild type (control) and injection after embryo in
In 1.5mL Ep pipe (2 embryos of every pipe), genomic DNA is extracted by the following method, the specific steps are as follows:
200 μ L cell pyrolysis liquids are added into the Ep pipe equipped with embryo, 2 μ L Proteinase Ks are placed in 55 DEG C of water-baths and split
Solution is overnight.
It after the completion of cracking, puts and fullys shake on the oscillator, isometric (200 μ L) isopropanol (pre-cooling) is added in Ep
Guan Zhong is sufficiently mixed by inversion, and under the conditions of 4 DEG C, 12000 × g is centrifuged 10min, outwells supernatant；
75% ethyl alcohol, 500 μ L is added, under the conditions of 4 DEG C, 12000 × g is centrifuged 5min, abandons supernatant, is air-dried at room temperature
20min；
60 μ L deionized waters are added, sufficiently piping and druming mixes, agarose gel electrophoresis Detection and Extraction efficiency
B, PCR amplification aim sequence
After extracting genomic DNA, according to the genome area of CRISPR target site upstream and downstream about 150-200bp, utilize
5.0 software Design primers sequence of Primer Premier is to amplify target DNA fragment.
PCR reaction system (50 μ L) is as follows:
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 5min of initial denaturation,
(95 DEG C of 30s of denaturation, anneal 60 DEG C of 30s, extends 72 DEG C of 30s) 30 circulations, then 72 DEG C of 8min.To after reaction, be centrifuged PCR
Product takes 5 μ L sample point samples in carrying out electrophoresis on 1.5% Ago-Gel, and whether detection PCR product size is correct.
C, PCR product is separated with 1.5% agarose gel electrophoresis, wild type gene group, which carries out PCR amplification, will appear 210bp
Band, the PCR product after gene knockout will appear the wild type band of 210bp and the gene knockout band of 112bp, in purple
The gene knockout band of outer incision 112bp carries out purification and recovery.
D, the target DNA fragment after partial purification is sent to carry out Sanger sequencing, it is slotting tentatively to obtain by the peak figure being sequenced
The information for entering or lacking.
E, it after injecting two months, carries out cutting tail identification, ibid authentication step.
The TA clone of step 5), aim sequence:
PCR Preliminary Identification has the aim sequence of large fragment deletion to carry out Sanger sequencing again, if sequencing peak figure has bimodal, connects
Picking monoclonal makees further detection after getting off to carry out TA clone.
The Sanger sequencing of step 6), plasmid:
The plasmid that double digestion testing result display stripe size meets expected results is sent to sequencing, is given later according to sequencing
Peak figure and sequence out, compare on NCBI with standard aim sequence, according to comparison result, analyze each monoclonal
Mutation type.
Step 7), the F1 generation for obtaining heritable zebra fish mutant:
By front it is a series of screening zebra fish mutant F0 generation has been determined, and then by F0 for mutant respectively with it is wild
Type zebra fish hybridizes to obtain F1 generation embryo, is placed in 28.5 DEG C of cultures, observes the survival rate of F1 generation in the early stage.It is fertilized two days later, often
A mutant F1 generation takes 2 embryos to carry out mutation heredity identification respectively.Each embryo is individually extracted into genome, then PCR
The target site near zone of 210bp is amplified, whether observation PCR amplification will appear small band, and PCR will appear 112bp or so
Small band, if whether this mutation can be genetic to F1 generation, whether PCR amplification will appear the small band of a 112bp.
If detecting the presence of mutation from F1 generation embryo, the F1 generation of zebra fish mutant was brought up to 2-3 months.Again
Every F1 generation zebra fish adult fish is carried out respectively to cut tail, is screened F1 generation mutant (specific method is as previously described).
Step 8) obtains the F2 of zebra fish mutant for homozygote:
The raun and milter of identical mutation are selected from F1 generation mutant, hybridization obtains F2 generation, is placed in 28 DEG C of cultures, by
Essence takes partial embryonic to be identified two days later.Each embryo is individually extracted into genome, PCR amplification goes out near 210bp target site
Region is analyzed and is sequenced by PCR amplification, the whether available mir196a mutant homozygote of preliminary test.Such as inspection result
There are homozygotes for proof, then single cuts tail identification again after bringing up.
