CN109468324A - A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish - Google Patents

A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish Download PDF

Info

Publication number
CN109468324A
CN109468324A CN201811444490.9A CN201811444490A CN109468324A CN 109468324 A CN109468324 A CN 109468324A CN 201811444490 A CN201811444490 A CN 201811444490A CN 109468324 A CN109468324 A CN 109468324A
Authority
CN
China
Prior art keywords
gene
zebra fish
pcr
pdlim5b
grna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811444490.9A
Other languages
Chinese (zh)
Inventor
邓云
曾宇茜
刘乐
陈湘定
谢紫微
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Normal University
Original Assignee
Hunan Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Normal University filed Critical Hunan Normal University
Priority to CN201811444490.9A priority Critical patent/CN109468324A/en
Publication of CN109468324A publication Critical patent/CN109468324A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knockout animals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/40—Fish
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Abstract

The present invention relates to gene Knockout fields, especially disclose a kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish, pass through CRISPR/Cas9 gene editing technology, suitable target practice site is designed on the pdlim5b gene of zebra fish, the specific gRNA and Cas9- albumen synthesized in vitro, micro- co-injection enters zebra fish one into the cell, after+Embryo Culture 48h, genotyping is carried out by choosing embryo, to confirm the validity in selected site.The present invention can the more efficient and more accurately silencing specific gene in organism genome, and make simple, at low cost, and sites multiple on target gene can be sheared simultaneously, any number of individual gene of silencing.And interference falls pdlim5b gene zebrafish embryo and apparent developmental deformity occurs.