Step 9), the F3 generation pure lines heredity that can ibid carry out the Gene Deletion zebra fish, obtain this new zebra fish
Strain.
Using the method for the present invention, sequence such as SEQ ID No.1 institute after the zebra fish gene delection experimental design area knocks out
Show.
Further, the selection of target site 1 (being transcribed using SP6 promoter) follows following standard in step 1): 5 '-
(N) 20-NGG-3 ' guarantees that 3 ' ends of target site are NGG；The selection of target site 2 follows following standard: 5 '-GG- (N) 18-NGG-3 '
Wherein the GG dinucleotides at 5 ' ends is a part of T7 promoter, guarantees that 3 ' ends of target site are NGG；The selection position of target spot exists
In the stem ring region of mir196a gene.
Further, Tip head used in the experiment of transcription described in step 2), EP pipe is the processed RNase- of DEPC
Free。
Further, described in the step c of step 2) in being carried out amplification reaction in PCR instrument, reaction condition are as follows: pre- to become
Property 95 DEG C of 3min, repeat 32 circulation following steps: 95 DEG C of 15s---- of denaturation, the 58 DEG C of 15s--- that anneal extend 72 DEG C of 10s, then
72℃5min；To after reaction, be centrifuged PCR product, electrophoresis is carried out.
Further, E3 water described in step 3) is 5mmol/L NaCl, 0.33mmol/L CaCl2,0.33mmol/L
The mixture of MgSO4,0.17mmol/L KCl.
Further, described in the b step of step 4) in being carried out amplification reaction in PCR instrument, reaction condition are as follows: pre- to become
Property 95 DEG C of 5min, repeat 30 circulation following steps: 95 DEG C of 30s--- of denaturation, the 60 DEG C of 30s--- that anneal extend 72 DEG C of 30s, then
72℃8min；To after reaction, be centrifuged PCR product, electrophoresis is carried out.
The beneficial effects of the present invention are:
By CRISPR/Cas9 gene editing technology, suitable target practice position is designed on the mir196a gene of zebra fish
Point, the specific sgRNA synthesized in vitro (final concentration 20ng/ μ L) and Cas9-mRNA (final concentration 150ng/ μ L), micro- total note
It injects into zebra fish one into the cell, after Embryo Culture 36h, passes through and choose embryo's progress genotyping, identify set target practice position
The validity of point.
The present invention can the more efficient and more accurately silencing specific gene in organism genome, and make simple, cost
It is low, and sites multiple on target gene can be sheared simultaneously, any number of individual gene of silencing.
Mir196a has strong expression in expression, especially enteron aisle in multiple tissues of human embryos early stage.Interference is fallen
Mir196a gene, and its function is studied by science of heredity means, help further to disclose the entire mistake that Intestinal Morphology occurs
Journey and the molecular mechanism for regulating and controlling these processes, medically in the understanding of intestines problem pathology and the research and development of new therapeutic scheme
It has a very important significance.
The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
Detailed description of the invention
Fig. 1 is the schematic diagram of CRISPR/Cas9 targeting system.
Fig. 2 is the structure chart of target site on mir196a gene.
Fig. 3 is zebra fish F1 generation electrophoresis result figure.
Fig. 4 is that deletion form and wild type (WT type) gene order forward direction compare.
Fig. 5 is that target site nearby lacks comparison.
Specific embodiment
In order to make those skilled in the art more fully understand technical solution of the present invention, with reference to the accompanying drawing to the present invention into
Row detailed description, the description of this part be only it is exemplary and explanatory, should not have any limitation to protection scope of the present invention
Effect.
Embodiment 1:
1) CRISPR/Cas9 gene knockout target site and detection primer are designed
Zebra fish is inquired on National Center for Biotechnology Information (NCBI)
The genomic dna sequence of mir196a gene, in website SMART (http://smart.embl-heidelberg.de/) on point
Analyse its functional domain, according to CRISPR/Cas knock out principle, in website The ZiFiT Targeter (http:// zifit.partners.org/ZiFiT/) on design mir196a gene target site.The selection of target spot must comply with this standard:
5'-GG-(N)18-NGG-3'.Wherein the GG dinucleotides at 5 ' ends is a part of T7 promoter, can not when designing target site
It is so limited, but it must be ensured that 3 ' ends of target site are NGG.The selection position of target spot must in the structural domain of gene, with
Ensure that the insertion of target site base or missing can influence the total domain of mir196a gene, thus to change gene
Expression.