Description

A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish
Technical field
The present invention relates to gene knockout fields, especially disclose a kind of gene knockout breeding pdlim5b Gene Deletion The method of zebra fish.
Background technique
Pdlim5b(PDZ and LIM domain 5b) gene is located on No. 10 chromosome of zebra fish, and it include 17 Exon and 16 intrones, cDNA overall length 1887bp encode 628 amino acid, and pdlim5b includes to guard in 9 evolution Functional domain, while being analyzed by gene differential expression spectrum analysis and genome association etc., find pdlim5(pdlim5b Homologous gene in the mankind) in multiple tissues of human embryos early stage there is strong expression in expression, especially heart.
Summary of the invention
Gene, signal path in zebra fish and human heart growth course have a high homology, and pdlim5b gene into More conservative in change, research finds that pdlim5b is especially high in zebrafish embryo early expression amount.Moreover, with other animal models It compares, zebra fish has that individual is small, be easy to raise, development is fast, fertility is strong, in vitro fertilization, vitro Development of Embryos and transparent The advantages that.
By CRISPR/Cas9 gene editing technology, suitable target practice position is designed on the pdlim5b gene of zebra fish Point, the 20 ng/ μ L of specific gRNA(final concentration synthesized in vitro) and Cas9 albumen (5 μ g/ μ L of final concentration), micro- co-injection It is intracellular into zebra fish one, after Embryo Culture 48h, genotyping is carried out by choosing embryo, identifies set target practice site Validity.
Gene targeting originates from late 1980s, is a kind of by studying genome progress pointed decoration The important method means of gene function, it can also be used to treat the various genetic diseases of the mankind.The technology mainly utilizes missing Mutation, inactivation of gene, chromosome large fragment delete and foreign gene import etc. modes come change biology hereditary information, and Mutant character is expressed after stablizing heredity in system genitale, to study work of the specific gene in growth and development process in organism With so this kind of technological means has become modern molecular biology research hotspot.Traditional gene targeting is built upon embryo On tire stem cell (ESC) and the basis of homologous recombination technique, therefore Knockout technology efficiency is extremely low.It is a kind of completely new at the beginning of 2013 Artificial endonucleases clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9, can the more efficient and more accurately specific base of silencing in organism genome Cause, and production is simple, at low cost, and can shear simultaneously to sites multiple on target gene, any number of single base of silencing Cause, but the technology haves the defects that certain simultaneously, and off-target rate is relatively high.
Summary of the invention
It is an object of the present invention to overcome the above-mentioned technical problems, and to provide a kind of gene knockout breeding pdlim5b genes to lack The method of mistake type zebra fish has found suitable target practice site, by CRISPR/Cas9 gene editing technology, selects Pdlim5b Gene Deletion zebra fish
The technical solution for solving above-mentioned technical problem is as follows:
1) CRISPR/Cas9 gene knockout target site and detection primer are designed
In National Center for Biotechnology Information(NCBI) on inquire zebra fish pdlim5b The genomic dna sequence of gene analyzes its function on website SMART (http://smart.embl-heidelberg.de/) Structural domain, according to CRISPR/Cas knock out principle, in website The ZiFiT Targeter (http: // Zifit.partners.org/ZiFiT/ the target site of pdlim5b gene is designed on).The selection of target spot must comply with this mark It is quasi-: 5 '-GG- (N) 18-NGG-3 '.Wherein the GG dinucleotides at 5 ' ends is a part of T7 promoter, can when designing target site With not limited, but it must be ensured that 3 ' ends of target site are NGG.The selection position of target spot must be in the structural domain of gene It is interior, to ensure that insertion or the missing of target site base can influence the total domain of pdlim5b gene, thus to change base The expression of cause
Two pairs of specific target sites PCR primers are as follows:
Two pairs of specific target sites PCR primers are as follows:
F1(target site a forward primer):
tgtaatacgactcactata ggagatcagtgttggtgatg gttttagagctagaaatagc
R(shared reverse primer): aagcaccgactcggtgccact
F2(target site b forward primer)
tgtaatacgactcactata ggaagatcaaagcctgcagc gttttagagctagaaatagc
R(shared reverse primer): aagcaccgactcggtgccact
PCR detection primer upstream and downstream primer is located on No. 2 intrones and No. 3 intrones:
F (5’-agactccacccactcaactg-3’)
R (5 '-cactaaacacagcgcagaca-3 ')
2) it constructs gRNA expression vector and gRNA is synthesized in vitro
GRNA skeleton is cloned on p42250 carrier by a first, and 1-2 μ L plasmid is taken to carry out agarose gel electrophoresis detection
B, specific gRNA are synthesized in vitro
This plasmid is linearized with BsaI restriction enzyme.In general, endonuclease reaction total volume is 20 μ L, and system is as follows:
6 μ L of p42250 carrier
10× Buffer 2μL
1 μ L of BsaI restriction enzyme
ddH2O 11μL
20 μ L of total volume
In 37 DEG C of water-baths, digestion 2.5h or more after mixing
C carries out PCR by following specific primer, amplifies for specificity using the p42250 carrier of linearisation as template The double-stranded DNA of gRNA synthesis
Positive specific target sites primers F 1 or the upstream F2:T7 promoter+20pb target sequence+20bp sgRNA skeleton；
The downstream reverse primer R:20bp sgRNA skeleton
PCR reaction system (50 μ L) is as follows:
0.5 μ L of template (p42250 carrier)
Primer F1(or F2,10 uM) 2 μ L
Primer R(10 uM) 2 μ L
2 × Buffer(Mg2+ containing 20mM) 25 μ L
DNTP mix(10 mM) 1 μ L
1 μ L of Ex-Taq archaeal dna polymerase
ddH2O 18.5 μL
50 μ L of total volume
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 5min of initial denaturation (become Property 95 DEG C of 30 s, anneal 60 DEG C of 30s, extends 72 DEG C of 30s) 30 circulations, then 72 DEG C of 8 min.To after reaction, be centrifuged PCR product takes 1 μ L sample point sample in carrying out electrophoresis, gel imaging system shooting result on 1.3% Ago-Gel
D detects after determining that band is correct, carries out Ago-Gel DNA recycling, purification and recovery PCR product
E measures the DNA concentration (reaching 1 μ g as far as possible) of purifying, then using this DNA as template, is turned in vitro with 20 μ L systems Record synthesizes specificity gRNA.Tip head used in transcription experiment, EP pipe is the processed RNase-Free product of DEPC, specifically It operates as follows:
It is transcribed in vitro reaction system (20 μ L):
12 μ L of template DNA
10×Buffer 2μL
RNTP mix(10 mM) 4 μ L
2 μ L of T7 RNA polymerase
Nuclease-Free Water 0 μL
20 μ L of total volume
Reactant is all added in the EP pipe of 0.2 mL RNase-Free, after mixing, in 37 DEG C of 2 .5h of water-bath；
After the water bath is over, 1 μ L DNA enzymatic is added into transcription system, is placed in 37 DEG C of water-baths and reacts 30 min, to disappear Change DNA profiling, then takes 1 μ L sample, carry out electrophoresis with prepared 1.3% Ago-Gel, to detect transcription result, if Transcription product size is consistent with expected, then illustrates to transcribe successfully；
F, the purifying of specific gRNA
Successful gRNA is transcribed with RNeasy Mini kit kits, is stored in -20 DEG C.The gRNA drawn after purification is molten 1 μ L of liquid carries out agarose gel electrophoresis, to examine purified product, and measures the gRNA concentration after purifying
3) microinjection of zebrafish embryo
Within 30 min of after fertilization, embryo transfer is drawn to the microinjection special culture dish for using agarose production with suction pipe In
Before carrying out microinjection, Cas9 albumen and gRNA are made into mixed liquor, mixed well, keeps the end of Cas9 albumen dense Degree is the final concentration of 20 ng/ μ L of 5 μ g/ μ L, gRNA.About 3 μ L Cas9 albumen and gRNA mixed liquor are injected in one cell stage Fertilized eggs in.The fertilized eggs injected are placed in E3 water (5 mmol/L NaCl, 0.33mmol/L CaCl2, 0.33mmol/ L MgSO4, 0.17 mmol/L KCl) in, 28 DEG C of hatchings.Embryonic phenotypes are observed under Stereo microscope, screen normal development Embryo be used for target position point mutation analysis
Microinjection system is as follows:
5 μ g/ μ L of Cas9 albumen
gRNA 20 ng/μL
Nuclease free H2O
Total 3μL
4) validity of Sanger sequencing detection target site
After carrying out microinjection to zebrafish embryo, the normal body early embryo of individual developmental is selected, its pdlim5b gene is detected With the presence or absence of mutation, can confirm whether the target site of this time selection is effective in advance, whether microinjection operation standardizes
A, zebra fish genome is extracted
After zebrafish embryo is fertilized 48 hours (48 hpf), embryo is in 1.5mL after collecting wild type (control) respectively and injecting In Ep pipe (10 embryos of every pipe), genomic DNA is extracted by the following method, the specific steps are as follows:
200 μ L cell pyrolysis liquids are added into the Ep pipe equipped with embryo, 2 μ L Proteinase Ks are placed in 55 DEG C of insulating boxs and split Solution is overnight
It after the completion of cracking, puts and fullys shake on the oscillator, isometric (200 μ L) isopropanol (pre-cooling) is added and is managed in Ep In, it is sufficiently mixed by inversion, under the conditions of 4 DEG C, 12000rpm is centrifuged 10 min, outwells supernatant；
70 % ethyl alcohol, 500 μ L is added, under the conditions of 4 DEG C, 12000rpm is centrifuged 5 min, abandons supernatant, is air-dried at room temperature 5- 10min；
20 μ L deionized waters are added, sufficiently piping and druming mixes, agarose gel electrophoresis Detection and Extraction efficiency
B, PCR amplification aim sequence
After extracting genomic DNA, according to the genome area of CRISPR target site upstream and downstream about 50-100bp, Primer is utilized 3.0 software Design primers sequences are to amplify target DNA fragment
PCR reaction system (20 μ L) is as follows:
2×Es Taq MasterMix 10 μL
Primer F (10 μM) 1 μL
Primer R (10 μM) 1 μL
1 μ L of template (genomic DNA)
ddH2O 7 μL
20 μ L of total volume
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 5 min of initial denaturation, (95 DEG C of 30 s of denaturation, anneal 60 DEG C of 30 s, extends 72 DEG C of 30 s) 30 circulation, then 72 DEG C of 8 min.To the end of reacting Afterwards, it is centrifuged PCR product, takes 2 μ L sample point samples in carrying out electrophoresis on 1.3 % Ago-Gels, just whether detection PCR product size Really