Two pairs of specific target sites PCR primers are as follows:
F1 (target site a forward primer):
GCGATTTAGGTGACACTATAtagcccgtccagctgatgcgGTTTTAGAGCTAGAAATAG
F2 (target site b forward primer):
GCGTAATACGACTCACTATAGGccgttcatttccgccaaattaccGTTTTAGAGCTAGAAATAG
R (shared reverse primer): AAGCACCGACTCGGTGCCACT
PCR detection primer
PCR detection primer upstream and downstream primer is located on mir196a introne:
F(5’-CAATACCCTTAACCGAACTGA-3’)
R(5’-TCATTTACAATGCCATTTGC-3
2) it constructs gRNA expression vector and gRNA is synthesized in vitro
A carries out PCR by following specific primer, amplifies and close for specificity gRNA using the DNA of synthesis as template
At double-stranded DNA.
Positive specific target sites primers F 1 or the upstream F2:T7 promoter 20pb target sequence 20bp gRNA skeleton；Reversely draw
The downstream object R:20bp gRNA skeleton
PCR reaction system (25 μ L) is as follows:
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 3min of initial denaturation,
(95 DEG C of 15s of denaturation, anneal 56 DEG C of 15s, extends 72 DEG C of 15s) 32 circulations, then 72 DEG C of 5min.To after reaction, be centrifuged PCR
Product takes 1 μ L sample point sample in carrying out electrophoresis, gel imaging system shooting result on 1.5% Ago-Gel.
D detects after determining that band is correct, carries out Ago-Gel DNA recycling, purification and recovery PCR product.
E measures the DNA concentration (reaching 1 μ g as far as possible) of purifying, then using this DNA as template, is turned in vitro with 20 μ L systems
Record synthesizes specificity gRNA.Tip head used in transcription experiment, EP pipe is the processed RNase-Free product of DEPC, specifically
It operates as follows:
It is transcribed in vitro reaction system (20 μ L):
Reactant is all added in the EP pipe of 0.2mL RNase-Free, after mixing, in 37 DEG C of water-bath 2h；
After the water bath is over, 1 μ L DNA enzymatic is added into transcription system, is placed in 37 DEG C of water-baths and reacts 30min, to disappear
Change DNA profiling, then takes 1 μ L sample, carry out electrophoresis with prepared 1.5% Ago-Gel, to detect transcription result, if
Transcription product size is consistent with expected, then illustrates to transcribe successfully；F, the purifying of specific gRNA
Successful gRNA is transcribed with RNeasy Mini kit kits, is stored in -20 DEG C.It draws after purification
1 μ L of gRNA solution carries out agarose gel electrophoresis, to examine purified product, and measures the gRNA concentration after purifying.
3) microinjection of zebrafish embryo
Within after fertilization 30min, embryo transfer is drawn to the dedicated culture of microinjection for using agarose production with suction pipe
In ware.
Before carrying out microinjection, Cas9mRNA and gRNA are made into mixed liquor, mixed well, makes the end of Cas9mRNA
Concentration is the final concentration of 20ng/ μ L of 150ng/ μ L, gRNA.About 1.8nL Cas9mRNA and gRNA mixed liquor are injected in a cell
In the fertilized eggs of phase.The fertilized eggs injected are placed in E3 water (5mmol/L NaCl, 0.33mmol/L CaCl2,0.33mmol/
L MgSO4,0.17mmol/L KCl) in, 28 DEG C of hatchings.Embryonic phenotypes are observed under Stereo microscope, screen normal development
Embryo is used for target position point mutation analysis.
Microinjection system is as follows:
4) validity of Sanger sequencing detection target site
After carrying out microinjection to zebrafish embryo, the normal body early embryo of individual developmental is selected, its mir196a is detected
Gene can confirm whether the target site of this time selection is effective with the presence or absence of mutation in advance, and whether microinjection operation standardizes.