If c, PCR product is correct, PCR product is separated with 1.3 % agarose gel electrophoresis, part PCR product is sent to carry out Sanger sequencing is tentatively obtained the information of insertion or missing by the peak figure being sequenced
4) it after injecting two months, carries out cutting tail identification, ibid authentication step
5) the TA clone of aim sequence
PCR identification have purpose band after carries out Sanger sequencing again, if sequencing peak figure have it is bimodal, and sequencing result show it is slotting Enter or the aim sequence of deficient phenomena, makees further detection followed by picking monoclonal after TA clone
6) the Sanger sequencing of plasmid
The plasmid that double digestion testing result display stripe size meets expected results is sent to sequencing, according to what is provided after sequencing Peak figure and sequence compare on NCBI with standard aim sequence, according to comparison result, analyze the mutation of each monoclonal Type
7) F1 generation of heritable zebra fish mutant is obtained
By front it is a series of screening zebra fish mutant F0 generation has been determined, and then by F0 for mutant respectively with wild type spot Horse fish hybridizes to obtain F1 generation embryo, is placed in 28 DEG C of cultures, observes the survival rate of F1 generation in the early stage.It is fertilized two days later, each mutation Body F1 generation takes 10 embryos to carry out mutation heredity identification respectively.Every pipe embryo is extracted into genome, then PCR amplification goes out Whether the target site near zone of 355bp, observation PCR amplification will appear small band, and PCR will appear the small band of 300bp or so, If this mutation can be genetic to F1 generation, PCR amplification will appear the small band less than 355bp
If detecting the presence of mutation from F1 generation embryo, the F1 generation of zebra fish mutant was brought up to 2-3 months.Distinguish again Every F1 generation zebra fish adult fish is carried out to cut tail, is screened F1 generation mutant (specific method is as previously described).
The beneficial effects of the present invention are:
By CRISPR/Cas9 gene editing technology, suitable target practice site is designed on the pdlim5b gene of zebra fish, The 20 ng/ μ L of specific gRNA(final concentration synthesized in vitro) and Cas9 albumen (5 μ g/ μ L of final concentration), micro- co-injection entrance Zebra fish one is intracellular, after Embryo Culture 48h, carries out genotyping by choosing embryo, identifies having for set target practice site Effect property.The present invention can the more efficient and more accurately silencing specific gene in organism genome, and make it is simple, at low cost, And sites multiple on target gene can be sheared simultaneously, any number of individual gene of silencing, off-target rate is very low, and interferes There is apparent developmental deformity in pdlim5b gene zebrafish embryo.
The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.
Detailed description of the invention
Fig. 1 is the schematic diagram of CRISPR/Cas9 targeting system；
Fig. 2 is the structure chart of target site on pdlim5b gene；
Fig. 3 is zebra fish F1 generation electrophoresis result figure；
Fig. 4 is that deletion form and WT type gene order forward direction compare；
Fig. 5 is that target site nearby lacks comparison.
Specific embodiment
Embodiment 1:
1) CRISPR/Cas9 gene knockout target site and detection primer are designed
In National Center for Biotechnology Information(NCBI) on inquire zebra fish pdlim5b The genomic dna sequence of gene analyzes its function on website SMART (http://smart.embl-heidelberg.de/) Structural domain, according to CRISPR/Cas knock out principle, in website The ZiFiT Targeter (http: // Zifit.partners.org/ZiFiT/ the target site of pdlim5b gene is designed on).The selection of target spot must comply with this mark It is quasi-: 5 '-GG- (N) 18-NGG-3 '.Wherein the GG dinucleotides at 5 ' ends is a part of T7 promoter, can when designing target site With not limited, but it must be ensured that 3 ' ends of target site are NGG.The selection position of target spot must be in the structural domain of gene It is interior, to ensure that insertion or the missing of target site base can influence the total domain of pdlim5b gene, thus to change base The expression of cause
Specific target sites PCR primer is as follows:
F1(target site a forward primer):
tgtaatacgactcactata ggagatcagtgttggtgatg gttttagagctagaaatagc
R(shared reverse primer): aagcaccgactcggtgccact
F2(target site b forward primer)
tgtaatacgactcactata ggaagatcaaagcctgcagc gttttagagctagaaatagc
R(shared reverse primer): aagcaccgactcggtgccact
PCR detection primer upstream and downstream primer is located on No. 2 intrones and No. 3 intrones:
F (5’-agactccacccactcaactg-3’)
R (5 '-cactaaacacagcgcagaca-3 ')
3) it constructs gRNA expression vector and gRNA is synthesized in vitro
GRNA skeleton is cloned on p42250 carrier by a first, and 1-2 μ L plasmid is taken to carry out agarose gel electrophoresis detection
B, specific gRNA are synthesized in vitro
This plasmid is linearized with BsaI restriction enzyme.In general, endonuclease reaction total volume is 20 μ L, and system is as follows:
6 μ L of p42250 carrier
10× Buffer 2μL
1 μ L of BsaI restriction enzyme
ddH2O 11μL
20 μ L of total volume
In 37 DEG C of water-baths, digestion 2h or more after mixing
C carries out PCR by following specific primer, amplifies for specificity using the p42250 carrier of linearisation as template The double-stranded DNA of gRNA synthesis
Positive specific target sites primers F 1 or the upstream F2:T7 promoter+20pb target sequence+20bp sgRNA skeleton；
The downstream reverse primer R:20bp sgRNA skeleton
PCR reaction system (50 μ L) is as follows:
0.5 μ L of template (p42250 carrier)
Primer F1(or F2,10 uM) 2 μ L
Primer R(10 uM) 2 μ L
2 × Buffer(Mg2+ containing 20mM) 25 μ L
DNTP mix(10 mM) 1 μ L
1 μ L of Ex-Taq archaeal dna polymerase
ddH2O 18.5 μL
50 μ L of total volume
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 5 min of initial denaturation, (95 DEG C of 15 s of denaturation, anneal 60 DEG C of 15 s, extends 72 DEG C of 20 s) 30 circulation, then 72 DEG C of 8 min.To the end of reacting Afterwards, it is centrifuged PCR product, takes 1 μ L sample point sample in carrying out electrophoresis, gel imaging system shooting result on 1.3% Ago-Gel
D detects after determining that band is correct, carries out Ago-Gel DNA recycling, purification and recovery PCR product
E measures the DNA concentration (reaching 1 μ g as far as possible) of purifying, then using this DNA as template, is turned in vitro with 20 μ L systems Record synthesizes specificity gRNA.Tip head used in transcription experiment, EP pipe is the processed RNase-Free product of DEPC, specifically It operates as follows:
It is transcribed in vitro reaction system (20 μ L):
12 μ L of template DNA
10×Buffer 2μL
RNTP mix(10 mM) 4 μ L
2 μ L of T7 RNA polymerase
Nuclease-Free Water 0 μL
20 μ L of total volume
Reactant is all added in the EP pipe of 0.2 mL RNase-Free, after mixing, in 37 DEG C of 2 .5h of water-bath；
After the water bath is over, 1 μ L DNA enzymatic is added into transcription system, is placed in 37 DEG C of water-baths and reacts 30 min, to disappear Change DNA profiling, then takes 1 μ L sample, carry out electrophoresis with prepared 1.3% Ago-Gel, to detect transcription result, if Transcription product size is consistent with expected, then illustrates to transcribe successfully；
F, the purifying of specific gRNA
Successful gRNA is transcribed with RNeasy Mini kit kits, is stored in -20 DEG C.The gRNA drawn after purification is molten 1 μ L of liquid carries out agarose gel electrophoresis, to examine purified product, and measures the gRNA concentration after purifying
3) microinjection of zebrafish embryo
Within 30 min of after fertilization, embryo transfer is drawn to the microinjection special culture dish for using agarose production with suction pipe In
Before carrying out microinjection, Cas9 albumen and gRNA are made into mixed liquor, mixed well, keeps the end of Cas9 albumen dense Degree is the final concentration of 20 ng/ μ L of 5 μ g/ μ L, gRNA.About 3 μ LCas9 albumen and gRNA mixed liquor are injected in one cell stage Fertilized eggs in.The fertilized eggs injected are placed in E3 water (5 mmol/L NaCl, 0.33mmol/L CaCl2,0.33mmol/ L MgSO4,0.17 mmol/L KCl) in, 28 DEG C of hatchings.Embryonic phenotypes are observed under Stereo microscope, screen normal development Embryo be used for target position point mutation analysis
Microinjection system is as follows:
5 μ g/ μ L of Cas9 albumen
gRNA 20 ng/μL
Nuclease free H2O
Total 3μL
4) validity of Sanger sequencing detection target site
After carrying out microinjection to zebrafish embryo, the normal body early embryo of individual developmental is selected, its pdlim5b gene is detected With the presence or absence of mutation, can confirm whether the target site of this time selection is effective in advance, whether microinjection operation standardizes
A, zebra fish genome is extracted
After zebrafish embryo is fertilized 48 hours (48hpf), embryo is in 1.5mL after collecting wild type (control) respectively and injecting In Ep pipe (10 embryos of every pipe), genomic DNA is extracted by the following method, the specific steps are as follows:
200 μ L cell pyrolysis liquids are added into the Ep pipe equipped with embryo, 2 μ L Proteinase Ks are placed in 55 DEG C of insulating boxs and split Solution is overnight
It after the completion of cracking, puts and fullys shake on the oscillator, isometric (200 μ L) isopropanol (pre-cooling) is added and is managed in Ep In, it is sufficiently mixed by inversion, under the conditions of 4 DEG C, 12000rpm is centrifuged 10 min, outwells supernatant；
70 % ethyl alcohol, 500 μ L is added, under the conditions of 4 DEG C, 12000rpm is centrifuged 5 min, abandons supernatant, is air-dried at room temperature 20min；
20 μ L deionized waters are added, sufficiently piping and druming mixes, agarose gel electrophoresis Detection and Extraction efficiency
B, PCR amplification aim sequence
After extracting genomic DNA, according to the genome area of CRISPR target site upstream and downstream about 150-200bp, utilize 3.0 software Design primers sequence of Primer Premier is to amplify target DNA fragment
PCR reaction system (20 μ L) is as follows:
2×Es Taq MasterMix 10 μL
Primer F (10 μM) 1 μL
Primer R (10 μM) 1 μL
1 μ L of template (genomic DNA)
ddH2O 7 μL
20 μ L of total volume