A, zebra fish genome is extracted
Zebrafish embryo be fertilized 36 hours after (36hpf), respectively collect wild type (control) and injection after embryo in
In 1.5mL Ep pipe (2 embryos of every pipe), genomic DNA is extracted by the following method, the specific steps are as follows:
200 μ L cell pyrolysis liquids are added into the Ep pipe equipped with embryo, 2 μ L Proteinase Ks are placed in 55 DEG C of water-baths and split
Solution is overnight.
It after the completion of cracking, puts and fullys shake on the oscillator, isometric (200 μ L) isopropanol (pre-cooling) is added in Ep
Guan Zhong is sufficiently mixed by inversion, and under the conditions of 4 DEG C, 12000 × g is centrifuged 10min, outwells supernatant；
75% ethyl alcohol, 500 μ L is added, under the conditions of 4 DEG C, 12000 × g is centrifuged 5min, abandons supernatant, is air-dried at room temperature
20min；
60 μ L deionized waters are added, sufficiently piping and druming mixes, agarose gel electrophoresis Detection and Extraction efficiency
B, PCR amplification aim sequence
After extracting genomic DNA, according to the genome area of CRISPR target site upstream and downstream about 150-200bp, utilize
5.0 software Design primers sequence of Primer Premier is to amplify target DNA fragment.
PCR reaction system (50 μ L) is as follows:
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 5min of initial denaturation,
(95 DEG C of 30s of denaturation, anneal 60 DEG C of 30s, extends 72 DEG C of 30s) 30 circulations, then 72 DEG C of 8min.To after reaction, be centrifuged PCR
Product takes 5 μ L sample point samples in carrying out electrophoresis on 1.5% Ago-Gel, and whether detection PCR product size is correct.
If c, PCR product is correct, PCR product is separated with 1.5% agarose gel electrophoresis, purpose item is cut under ultraviolet
Band carries out purification and recovery.
D, the target DNA fragment after partial purification is sent to carry out Sanger sequencing, it is slotting tentatively to obtain by the peak figure being sequenced
The information for entering or lacking.
4) it after injecting two months, carries out cutting tail identification, ibid authentication step.
5) the TA clone of aim sequence
PCR Preliminary Identification has the possible aim sequence of mutation to carry out Sanger sequencing again.If sequencing peak figure have it is bimodal, and
Sequencing result shows the aim sequence of insertion or deficient phenomena, makees followed by picking monoclonal after TA clone further
Detection.
6) the Sanger sequencing of plasmid
The plasmid that double digestion testing result display stripe size meets expected results is sent to sequencing, is given later according to sequencing
Peak figure and sequence out, compare on NCBI with standard aim sequence, according to comparison result, analyze each monoclonal
Mutation type.
7) F1 generation of heritable zebra fish mutant is obtained
By front it is a series of screening zebra fish mutant F0 generation has been determined, and then by F0 for mutant respectively with it is wild
Type zebra fish hybridizes to obtain F1 generation embryo, is placed in 28.5 DEG C of cultures, observes the survival rate of F1 generation in the early stage.It is fertilized two days later, often
A mutant F1 generation takes 2 embryos to carry out mutation heredity identification respectively.Each embryo is individually extracted into genome, then PCR
The target site near zone of 210bp is amplified, whether observation PCR amplification will appear small band, and PCR will appear 112bp or so
Small band, if whether this mutation can be genetic to F1 generation, whether PCR amplification will appear the small band of a 112bp.
If detecting the presence of mutation from F1 generation embryo, the F1 generation of zebra fish mutant was brought up to 2-3 months.Again
Every F1 generation zebra fish adult fish is carried out respectively to cut tail, is screened F1 generation mutant (specific method is as previously described).
8) F2 of zebra fish mutant is obtained for homozygote
The raun and milter of identical mutation are selected from F1 generation mutant, hybridization obtains F2 generation, is placed in 28.5 DEG C of cultures,
Fertilization takes partial embryonic to be identified two days later.Each embryo is individually extracted into genome, it is attached that PCR amplification goes out 112bp target site
Near field is analyzed and is sequenced by PCR amplification, the whether available mir196a mutant homozygote of preliminary test.Such as examine knot
Fruit proves that there are homozygotes, then single cuts tail identification again after bringing up.