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument.Reaction condition are as follows: 95 DEG C of 5 min of initial denaturation, (95 DEG C of 30 s of denaturation, anneal 60 DEG C of 30 s, extends 72 DEG C of 30 s) 30 circulation, then 72 DEG C of 8 min.To the end of reacting Afterwards, it is centrifuged PCR product, takes 2 μ L sample point samples in carrying out electrophoresis on 1.3 % Ago-Gels, whether detection PCR product size Correctly
If c, PCR product is correct, PCR product is separated with 1.3 % agarose gel electrophoresis, PCR product is sent to carry out Sanger survey Sequence is tentatively obtained the information of insertion or missing by the peak figure being sequenced
4) it after injecting two months, carries out cutting tail identification, ibid authentication step
5) the TA clone of aim sequence
PCR Preliminary Identification has the possible aim sequence of mutation to carry out Sanger sequencing again.If sequencing peak figure has bimodal, and it is sequenced There is the aim sequence of insertion or deficient phenomena as the result is shown, makees further detection followed by picking monoclonal after TA clone
6) the Sanger sequencing of plasmid
The plasmid that double digestion testing result display stripe size meets expected results is sent to sequencing, according to what is provided after sequencing Peak figure and sequence compare on NCBI with standard aim sequence, according to comparison result, analyze the mutation of each monoclonal Type
7) F1 generation of heritable zebra fish mutant is obtained
By front it is a series of screening zebra fish mutant F0 generation has been determined, and then by F0 for mutant respectively with wild type spot Horse fish hybridizes to obtain F1 generation embryo, is placed in 28 DEG C of cultures, observes the survival rate of F1 generation in the early stage.It is fertilized two days later, each mutation Body F1 generation takes 10 embryos to carry out mutation heredity identification respectively.Every pipe embryo is extracted into genome, then PCR amplification goes out Whether the target site near zone of 355bp, observation PCR amplification will appear small band, and PCR will appear the small band of 300bp or so, If this mutation can be genetic to F1 generation, PCR amplification will appear the small band less than 355bp
If detecting the presence of mutation from F1 generation embryo, the F1 generation of zebra fish mutant was brought up to 2-3 months.Distinguish again Every F1 generation zebra fish adult fish is carried out to cut tail, is screened F1 generation mutant (specific method is as previously described)
Fig. 1 is the schematic diagram of CRISPR/Cas9 targeting system；Fig. 2 is the structure chart in target practice site on pdlim5b gene；Fig. 3 is WT type and deletion form F1 generation adult fish PCR electrophoretogram, sequencing result and wild-type sequence (355bp) are compared, discovery There is base deletion in the target practice site of pdlim5b；Fig. 4 is that deletion form and WT type gene order forward direction alignment scheme；Fig. 5 is target position Point missing comparison nearby.Since the pdlim5b Gene Partial base deletion of the F1 generation of the mutant screened causes whole gene Frameshift mutation, change the expression of zebra fish pdlim5b gene.To influence the development of the heart of zebra fish
The above is only presently preferred embodiments of the present invention, not does limitation in any form to the present invention, all according to this Any simple modification to the above embodiments, equivalent variations, each fall within protection model of the invention in the technical spirit of invention Within enclosing.
Sequence table
<110>Hunan Normal University
<120>a kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish
<141> 2018-11-23
<160> 11
<170> SIPOSequenceListing 1.0
<210> 3
<211> 20
<212> DNA
<213>zebra fish (Danio rerio)
<400> 3
ggagatcagt gttggtgatg 20
<210> 4
<211> 20
<212> DNA
<213>zebra fish (Danio rerio)
<400> 4
ggaagatcaa agcctgcagc 20
<210> 5
<211> 21
<212> DNA
<213>zebra fish (Danio rerio)
<400> 5
aagcaccgac tcggtgccac t 21
<210> 6
<211> 20
<212> DNA
<213>zebra fish (Danio rerio)
<400> 6
agactccacc cactcaactg 20
<210> 7
<211> 20
<212> DNA
<213>zebra fish (Danio rerio)
<400> 7
cactaaacac agcgcagaca 20
<210> 4
<211> 355
<212> DNA
<213>zebra fish (Danio rerio)
<400> 4
agactccacc cactcaactg tatggtgcta acctatcata gtgccctcaa gctccaccca 60
atcacagttt tccacattta taatgctgtg tgtgtttttg tgtgttgtgt agttgacaga 120
tggaggaaag gcggctaaag ccaagatcag tgttggtgat gtggttctgt ccatcgacgg 180
catccacact gagagaatga cacacctgga ggcccagaac aagatcaaag cctgcagcgg 240
gaacctcaac ctctcactca tgaggtgaca cacacacaca ctgtactctt actgtacaca 300
cacatactgt attaataaat gtaatgtatc acacttgtct gcgctgtgtt tagtg 355
<210> 5
<211> 268
<212> DNA
<213>zebra fish (Danio rerio)
<400> 5
atcatagtga ctcacgctcc acccaatcac ggttttccac atttataatg ctgtgtgtgt 60
gtttgtgtgt tgtgtagttg acagatggag gaaaggcggc taaagccaag atcagtgttg 120
gtgtggttct gtccatcgac ggcatccaca ctgagggaac ctcaacctct cactcatgag 180
gtgacacaca cacactgtac tcttactgta cacacatact gtattaataa atgtaatgta 240
tcacacttgt ctgcgctgtg tttagtga 268
<210> 9
<211> 64
<212> DNA
<213>zebra fish (Danio rerio)
<400> 9
tgacagatgg aggaaaggcg gctaaagcca agatcagtgt tggtgatgtg gttctgtcca 60
tcga 64
<210> 9
<211> 61
<212> DNA
<213>zebra fish (Danio rerio)
<400> 9
tgacagatgg aggaaaggcg gctaaagcca agatcagtgt tggtgtggtt ctgtccatcg 60
a 61
<210> 10
<211> 65
<212> DNA
<213>zebra fish (Danio rerio)
<400> 10
catccacact gagagaatga cacacctgga ggcccagaac aagatcaaag cctgcagcgg 60
gaacc 65
<210> 11
<211> 19
<212> DNA
<213>zebra fish (Danio rerio)
<400> 11
catccacact gagggaacc 19