9) the F3 generation pure lines heredity that, can ibid carry out the Gene Deletion zebra fish, obtains this new zebra fish strain.
Attached drawing 3 is zebra fish F1 generation electrophoresis result figure, the adult fish of F1 generation is carried out genotyping, PCR amplification result is aobvious
Show, 2,9, No. 11 swimming lanes are compared with wild type, and in addition to the purpose band of 210bp, there are also the bands of a 112bp or so, by this
Band carries out gel extraction, TA clone, and is sequenced.If Fig. 4 and Fig. 5 are shown, by sequencing result and wild-type sequence (210bp) into
Row comparison finds at two target sites of mir196a that (runic expression, underscore) has base deletion, target site a and target site b
Between have the missings of 103 bases, since the mir196a Gene Partial base deletion of the F1 generation of No. 2 mutant screened is made
At the frameshift mutation of whole gene, change the zebra fish expression of mir196a gene.To influence the development of zebra fish enteron aisle.
The above is only presently preferred embodiments of the present invention, not does limitation in any form to the present invention, it is all according to
According to any simple modification to the above embodiments in technical spirit of the invention, equivalent variations, guarantor of the invention is each fallen within
Within the scope of shield.
Sequence table
<110>Hunan Normal University
<120>a kind of method of gene knockout breeding mir196a Gene Deletion zebra fish
<141> 2019-03-02
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 300
<212> DNA
<213>zebra fish (Brachydanio rerio)
<400> 1
catataacag ttgatttgat attgtatgag aattaaatat gtccaatacc cttaaccgaa 60
ctgataataa aggaaggtct tgaagtggat agcccgtcca gctgatgcgt ggtttaggta 120
gtttgatgtt gttggggttg acttcctggc tcgacaacaa gaaactgcct tgattacgtc 180
agtttgcctt catcaaggcc gttcatttcc gccaaattac ccttgcagac tgcgcaaatg 240
gcattgtaaa tgaaccaccg ccggcggctc tacaatacac agtatccttc tatcctttca 300
Claims (6)
1. a kind of method of gene knockout breeding mir196a Gene Deletion zebra fish, which comprises the following steps:
Step 1) separately designs CRISPR/Cas9 gene knockout target site and detection primer:
The genomic dna sequence that zebra fish mir196a gene is inquired on NCBI, analyzes its functional structure on the SMART of website
Domain knocks out principle according to CRISPR/Cas, the target site of mir196a gene is designed on the The ZiFiT Targeter of website；
Two pairs of specific target sites PCR primers are as follows:
Target site a forward primer, F1:
GCGATTTAGGTGACACTATAtagcccgtccagctgatgcgGTTTTAGAGCTAGAAATAG
Target site b forward primer, F2:
GCGTAATACGACTCACTATAGGccgttcatttccgccaaattaccGTTTTAGAGCTAGAAATAG
Shared reverse primer, R:AAGCACCGACTCGGTGCCACT
PCR detection primer: PCR detection primer upstream and downstream primer is located at the upstream and downstream of mirR196a:
F:5 '-CAATACCCTTAACCGAACTGA-3 '
R:5 '-TCATTTACAATGCCATTTGC-3
Common template sequence:
TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT
GCTTT
Step 2), PCR product carry out gene specific gRNA and synthesize in vitro:
A carries out PCR by following specific primer using the DNA of synthesis as template, amplifies for specific gRNA synthesis
Double-stranded DNA；
Positive specific target sites primers F 1 or the upstream F2:T7 promoter 20pb target sequence 20bp gRNA skeleton, reverse primer R:
The downstream 20bp gRNA skeleton,
PCR reaction system is as follows:
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument；
B detects after determining that band is correct, carries out Ago-Gel DNA recycling, purification and recovery PCR product；
C measures the DNA concentration of purifying, then using this DNA as template, is transcribed in vitro with 20 μ L systems, synthesis specificity
gRNA；Concrete operations are as follows:
Reaction system is transcribed in vitro:
Reactant is all added in 0.2mL EP pipe, after mixing, in 37 DEG C of water-bath 2h；
After the water bath is over, DNA profiling is digested, then electrophoresis；
D, the purifying of specific gRNA
Successful gRNA is transcribed with RNeasy Mini kit kits, is stored in -20 DEG C；Agarose gel electrophoresis is carried out,
To examine purified product, and the gRNA concentration after purifying is measured with Nano drop；
The microinjection of step 3), zebrafish embryo:
Within after fertilization 30min, embryo transfer is drawn into the microinjection special culture dish for using agarose production with suction pipe,
Before carrying out microinjection, Cas9mRNA and gRNA are made into mixed liquor, mixed well, keeps the end of Cas9 mRNA dense
Degree is the final concentration of 20ng/ μ L of 150ng/ μ L, gRNA, injects about 1.0nL Cas9 mRNA and gRNA mixed liquor in a cell
In the fertilized eggs of phase；The fertilized eggs injected are placed in E3 water, 28 DEG C of hatchings；Embryonic phenotypes are observed under Stereo microscope,
The embryo for screening normal development is used for target position point mutation analysis；
Microinjection system is as follows:
The validity of step 4), Sanger sequencing detection target site:
After carrying out microinjection to zebrafish embryo, the normal body early embryo of individual developmental is selected, its mir196a gene is detected
With the presence or absence of mutation；
A extracts zebra fish genome
After zebrafish embryo is fertilized 36 hours (36hpf), embryo is in 1.5mL Ep pipe after collecting wild type and injection respectively, often
2 embryos of pipe, extract genomic DNA by the following method, the specific steps are as follows:
200 μ L cell pyrolysis liquids are added into the Ep pipe equipped with embryo, 2 μ L Proteinase Ks are placed in 55 DEG C of water-baths and cracked
Night；
It after the completion of cracking, puts and fullys shake on the oscillator, the isopropanol pre-cooled in equal volume is added in Ep pipe, sufficiently runs
It mixes, under the conditions of 4 DEG C, 12000 × g is centrifuged 10min, outwells supernatant；
75% ethyl alcohol, 500 μ L is added, under the conditions of 4 DEG C, 12000 × g is centrifuged 5min, abandons supernatant, is air-dried at room temperature 20min；
60 μ L deionized waters are added, sufficiently piping and druming mixes, agarose gel electrophoresis Detection and Extraction efficiency；
B, PCR amplification aim sequence
After extracting genomic DNA, according to the genome area of CRISPR target site upstream and downstream about 150-200bp, Primer is utilized
5.0 software Design primers sequence of Premier is to amplify target DNA fragment；
PCR reaction system is as follows:
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument；
C separates PCR product with 1.5% agarose gel electrophoresis, and wild type gene group, which carries out PCR amplification, will appear the item of 210bp
Band, the PCR product after gene knockout will appear the wild type band of 210bp and the gene knockout band of 112bp, under ultraviolet
The gene knockout band of 112bp is cut, purification and recovery is carried out；
D send the target DNA fragment after partial purification to carry out Sanger sequencing, by the peak figure being sequenced come it is preliminary be inserted into or
The information of missing；
E after injection two months, carries out cutting tail identification, ibid authentication step；
The TA clone of step 5), aim sequence:
PCR Preliminary Identification has the aim sequence of large fragment deletion to carry out Sanger sequencing again, if sequencing peak figure have it is bimodal, next
Picking monoclonal makees further detection after carrying out TA clone；
The Sanger sequencing of step 6), plasmid:
The plasmid that double digestion testing result display stripe size meets expected results is sent to sequencing, according to what is provided after sequencing
Peak figure and sequence compare on NCBI with standard aim sequence, according to comparison result, analyze the mutation of each monoclonal
Type；
Step 7), the F1 generation for obtaining heritable zebra fish mutant:
By front it is a series of screening zebra fish mutant F0 generation has been determined, and then by F0 for mutant respectively with wild type spot
Horse fish hybridizes to obtain F1 generation embryo, is placed in 28.5 DEG C of cultures, observes the survival rate of F1 generation in the early stage；Fertilization is two days later, each prominent
Variant F1 generation takes 2 embryos to carry out mutation heredity identification respectively；Each embryo is individually extracted into genome, then PCR amplification
Whether the target site near zone of 210bp out, observation PCR amplification will appear small band, and PCR will appear the small of 112bp or so
Band, if this mutation can be genetic to F1 generation, PCR amplification will appear the small band of 112bp；
If detecting the presence of mutation from F1 generation embryo, the F1 generation of zebra fish mutant was brought up to 2-3 months；Distinguish again
Every F1 generation zebra fish adult fish is carried out to cut tail, screens F1 generation mutant；
Step 8) obtains the F2 of zebra fish mutant for homozygote
The raun and milter of identical mutation are selected from F1 generation mutant, hybridization obtains F2 generation, is placed in 28.5 DEG C of cultures, is fertilized
Partial embryonic is taken to be identified two days later；Each embryo is individually extracted into genome, PCR amplification goes out 112bp target site area nearby
Domain is analyzed and is sequenced by PCR amplification, the whether available mir196a mutant homozygote of preliminary test；Select inspection result
There are homozygotes for proof, and single cuts tail identification again after bringing up；
Step 9), the F3 generation pure lines heredity that can ibid carry out the Gene Deletion zebra fish, obtain this new zebra fish strain.
2. the method for gene knockout breeding mir196a Gene Deletion zebra fish according to claim 1, feature exist
In, the selection of target site 1 (being transcribed using SP6 promoter) follows following standard: 5 '-(N) 20-NGG-3 ' in step 1),
3 ' the ends for guaranteeing target site are NGG；Target site 2 selects to follow following standard: the GG at the wherein 5 ' ends 5 '-GG- (N) 18-NGG-3 '
Dinucleotides is a part of T7 promoter, guarantees that 3 ' ends of target site are NGG；The selection position of target spot is in mir196a gene
Stem ring region in.
3. the method for gene knockout breeding mir196a Gene Deletion zebra fish according to claim 1, feature exist
In Tip head used in the experiment of transcription described in step 2), EP pipe is the processed RNase-Free of DEPC.
4. the method for gene knockout breeding mir196a Gene Deletion zebra fish according to claim 1, feature exist
In, in being carried out amplification reaction in PCR instrument described in the step c of step 2), reaction condition are as follows: 95 DEG C of 3min of initial denaturation, then
Repeat 32 circulation following steps: 95 DEG C of 15s---- annealing of denaturation, 58 DEG C of 15s--- extend 72 DEG C of 10s, then 72 DEG C of 5min；To anti-
After answering, it is centrifuged PCR product, carries out electrophoresis.
5. the method for gene knockout breeding mir196a Gene Deletion zebra fish according to claim 1, feature exist
In, E3 water described in step 3) be 5mmol/L NaCl, 0.33mmol/L CaCl2,0.33mmol/L MgSO4,
The mixture of 0.17mmol/L KCl.
6. the method for gene knockout breeding mir196a Gene Deletion zebra fish according to claim 1, feature exist
In, in being carried out amplification reaction in PCR instrument described in the b step of step 4), reaction condition are as follows: 95 DEG C of 5min of initial denaturation, then
Repeat 30 circulation following steps: 95 DEG C of 30s--- annealing of denaturation, 60 DEG C of 30s--- extend 72 DEG C of 30s, then 72 DEG C of 8min；To anti-
After answering, it is centrifuged PCR product, carries out electrophoresis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910158021.9A CN109897868A (en) | 2019-03-02 | 2019-03-02 | A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910158021.9A CN109897868A (en) | 2019-03-02 | 2019-03-02 | A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109897868A true CN109897868A (en) | 2019-06-18 |
Family
ID=66946156
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910158021.9A Pending CN109897868A (en) | 2019-03-02 | 2019-03-02 | A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109897868A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111802307A (en) * | 2020-07-29 | 2020-10-23 | 湖南工商大学 | Zebra fish training device |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006069584A2 (en) * | 2004-12-29 | 2006-07-06 | Exiqon A/S | NOVEL OLIGONUCLEOTIDE COMPOSITIONS AND PROBE SEQUENCES USEFUL FOR DETECTION AND ANALYSIS OF microRNAs AND THEIR TARGET mRNAs |
| CN107988268A (en) * | 2017-12-18 | 2018-05-04 | 湖南师范大学 | A kind of method of gene knockout selection and breeding tcf25 Gene Deletion zebra fish |
| CN109266687A (en) * | 2018-10-25 | 2019-01-25 | 湖南师范大学 | A kind of method of gene knockout breeding tnni3k Gene Deletion zebra fish |
-
2019
- 2019-03-02 CN CN201910158021.9A patent/CN109897868A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006069584A2 (en) * | 2004-12-29 | 2006-07-06 | Exiqon A/S | NOVEL OLIGONUCLEOTIDE COMPOSITIONS AND PROBE SEQUENCES USEFUL FOR DETECTION AND ANALYSIS OF microRNAs AND THEIR TARGET mRNAs |
| CN107988268A (en) * | 2017-12-18 | 2018-05-04 | 湖南师范大学 | A kind of method of gene knockout selection and breeding tcf25 Gene Deletion zebra fish |
| CN109266687A (en) * | 2018-10-25 | 2019-01-25 | 湖南师范大学 | A kind of method of gene knockout breeding tnni3k Gene Deletion zebra fish |
Non-Patent Citations (1)
| Title |
|---|
| SU-CHENLI等: "Roles of miR-196a on gene regulation of neuroendocrine tumor cells", 《MOLECULAR AND CELLULAR ENDOCRINOLOGY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111802307A (en) * | 2020-07-29 | 2020-10-23 | 湖南工商大学 | Zebra fish training device |
| CN111802307B (en) * | 2020-07-29 | 2022-03-29 | 湖南工商大学 | Zebra fish training device |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988268A (en) | A kind of method of gene knockout selection and breeding tcf25 Gene Deletion zebra fish | |
| CN105594664B (en) | A kind of method of gene knockout selection and breeding stat1a Gene Deletion zebra fish | |
| CN105647969B (en) | Method for breeding zebra fish with stat1a gene deletion by gene knockout | |
| CN108018316A (en) | A kind of method of gene knockout selection and breeding rmnd5b Gene Deletion zebra fish | |
| CN108048486A (en) | A kind of method of gene knockout selection and breeding fhl1b Gene Deletion zebra fish | |
| CN107058320B (en) | The preparation and its application of IL7R gene delection zebra fish mutant | |
| CN105177126B (en) | It is a kind of using Fluorescence PCR assay to the Classification Identification method of mouse | |
| CN106191110A (en) | A kind of wnt16 Gene Deletion Brachydanio rerio | |
| CN109266687A (en) | A kind of method of gene knockout breeding tnni3k Gene Deletion zebra fish | |
| CN106191112A (en) | A kind of method of gene knockout selection-breeding wnt16 Gene Deletion Brachydanio rerio | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| CN110684777B (en) | Application of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular stings | |
| CN110607359B (en) | Patinopecten yessoensis female specific marker combination and application | |
| CN109280666A (en) | A kind of method of gene knockout breeding bai2 Gene Deletion zebra fish | |
| CN111394445B (en) | Indel marker for sex identification of channa maculata and application thereof | |
| CN113584079A (en) | Establishment of zebra fish heart specific marker strain applied to calcium ion imaging | |
| CN109652457A (en) | A kind of method of gene knockout breeding ALPK2 Gene Deletion zebra fish | |
| CN110894510A (en) | Method for breeding Lgr6 gene-deleted zebra fish through gene knockout | |
| CN111154758A (en) | Method for knocking out zebra fish slc26a4 gene | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN110066805A (en) | The method of gene knockout breeding adgrf3b Gene Deletion zebra fish | |
| CN101818195A (en) | Genetic marker by taking pig miR-27a precursor flanking sequence SNP as trait of litter size of pig and application | |
| CN113637765A (en) | Molecular marker for identifying genetic sex of micropterus salmoides and application | |
| CN109468324A (en) | A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish | |
| CN109897868A (en) | A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190618 |
|
| RJ01 | Rejection of invention patent application after publication |