Claims (6)

1. a kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish, which comprises the following steps:
1) CRISPR/Cas9 gene knockout target site and detection primer are separately designed
In National Center for Biotechnology Information(NCBI) on inquire zebra fish pdlim5b The genomic dna sequence of gene, in website SMART(http: //smart.embl-heidelberg.de/) on analyze its function Structural domain, according to CRISPR/Cas9 knock out principle, in website The ZiFiT Targeter (http: // Zifit.partners.org/ZiFiT/ the target site of pdlim5b gene is designed on)；
Two pairs of specific target sites PCR primers are as follows:
F1(target site a forward primer):
tgtaatacgactcactata ggagatcagtgttggtgatg gttttagagctagaaatagc
R(shared reverse primer): aagcaccgactcggtgccact
F2(target site b forward primer)
tgtaatacgactcactata ggaagatcaaagcctgcagc gttttagagctagaaatagc
R(shared reverse primer): aagcaccgactcggtgccact
PCR detection primer upstream and downstream primer is located on No. 2 intrones and No. 3 intrones:
F (5’-agactccacccactcaactg-3’)
R (5 '-cactaaacacagcgcagaca-3 ')
2) it constructs gRNA expression vector and specificity gRNA is synthesized in vitro
GRNA skeleton is cloned on p42250 carrier by a first；
B, specific gRNA are synthesized in vitro
This plasmid is linearized with BsaI restriction enzyme；Endonuclease reaction total volume is 20 μ L, and system is as follows:
6 μ L of p42250 carrier
10× Buffer 2μL
1 μ L of BsaI restriction enzyme
ddH2O 11μL
20 μ L of total volume
In 37 DEG C of water-baths, digestion 2h or more after mixing；
C carries out PCR by following specific primer, amplifies for specificity using the p42250 carrier of linearisation as template The double-stranded DNA of gRNA synthesis；
Positive specific target sites primers F 1 or the upstream F2:T7 promoter+20pb target sequence+20bp sgRNA skeleton, reversely draw The downstream object R:20bp sgRNA skeleton,
PCR reaction system is as follows:
0.5 μ L of template (p42250 carrier)
Primer F1(10 uM) 2 μ L
Primer R(10 uM) 2 μ L
2 × Buffer(Mg2+ containing 20mM) 25 μ L
DNTP mix(10 mM) 1 μ L
1 μ L of Ex-Taq archaeal dna polymerase
ddH2O 18.5 μL
50 μ L of total volume
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument；
D detects after determining that band is correct, carries out Ago-Gel DNA recycling, purification and recovery PCR product；
E measures the DNA concentration of purifying, then using this DNA as template, is transcribed in vitro with 20 μ L systems, synthesis specificity gRNA；Concrete operations are as follows:
Reaction system is transcribed in vitro:
12 μ L of template DNA
10×Buffer 2μL
RNTP mix(10 mM) 4 μ L
2 μ L of T7 RNA polymerase
Nuclease-Free Water 0 μL
20 μ L of total volume
Reactant is all added in 1.5 mL EP pipes, after mixing, in 37 DEG C of 2.5 h of water-bath；
After the water bath is over, DNA profiling is digested, then electrophoresis；
F, the purifying of specific gRNA
Successful gRNA is transcribed with RNeasy Mini kit kits, is stored in -20 DEG C；Carry out Ago-Gel electricity Swimming to examine purified product, and measures the gRNA concentration after purifying；
3) microinjection of zebrafish embryo
Within 30 min of after fertilization, embryo transfer is drawn to the microinjection special culture dish for using agarose production with suction pipe In,
Before carrying out microinjection, Cas9 albumen and gRNA are made into mixed liquor, mixed well, keeps the end of Cas9 albumen dense Degree is the final concentration of 20 ng/ μ L of 5 μ g/ μ L, gRNA, injects 3 μ L Cas9 albumen and gRNA mixed liquor in one cell stage In fertilized eggs；The fertilized eggs injected are placed in E3 water, 28 DEG C of hatchings；Embryonic phenotypes are observed under Stereo microscope, are screened The embryo of normal development is used for target position point mutation analysis；
Microinjection system is as follows:
5 μ g/ μ L of Cas9 albumen
gRNA 20 ng/μL
Nuclease free H2O
Total 3μL；
4) validity of Sanger sequencing detection target site
After carrying out microinjection to zebrafish embryo, the normal body early embryo of individual developmental is selected, its pdlim5b gene is detected With the presence or absence of mutation；
A extracts zebra fish genome
After zebrafish embryo is fertilized 48 hours (48 hpf), wild type and embryo after injection are collected respectively in 1.5mL Ep pipe, 10 embryos of every pipe, extract genomic DNA by the following method, the specific steps are as follows:
200 μ L cell pyrolysis liquids are added into the Ep pipe equipped with embryo, 2 μ L Proteinase Ks are placed in 55 DEG C of insulating boxs and split Solution is overnight；
It after the completion of cracking, puts and fullys shake on the oscillator, the isopropanol pre-cooled in equal volume is added in Ep pipe, sufficiently runs It mixes, under the conditions of 4 DEG C, 12000rpm is centrifuged 10 min, outwells supernatant；
70 % ethyl alcohol, 500 μ L is added, under the conditions of 4 DEG C, 12000rpm is centrifuged 5 min, abandons supernatant, is air-dried at room temperature 20min；
20 μ L deionized waters are added, sufficiently piping and druming mixes, agarose gel electrophoresis Detection and Extraction efficiency；
B, PCR amplification aim sequence
After extracting genomic DNA, according to the genome area of CRISPR target site upstream and downstream about 355bp, Primer 3.0 is utilized Software Design primers sequence is to amplify target DNA fragment；
PCR reaction system is as follows:
2×Es Taq MasterMix 10 μL
Primer F (10 μM) 1 μL
Primer R (10 μM) 1 μL
1 μ L of template (genomic DNA)
ddH2O 7 μL
20 μ L of total volume
After concussion mixes, 4 DEG C of centrifugations, in being carried out amplification reaction in PCR instrument；
C separates PCR product with 1.3 % agarose gel electrophoresis, purpose band is cut under ultraviolet, carries out purification and recovery；
D send the target DNA fragment after partial purification to carry out Sanger sequencing, by the peak figure being sequenced come it is preliminary be inserted into or The information of missing；
E after injection two months, carries out cutting tail identification, ibid authentication step；
5) the TA clone of aim sequence
PCR identification have purpose band after carries out Sanger sequencing again, if sequencing peak figure have it is bimodal, and sequencing result show it is slotting Enter or the aim sequence of deficient phenomena, makees further detection followed by picking monoclonal after TA clone；
6) the Sanger sequencing of plasmid
The plasmid that double digestion testing result display stripe size meets expected results is sent to sequencing, the peak provided after being sequenced Figure and sequence, compare with standard aim sequence on NCBI, according to comparison result, analyze the mutation class of each monoclonal Type；
7) F1 generation of heritable zebra fish mutant is obtained
By front it is a series of screening zebra fish mutant F0 generation has been determined, and then by F0 for mutant respectively with wild type spot Horse fish hybridizes to obtain F1 generation embryo, is placed in 28 DEG C of cultures, observes the survival rate of F1 generation in the early stage；It is fertilized two days later, each mutation Body F1 generation takes 10 embryos to carry out mutation heredity identification respectively；Every pipe embryo is extracted into genome, then PCR amplification goes out Whether the target site near zone of 355bp, observation PCR amplification will appear small band, and PCR will appear the small band of 300bp or so, If this mutation can be genetic to F1 generation, PCR amplification will appear the small band less than 355bp.
2. if the F1 generation of zebra fish mutant brought up to 2-3 months detect the presence of mutation from F1 generation embryo；Divide again It is other that every F1 generation zebra fish adult fish is carried out to cut tail, screen F1 generation mutant；
The method of gene knockout breeding pdlim5b Gene Deletion zebra fish according to claim 1, which is characterized in that The selection of target site follows following standard: 5 '-GG- (N) 18-NGG-3 ' in step 1)；Wherein the GG dinucleotides at 5 ' ends is A part of T7 promoter guarantees that 3 ' ends of target site are NGG；The selection position of target spot is in the structural domain of gene.
3. the method for gene knockout breeding pdlim5b Gene Deletion zebra fish according to claim 1, feature exist In Tip head used in the experiment of transcription described in step 2, EP pipe is the processed RNase-Free product of DEPC.
4. the method for gene knockout breeding pdlim5b Gene Deletion zebra fish according to claim 1, feature exist In, in being carried out amplification reaction in PCR instrument described in the step c of step 2, reaction condition are as follows: 95 DEG C of 5 min of initial denaturation, Repeat 30 circulation following steps: 95 DEG C of 30 s---- annealing of denaturation, 60 DEG C of 30 s--- extends 72 DEG C of 30s, then 72 DEG C 8min；To after reaction, be centrifuged PCR product, electrophoresis is carried out.
5. the method for gene knockout breeding pdlim5b Gene Deletion zebra fish according to claim 1, feature exist In E3 water described in step 3) is 5 mmol/L NaCl, 0.33mmol/L CaCl2, 0.33mmol/L MgSO4, 0.17 The mixture of mmol/L KCl.
6. the method for gene knockout breeding pdlim5b Gene Deletion zebra fish according to claim 1, feature exist In, in being carried out amplification reaction in PCR instrument described in the b step of step 4), reaction condition are as follows: 95 DEG C of 5 min of initial denaturation, then Repeat 30 circulation following steps: 95 DEG C of 30 s--- annealing of denaturation, 60 DEG C of 30 s--- extends 72 DEG C of 30 s, then 72 DEG C 8 min；To after reaction, be centrifuged PCR product, electrophoresis is carried out.
CN201811444490.9A 2018-11-29 2018-11-29 A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish Pending CN109468324A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811444490.9A CN109468324A (en) 2018-11-29 2018-11-29 A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811444490.9A CN109468324A (en) 2018-11-29 2018-11-29 A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish

Publications (1)

Publication Number Publication Date
CN109468324A true CN109468324A (en) 2019-03-15

Family

ID=65673556

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811444490.9A Pending CN109468324A (en) 2018-11-29 2018-11-29 A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish

Country Status (1)

Country Link
CN (1) CN109468324A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110066805A (en) * 2019-04-26 2019-07-30 湖南师范大学 The method of gene knockout breeding adgrf3b Gene Deletion zebra fish
CN111487399A (en) * 2020-03-26 2020-08-04 湖南师范大学 Application of protein molecular marker in research on fish germ cell development

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988268A (en) * 2017-12-18 2018-05-04 湖南师范大学 A kind of method of gene knockout selection and breeding tcf25 Gene Deletion zebra fish
CN108048486A (en) * 2017-12-18 2018-05-18 湖南师范大学 A kind of method of gene knockout selection and breeding fhl1b Gene Deletion zebra fish

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988268A (en) * 2017-12-18 2018-05-04 湖南师范大学 A kind of method of gene knockout selection and breeding tcf25 Gene Deletion zebra fish
CN108048486A (en) * 2017-12-18 2018-05-18 湖南师范大学 A kind of method of gene knockout selection and breeding fhl1b Gene Deletion zebra fish

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RICHARD J WHITE等: "A high-resolution mRNA expression time course of embryonic development in zebrafish", TOOLS AND RESOURCES, pages 1 - 32 *
无: "Gene: pdlim5b (ENSDARG00000027600) - Summary - Danio rerio - Ensembl genome browser 94", ENSEMBL, pages 1 *
袁月亲;罗世锋;颜尔聪;尹丽阳;漆轲婧;彭亚欣;万永奇;吴秀山;李永青;: "斑马鱼心脏发育候选基因Titin-Cap的CRISPR/Cas9打靶有效性分析", 激光生物学报, no. 05, pages 77 - 85 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110066805A (en) * 2019-04-26 2019-07-30 湖南师范大学 The method of gene knockout breeding adgrf3b Gene Deletion zebra fish
CN111487399A (en) * 2020-03-26 2020-08-04 湖南师范大学 Application of protein molecular marker in research on fish germ cell development
CN111487399B (en) * 2020-03-26 2021-09-17 湖南师范大学 Application of protein molecular marker in research on fish germ cell development

Similar Documents

Publication Publication Date Title
CN107988268A (en) A kind of method of gene knockout selection and breeding tcf25 Gene Deletion zebra fish
CN105594664B (en) A kind of method of gene knockout selection and breeding stat1a Gene Deletion zebra fish
CN108018316A (en) A kind of method of gene knockout selection and breeding rmnd5b Gene Deletion zebra fish
CN105647969B (en) Method for breeding zebra fish with stat1a gene deletion by gene knockout
CN108048486A (en) A kind of method of gene knockout selection and breeding fhl1b Gene Deletion zebra fish
CN109266687A (en) A kind of method of gene knockout breeding tnni3k Gene Deletion zebra fish
CN106282231B (en) Construction method and application of mucopolysaccharide storage disease type II animal model
CN106191110A (en) A kind of wnt16 Gene Deletion Brachydanio rerio
CN104531705A (en) Method for knocking off animal myostatin gene by using CRISPR-Cas9 system
CN104531704A (en) Method for knocking off animal FGF5 gene by using CRISPR-Cas9 system
CN110684777B (en) Application of isolated nucleotide sequence in construction of zebra fish with reduced intramuscular stings
CN109280666A (en) A kind of method of gene knockout breeding bai2 Gene Deletion zebra fish
CN106191112A (en) A kind of method of gene knockout selection-breeding wnt16 Gene Deletion Brachydanio rerio
CN109652457A (en) A kind of method of gene knockout breeding ALPK2 Gene Deletion zebra fish
CN110894510A (en) Method for breeding Lgr6 gene-deleted zebra fish through gene knockout
CN109468324A (en) A kind of method of gene knockout breeding pdlim5b Gene Deletion zebra fish
CN111154758A (en) Method for knocking out zebra fish slc26a4 gene
CN110066805A (en) The method of gene knockout breeding adgrf3b Gene Deletion zebra fish
CN110894511A (en) Method for breeding ppm1g gene mutant zebra fish by gene editing
CN109136351A (en) A method of sgRNA activity and specificity are detected by amplicon high throughput sequencing technologies
CN109897868A (en) A kind of method of gene knockout breeding mir196a Gene Deletion zebra fish
CN110331168A (en) A kind of method of gene knockout breeding pdlim5a Gene Deletion zebra fish
CN113493786B (en) Method for blocking or weakening expression of OsMIR3979 in rice to improve rice seed shape
CN112779259B (en) sgRNA for precisely editing sheep OCT4 gene, primer for amplification and application
CN113249409A (en) BMI1 gene-deleted zebra fish

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination