CN109880908B - Reagent and kit for diagnosing slow particle acute phase based on hnRNPA1 splice variant - Google Patents

Abstract

The invention discloses application of a No. 8 exon skipping/retaining spliceosome of hnRNPA1 (hnRNPA1-a and hnRNPA1-b) in preparation of a reagent for diagnosing the acute change stage of chronic myeloid leukemia or a kit containing the diagnostic reagent.

Description

Reagent and kit for diagnosing slow particle acute phase based on hnRNPA1 splice variant

Technical Field

The invention relates to application of hnRNPA1 splice variant as a marker in diagnosing patients with chronic myelogenous leukemia in acute phase, and application in preparing corresponding detection reagent and kit box.

Background

Chronic Myelogenous Leukemia (CML) is a malignant proliferative disease that originates from pluripotent hematopoietic stem cells, accounting for about 20% of human leukemias. It was found that about 95% of CML patients have abnormal cytogenetic changes, i.e., reciprocal translocation of chromosome 9 and chromosome 22 to form philadelphia (Ph) and Bcr-Abl fusion genes. The BCR/ABL fusion protein has strong tyrosine kinase activity, abnormally activates a plurality of downstream signal paths, and stimulates the abnormal proliferation and malignant transformation of hematopoietic cells. The disease course of CML is usually divided into three stages, namely a chronic stage, an accelerated stage and an acute stage, the chronic stage is relatively long and the symptoms are controllable, if the disease is not treated reasonably, the disease inevitably progresses to the acute stage through the accelerated stage, and once the disease is changed suddenly, the prognosis is very poor.

Aiming at the diagnosis of the CML sudden change, a plurality of sets of standards are provided at home and abroad. The diagnostic criteria for these criteria are mainly bone marrow/peripheral blood primary cell count, cell clonal evolution, splenomegaly degree and clinical drug responsiveness etc. (fusion gene bcr/abl quantification is not included due to insensitivity to diagnostic urgency). In summary, these indicators are too dependent on the biological phenotype and clinical performance of the CML cells, and have a certain diagnostic value only after the onset of the acute change, but cannot provide early warning in the early stage of the acute change, so that the optimal treatment opportunity is missed again and again in clinic. Therefore, two closely connected important links of early warning and targeted therapy of the CML sudden change are urgent to seek breakthrough.

Alternative splicing refers to the process of alternative combined splicing of pre-mRNA splice sites to form different mature mrnas, resulting in several isoforms of a protein with unique structure and function from one gene. In recent years, the research shows that the alternative splicing is related to the development and differentiation of diseases such as cancer, and a plurality of disease-related genes are regulated by the alternative splicing. The Wnt pathway serves as an important driver of transcriptome and proteome diversity, and mutations and alternative splicing of regulatory genes are important factors leading to leukemia progression and therapeutic resistance.

The heterogeneous nuclear ribonucleoprotein A1 gene (hnRNPA1, hepatogenic nuclear ribonucleoprotein A1) belongs to the hnRNP family and is involved in various processes of nucleic acid metabolism, including RNA transcription, exon splicing, pre-mRNA maturation and degradation, and the like. Two experimentally verified protein subtypes exist in hnRNPA1, the full-length A1-b subtype is 372aa, the molecular weight is 38kDa, the shorter 320aa is 34kDa and is A1-a subtype, and residues 253-303 are deleted. These two subtypes are produced by the selective retention/skipping of exon 8, also referred to as hnRNPA1 exon 7b in some studies. Although some previous studies have reported that alternative splicing plays an important role in the development of CML, there are no reports that alternative splicing, including hnRNPA1, may regulate abnormal splicing of pre-mRNA and participate in the development of the slow granule acute change, and therefore, there is an urgent need in the art for early, accurate and specific detection of the slow granule acute change.

Disclosure of Invention

The invention aims to provide a diagnostic reagent and a diagnostic kit which can accurately early warn the acute change stage (slow granulocytic acute change stage) of chronic granulocytic leukemia, and a method for early warning the slow granulocytic acute change by using the reagent or the kit.

One aspect of the present invention provides use of a hnRNPA1 splice variant for preparing a reagent for diagnosing the acute phase of chronic myelogenous leukemia or a kit containing the same, wherein the hnRNPA1 splice variant is a hnRNPA1-a subtype (nucleotide sequence is shown in SEQ ID NO.1) and/or a hnRNPA1-b subtype (nucleotide sequence is shown in SEQ ID NO. 2).

The hnRNPA1-a subtype is a splice variant resulting from alternative skipping of exon 8 of hnRNPA1, and the hnRNPA1-b subtype is a splice variant resulting from alternative retention of exon 8 of hnRNPA 1.

Another aspect of the invention is: a method of diagnosing whether a subject is in a slow-grain acute phase is provided, the method comprising at least two steps: (a) determining the amount of expression/binding of hnRNPA1-a subtype and/or hnRNPA1-b subtype in a peripheral blood sample from a subject suspected of being in the acute phase of chronic myelogenous leukemia; and

(b) assessing whether the subject is in the acute stage of chronic myelogenous leukemia based on the expression/binding of hnRNPA1-a subtype and/or hnRNPA1-b subtype.

As a preferred embodiment of the present invention, the evaluating comprises:

(1) comparing the determined expression/binding of hnRNPA1-a subtype to a predetermined threshold, the determined expression/binding of hnRNPA1-a subtype being below the threshold; or

(4) Comparing the determined expression/binding of hnRNPA1-b isoform with a predetermined threshold value, the determined expression/binding of hnRNPA1-b isoform being above the threshold value; or

(5) Comparing the determined ratio of hnRNPA1-a subtype to hnRNPA1-b subtype expression/binding to a predetermined threshold, the determined ratio of hnRNPA1-a subtype to hnRNPA1-b subtype being below the threshold;

indicating that the subject is in chronic myelogenous leukemia acute phase.

As a preferred embodiment of the present invention, the reagent comprises a nucleic acid amplification primer for detecting hnRNPA1-a subtype and/or a nucleic acid amplification primer for detecting hnRNPA1-b subtype.

As a preferred embodiment of the present invention, the nucleic acid amplification primer for detecting hnRNPA1-a subtype has a primer sequence 5'-3' upstream of the primer sequence: GGTAATGATGGAAGCAATTT, downstream 5 '-3': CCTCCCTTCATGGGTCCAAA, wherein the primer for nucleic acid amplification for detecting hnRNPA1-b subtype has 5'-3' upstream: GAGGCTATGGAAGTGGTGGA, downstream 5 '-3'; CCTCCCTTCATGGGTCCAAA are provided.

As a preferred embodiment of the present invention, the reagent comprises a nucleic acid probe for detecting hnRNPA1-a subtype and/or a nucleic acid probe for detecting hnRNPA1-b subtype.

As a preferred embodiment of the present invention, the nucleic acid probe for detecting subtypes hnRNPA1-a and hnRNPA1-b is 5 '-3': TTTGGAGGTGGTGGAAGCTACAAT are provided.

As a preferred embodiment of the present invention, the agent comprises an antibody against an anti-hnRNPA 1-a isoform protein and/or an antibody against an anti-hnRNPA 1-b isoform protein.

The invention has the following beneficial effects:

the invention uses the hnRNPA1 splice variant hnRNPA1-a subtype and/or hnRNPA1-b subtype for diagnosing the acute change stage of chronic myeloid leukemia, has higher sensitivity and specificity, can observe the disease progress early by a simpler and more accurate method, adopts treatment measures in time, and has higher clinical application value.

Drawings

FIG. 1 is a schematic diagram showing the process of verifying alternative splicing of hnRNPA1 that warns of a slow granule acute mutation in the present invention;

FIG. 2 is a schematic representation of the differential expression of the high throughput sequenced hnRNPA1 splice variants of the present invention;

FIG. 3 is a graph of qPCR validation of the expression of hnRNPA1 splice variants in various groups according to the invention;

FIG. 4 is a graph of immunoblot demonstrating expression of the hnRNPA1 splice variant subtypes in various groups according to the present invention;

FIG. 5 shows the sequencing validation of hnRNPA1 splice variants of the invention.

Detailed Description

The present invention will be described in further detail with reference to specific examples. It should be understood that the scope of the above-described subject matter is not limited to the following examples, and any techniques implemented based on the disclosure of the present invention are within the scope of the present invention. The technical means and procedures used in the following examples are conventional means and procedures well known to those skilled in the art, and the raw materials used are commercially available, unless otherwise specified.

The inventor adopts high-throughput technology to compare the difference of the total RNA alternative splicing expression profiles of peripheral blood mononuclear cells of a slow-granulocyte acute-mutation patient, a slow-granulocyte chronic-phase patient and a normal control group, and finds that the hnRNPA1-a splicing subtype has lower specific expression in the slow-granulocyte acute-mutation group.

Experimental procedures for the specific conditions not specified in the examples below are generally performed according to conventional conditions such as those described in Sambrook et al, A handbook of molecular cloning laboratories (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1

First, CML patient and health control group specimen collection

According to the NCCN diagnosis standard of CML in 2016, the peripheral blood samples of patients with slow-onset and acute-onset diseases and health examination groups, which are not treated in the primary diagnosis, are collected.

Second, peripheral blood mononuclear cell extraction

The Ficoll density gradient centrifugation method comprises ① placing 5ml whole blood into 50ml centrifuge tube, diluting with 5ml PBS solution, mixing gently, ② taking two 15ml centrifuge tubes, adding 5ml Ficoll solution, adding diluted blood into Ficoll upper layer (avoiding mixing two solutions) gently with pipette (5ml each), ③ centrifuging at 2000rpm for 20min, ④ sucking white cell layer (PBMC) with pipette and placing into clean 15ml centrifuge tube, ⑤ adding PBS to 10-15ml, 1500rpm, centrifuging for 10min, removing supernatant, adding Trizol, mixing well, and preserving at-80 deg.C.

Third, total RNA extraction

TRIzol method comprises adding 1ml of TRIzol/5 × 106 PBMC into ①, repeatedly blowing and beating in a ribozyme-free EP tube, standing at room temperature for 5min, adding 0.2ml of chloroform/1 ml of TRIzol into ②, violently shaking for 15s, standing at room temperature for 2-3min, ③ deg.C at 12000rpm, centrifuging for 15min, wherein the upper colorless aqueous phase layer (about 50%) is an RNA layer (three layers can be seen and lightly placed, and three layers are prevented from being mixed), ④ gently sucks the upper aqueous phase into a new EP tube (the middle layer is prevented from being sucked), adding 0.5ml of isopropanol/1 ml of TRIzol, reversing and mixing, standing at room temperature for 10min, ⑤ deg.C at 12000rpm, centrifuging for 10min, removing supernatant, wherein colloidal precipitate can be found on the side wall and bottom of the EP tube, blowing and beating 1ml of 75% ethanol solution (prepared by absolute ethanol and water-free of ribozyme) into ⑥ RNA precipitate, washing, centrifuging at 4 deg.C at 7500rpm, keeping for 5min, and drying at room temperature, and drying RNA at room temperature of 5-5910 deg.C.

Four, RT-PCR analysis

1. The RNA-seq data were verified, and multiple DEGs and RASG were selected among groups for expression level comparison by a real-time quantitative fluorescence PCR (qRT-PCR) method. Total RNA from each group was removed with RQ1 DNase enzyme to remove DNA. And (4) determining the purity and concentration of the total RNA for later use.

2. Synthesis of template DNA, cDNA: the prepared total RNA is subjected to reverse transcription according to the instruction of a Takara reverse transcription reaction kit, and a reaction system is prepared as follows:

of these, 100ng of total RNA was converted into the volume required to be added according to the RNA concentration. The preparation system needs to be operated on ice, so that accurate sample adding is realized, and operation errors are avoided. The prepared system needs to be stippled, mixed evenly and centrifuged, then placed on a PCR amplification instrument for reverse transcription, the reaction conditions are 15min at 37 ℃, 5s at 85 ℃ and 30min at 4 ℃, the amplification product (namely the template cDNA) is taken out in time after the reverse transcription is finished, and the amplification product is stored at 20 ℃ for later use.

3. PCR amplification of the target gene: adding template cDNA, amplimer of 8 exon skipping alternative splicing specific gene of hnRNPA1 and other necessary reagents to prepare reaction system for amplification on PCR amplifier. The amplification primer sequences and annealing temperatures for each alternative splicing subtype were as follows (wherein GAPDH is used as an internal reference for this experiment):

the qRT-PCR detection by SYBR Green method comprises the steps of synthesizing ① differential genes and internal reference GAPDH primers by Beijing Quanji, dissolving the primers into 10nmol/ml by non-ribozyme water for standby, preparing ② qRT-PCR reaction system by a Takara fluorescent quantitative kit according to the following table:

③ the reaction conditions are 95 ℃ for 20s, then the cycle is carried out for 40 times according to the sequence of 95 ℃ for 10s, the annealing temperature (above), 20s and 70 ℃ for 30s, the analysis result of ④ is that the amplification effect is judged by combining the amplification curve and the melting curve, the relative expression quantity of the target gene is calculated by the delta Ct method, and the calculation formula is as follows:

ΔΔC_t＝(Ct_gene–Ct_GAPDH)_CML-BC/CP–(Ct_Gene–Ct_GAPDH)_Ctrl

Fifth, analysis of immunoblot (Western blot)

① collecting PBMC of each experimental group, adding 0.5ml of lysate/5 multiplied by 106 cells, oscillating for resuspension, standing for 2min at 4 ℃, ② adding 1ml of protein extraction reagent/0.5 ml of lysate, oscillating for even mixing, standing for 10min at 4 ℃, ③ 4 ℃, 10000g, centrifuging for 10min to obtain two phases, wherein a protein membrane is arranged between the two phases, absorbing a surface phase and a bottom phase by a pipette, keeping an intermediate protein floccule (if the phases cannot be separated after centrifuging, adding 50 mu l of triple distilled water, finally mixing and centrifuging uniformly), washing ④ protein precipitate with 1ml of absolute ethyl alcohol, washing at 4 ℃, 10000g, centrifuging for 3min to precipitate the protein, ⑤ removing the liquid in an EP tube, opening the EP tube, drying the protein precipitate at room temperature, adding a proper amount of 3% SDS protein dissolving liquid into ⑥, heating the protein precipitate for 5-10min to complete dissolution in 95 ℃ hot water, standing for 20-30 min at room temperature, centrifuging for removing insoluble substances, and keeping in a refrigerator at 20 ℃ for later use.

2 SDS-PAGE electrophoresis, ① cleaning and washing a clean glass plate, naturally drying, ② glue preparation, namely assembling a glue preparation device, preparing 10% of separation glue (5ml) according to the molecular weight of a target protein, slowly pouring the glue to avoid bubbles until the bubbles are generated, sealing 1ml of absolute ethyl alcohol at the position of about 1cm of the lower edge of a comb, standing at room temperature for about 30min until the separation glue is solidified, removing the absolute ethyl alcohol and sucking the absolute ethyl alcohol by using filter paper, pouring 5% of concentrated glue on the separation glue, slightly inserting the comb into the separation glue and removing the bubbles, standing at room temperature for about 30min, and waiting for solidification at 4 ℃ for later use (the glue preparation formula is as follows):

③ putting the glass plate with the glue in it into electrophoresis tank, adding the 1 XTris-glycine buffer solution, taking out comb and washing sample hole, ④ adding 5 Xprotein buffer solution with 1:4 ratio to prepare the sample protein, the final content of each sample is consistent, mixing, after 5-10min boiling water bath, 4 deg.C 12000rpm, centrifuging for 2min to remove insoluble substance, loading, while pre-staining mark5 μ l, ⑤ electrophoresis, 80V constant voltage about 30min, after the protein enters the separation gel from the concentrated gel, adjusting 120V constant voltage about 2h electrophoresis, turning off power supply, stopping electrophoresis, putting the gel into buffer solution, stripping gel, balancing for about 20min, ⑥ rotating membrane, soaking PVDF film in methanol for 1min, balancing for about 20min, cutting gel according to the molecular weight of protein, putting the gel into buffer solution, clamping the gel pad, PVDF film, and filter paper, and placing the filter paper into three layers of sponge membrane, and filtering paper, and placing the sponge membrane into the electrophoresis tank, wherein the three layers are fixed by constant current flow and the three layers of filter paper.

3.① sealing, namely after membrane transfer, enabling the membrane transfer face containing protein to face upwards, marking the corner cut at the upper right corner and soaking in a sealing solution, slowly shaking at room temperature for about 1h (on a horizontal shaking bed), ② washing the membrane, namely washing the sealed PVDF membrane for three times by using 1 XTST buffer solution, placing the PVDF membrane on a horizontal shaking bed at room temperature for 5min each time, ③ incubating primary antibody, namely completely soaking and incubating the PVDF membrane after diluting the primary antibody by using a primary antibody diluting solution, and placing the PVDF membrane in a refrigerator at 4 ℃ for overnight at a dilution ratio of Tubulin (1:1000, AC015) and hnRNPA1(1:500,11176-1-AP).

④ washing the membrane, rinsing the PVDF membrane with 1 × TBST buffer solution three times the day, placing on a shaking table for 10min each time, incubating ⑤ with secondary antibody, completely soaking the PVDF membrane with the secondary antibody diluted by the blocking solution, shaking slowly for 2h at room temperature (shaking table), washing the membrane with ⑥, rinsing the membrane with 1 × TBST buffer solution three times after taking the membrane, placing on the shaking table at room temperature for 10min each time.

4. And (3) exposure, namely ①, mixing and shaking up the ECL chemiluminescence solution A and the ECL chemiluminescence solution B in equal volume, fully contacting and covering the luminescence solution on a PVDF membrane (repeatedly beating for about 3-5 min), then placing the PVDF membrane in a gel phase instrument (Shanghai, volleyball) to take a picture and store the picture, and repeating the experiment for three times.

Sixthly, sequencing of the amplification product of hnRNPA1 and comparative analysis of the Western blot result.

1. Grouping design

A slow granule acute change group (15 cases), a slow granule chronic period group (16 cases) and a normal control group (10 cases); to reduce the test error, 3 replicates of each sample were run.

2. Main instrument and test consumable

3. Results of the experiment

(1) Analysis of hnRNPA1 alternative splicing high-throughput sequencing results

In a preliminary study we performed high throughput sequencing of total mRNA from peripheral blood mononuclear cells in both the chronic (5 cases), acute (5 cases) and normal (5 cases) populations, and based on the alternative splicing pattern of hnRNPA1 (FIG. 2.A), exon skipping splicing patterns occurred in exon 8, resulting in exon 8 skipping and retention of two splicing subtypes in hnRNPA 1. Analysis of splice junctions revealed that the hnRNPA1-a/B subtype ratio in samples from patients with a slow-granulocytic acute phase was significantly lower than in samples from patients with a slow-granulocytic chronic phase and normal humans (FIG. 2.B), suggesting that the hnRNPA1-a subtype may be expressed specifically for a slow-granulocytic acute phase.

(2) qPCR result analysis

The expression of two splicing subtypes, hnRNPA1-a and hnRNPA1-B, in peripheral blood mononuclear cells of the slow-granule acute-change stage (15 cases), the slow-granule chronic stage (16 cases) and normal persons (10 cases) were analyzed by qPCR, and the results showed that the hnRNPA1-a subtype was low in the slow-granule acute-change group (FIG. 3.A), while the hnRNPA1-a subtype was high in the slow-granule chronic stage and normal persons (FIG. 3.B), and the ratio of hnRNPA1-a/B subtypes was consistent with the high-throughput sequencing results (FIG. 3.C), further confirming that the alternative splicing of hnRNPA1 could be used for the early warning of slow-granule acute-change.

(3) Analysis of immunoblot (Western blot) results

The expression of hnRNPA1 protein in peripheral blood mononuclear cells of a slow-granulocyte rapid-change group (8 cases), a slow-granulocyte chronic-change group (9 cases) and normal persons (8 cases) was confirmed by immunoblotting, and as a result, the hnRNPA1-b subtype was highly expressed in the slow-granulocyte rapid-change group, whereas the hnRNPA1-a subtype was highly expressed in the normal persons (FIG. 4). Demonstrating that alternative splicing of hnRNPA1 can apply slow granule acute changes at the protein level. Western blot results showed that the two splice subtypes were found to be 34KD and 38KD for hnRNPA1-a and hnRNPA1-b, respectively, at positions less than 35KD and greater than 35 KD.

(4) qPCR amplification products and hnRNPA1 protein results analysis

To verify the exon 8 skipping splicing pattern of hnRNPA1, qPCR amplification products were sequenced (fig. 5). The results demonstrate that the alternative splicing pattern of hnRNPA1 is exon 8 skipping. Review that alternative splicing of hnRNPA1 is closely related to SLP, hnRNPA1-b subtype is specifically expressed in SLP group, and furthermore, the ratio of hnRNPA1-a/b subtypes can improve the diagnosis of SLP and SLP patients.

The above steps are preferred embodiments of the present patent, but the present patent is not limited to the above embodiments, and those skilled in the art or researchers can make corresponding changes in various fields of knowledge without departing from the spirit of the present patent.

Sequence listing

<110> second subsidiary Hospital of Nanchang university

<120> reagent and kit for diagnosing the bradykinin phase based on hnRNPA1 splice variant

<160>7

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial sequence ()

<400>1

ggtaatgatg gaagcaattt 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence ()

<400>2

cctcccttca tgggtccaaa 20

<210>3

<211>20

<212>DNA

<213> Artificial sequence ()

<400>3

gaggctatgg aagtggtgga 20

<210>4

<211>20

<212>DNA

<213> Artificial sequence ()

<400>4

cctcccttca tgggtccaaa 20

<210>5

<211>24

<212>DNA

<213> Artificial sequence ()

<400>5

tttggaggtg gtggaagcta caat 24

<210>6

<211>1799

<212>DNA

<213> gi 994318938 | Ref _ NM _002136.3 | -human HNRNPA1, transcript variant 1, mRNA, CDS 119..1081()

<400>6

ggcggggtaa aaaagagagg gcgaaggtag gctggcagat acgttcgtca gcttgctcct 60

ttctgcccgt ggacgccgcc gaagaagcat cgttaaagtc tctcttcacc ctgccgtcat 120

gtctaagtca gagtctccta aagagcccga acagctgagg aagctcttca ttggagggtt 180

gagctttgaa acaactgatg agagcctgag gagccatttt gagcaatggg gaacgctcac 240

ggactgtgtg gtaatgagag atccaaacac caagcgctcc aggggctttg ggtttgtcac 300

atatgccact gtggaggagg tggatgcagc tatgaatgca aggccacaca aggtggatgg 360

aagagttgtg gaaccaaaga gagctgtctc cagagaagat tctcaaagac caggtgccca 420

cttaactgtg aaaaagatat ttgttggtgg cattaaagaa gacactgaag aacatcacct 480

aagagattat tttgaacagt atggaaaaat tgaagtgatt gaaatcatga ctgaccgagg 540

cagtggcaag aaaaggggct ttgcctttgt aacctttgac gaccatgact ccgtggataa 600

gattgtcatt cagaaatacc atactgtgaa tggccacaac tgtgaagtta gaaaagccct 660

gtcaaagcaa gagatggcta gtgcttcatc cagccaaaga ggtcgaagtg gttctggaaa 720

ctttggtggt ggtcgtggag gtggtttcgg tgggaatgac aacttcggtc gtggaggaaa 780

cttcagtggt cgtggtggct ttggtggcag ccgtggtggt ggtggatatg gtggcagtgg 840

ggatggctat aatggatttg gtaatgatgg aagcaatttt ggaggtggtg gaagctacaa 900

tgattttggg aattacaaca atcagtcttc aaattttgga cccatgaagg gaggaaattt 960

tggaggcaga agctctggcc cctatggcgg tggaggccaa tactttgcaa aaccacgaaa 1020

ccaaggtggc tatggcggtt ccagcagcag cagtagctat ggcagtggca gaagatttta 1080

attaggaaac aaagcttagc aggagaggag agccagagaa gtgacaggga agctacaggt 1140

tacaacagat ttgtgaactc agccaagcac agtggtggca gggcctagct gctacaaaga 1200

agacatgttt tagacaaata ctcatgtgta tgggcaaaaa actcgaggac tgtatttgtg 1260

actaattgta taacaggtta ttttagtttc tgttctgtgg aaagtgtaaa gcattccaac 1320

aaagggtttt aatgtagatt tttttttttg caccccatgc tgttgattgc taaatgtaac 1380

agtctgatcg tgacgctgaa taaatgtctt ttttttaatg tgctgtgtaa agttagtcta 1440

ctcttaagcc atcttggtaa atttccccaa cagtgtgaag ttagaattcc ttcagggtga 1500

tgccaggttc tatttggaat ttatatacaa cctgcttggg tggagaagcc attgtcttcg 1560

gaaaccttgg tgtagttgaa ctgatagtta ctgttgtgac ctgaagttca ccattaaaag 1620

ggattaccca agcaaaatca tggaatggtt ataaaagtga ttgttggcac atcctatgca 1680

atatatctaa attgaataat ggtaccagat aaaattatag atgggaatga agcttgtgta 1740

tccattatca tgtgtaatca ataaacgatt taattctctt gaaaaaaaaa aaaaaaaaa 1799

<210>7

<211>1955

<212>DNA

<213> gi 994318937 | Ref-NM-031157.3 | -human HNRNPA1, transcript variant 2, mRNA, CDS 119..1237()

<400>7

ggcggggtaa aaaagagagg gcgaaggtag gctggcagat acgttcgtca gcttgctcct 60

ttctgcccgt ggacgccgcc gaagaagcat cgttaaagtc tctcttcacc ctgccgtcat 120

gtctaagtca gagtctccta aagagcccga acagctgagg aagctcttca ttggagggtt 180

gagctttgaa acaactgatg agagcctgag gagccatttt gagcaatggg gaacgctcac 240

ggactgtgtg gtaatgagag atccaaacac caagcgctcc aggggctttg ggtttgtcac 300

atatgccact gtggaggagg tggatgcagc tatgaatgca aggccacaca aggtggatgg 360

aagagttgtg gaaccaaaga gagctgtctc cagagaagat tctcaaagac caggtgccca 420

cttaactgtg aaaaagatat ttgttggtgg cattaaagaa gacactgaag aacatcacct 480

aagagattat tttgaacagt atggaaaaat tgaagtgatt gaaatcatga ctgaccgagg 540

cagtggcaag aaaaggggct ttgcctttgt aacctttgac gaccatgact ccgtggataa 600

gattgtcatt cagaaatacc atactgtgaa tggccacaac tgtgaagtta gaaaagccct 660

gtcaaagcaa gagatggcta gtgcttcatc cagccaaaga ggtcgaagtg gttctggaaa 720

ctttggtggt ggtcgtggag gtggtttcgg tgggaatgac aacttcggtc gtggaggaaa 780

cttcagtggt cgtggtggct ttggtggcag ccgtggtggt ggtggatatg gtggcagtgg 840

ggatggctat aatggatttg gtaatgatgg tggttatgga ggaggcggcc ctggttactc 900

tggaggaagc agaggctatg gaagtggtgg acagggttat ggaaaccagg gcagtggcta 960

tggcgggagt ggcagctatg acagctataa caacggaggc ggaggcggct ttggcggtgg 1020

tagtggaagc aattttggag gtggtggaag ctacaatgat tttgggaatt acaacaatca 1080

gtcttcaaat tttggaccca tgaagggagg aaattttgga ggcagaagct ctggccccta 1140

tggcggtgga ggccaatact ttgcaaaacc acgaaaccaa ggtggctatg gcggttccag 1200

cagcagcagt agctatggca gtggcagaag attttaatta ggaaacaaag cttagcagga 1260

gaggagagcc agagaagtga cagggaagct acaggttaca acagatttgt gaactcagcc 1320

aagcacagtg gtggcagggc ctagctgcta caaagaagac atgttttaga caaatactca 1380

tgtgtatggg caaaaaactc gaggactgta tttgtgacta attgtataac aggttatttt 1440

agtttctgtt ctgtggaaag tgtaaagcat tccaacaaag ggttttaatg tagatttttt 1500

tttttgcacc ccatgctgtt gattgctaaa tgtaacagtc tgatcgtgac gctgaataaa 1560

tgtctttttt ttaatgtgct gtgtaaagtt agtctactct taagccatct tggtaaattt 1620

ccccaacagt gtgaagttag aattccttca gggtgatgcc aggttctatt tggaatttat 1680

atacaacctg cttgggtgga gaagccattg tcttcggaaa ccttggtgta gttgaactga 1740

tagttactgt tgtgacctga agttcaccat taaaagggat tacccaagca aaatcatgga 1800

atggttataa aagtgattgt tggcacatcc tatgcaatat atctaaattg aataatggta 1860

ccagataaaa ttatagatgg gaatgaagct tgtgtatcca ttatcatgtg taatcaataa 1920

acgatttaat tctcttgaaa aaaaaaaaaa aaaaa 1955

Claims (9)

1. Use of a reagent for detecting the expression level of hnRNPA1 splice variant in preparing a kit for diagnosing acute phase of chronic myeloid leukemia, wherein the hnRNPA1 splice variant is hnRNPA1-a subtype and/or hnRNPA1-b subtype, the nucleotide sequence of the hnRNPA1-a subtype is SEQ ID NO.1, and the nucleotide sequence of the hnRNPA1-b subtype is SEQ ID NO. 2.

2. The use according to claim 1, characterized in that said hnRNPA1-a subtype is a splice variant resulting from alternative skipping of exon 8 of hnRNPA1 and said hnRNPA1-b subtype is a splice variant resulting from alternative retention of exon 8 of hnRNPA 1.

3. Use according to either of claims 1 and 2, characterized in that the diagnosis comprises the following steps:

(a) determining the expression level of hnRNPA1-a subtype and/or hnRNPA1-b subtype in a peripheral blood sample from a subject suspected of being in the acute phase of chronic myelogenous leukemia; and

(b) assessing whether the subject is in the acute stage of chronic myelogenous leukemia based on the expression level of hnRNPA1-a subtype and/or hnRNPA1-b subtype.

4. Use according to claim 3, characterized in that said evaluation comprises:

(1) comparing the determined expression level of hnRNPA1-a subtype with a predetermined threshold, the determined expression level of hnRNPA1-a subtype being below the threshold; or comparing the determined expression level of hnRNPA1-b subtype with a predetermined threshold value, the determined expression level of hnRNPA1-b subtype being above the threshold value; or comparing the determined ratio of hnRNPA1-a subtype to hnRNPA1-b subtype expression levels to a predetermined threshold, the determined ratio of hnRNPA1-a subtype to hnRNPA1-b subtype being below the threshold; indicating that the subject is in chronic myelogenous leukemia acute phase.

5. Use according to claim 1, characterized in that said reagents comprise nucleic acid amplification primers for the detection of hnRNPA1-a subtype and/or nucleic acid amplification primers for the detection of hnRNPA1-b subtype.

6. The use according to claim 5, characterized in that said nucleic acid amplification primers for the detection of hnRNPA1-a subtype have a primer sequence 5 '-3': GGTAATGATGGAAGCAATTT, downstream 5 '-3': CCTCCCTTCATGGGTCCAAA, wherein the primer for nucleic acid amplification for detecting hnRNPA1-b subtype has 5'-3' upstream: GAGGCTATGGAAGTGGTGGA, downstream 5 '-3': CCTCCCTTCATGGGTCCAAA are provided.

7. Use according to claim 1, characterized in that said reagents comprise a nucleic acid probe for detecting hnRNPA1-a subtype and/or a nucleic acid probe for detecting hnRNPA1-b subtype.

8. The use according to claim 7, characterized in that said nucleic acid probe for the detection of the hnRNPA1-a and hnRNPA1-b subtypes is a 5 '-3': TTTGGAGGTGGTGGAAGCTACAAT are provided.

9. Use according to claim 1, characterized in that said agent comprises an antibody directed against the hnRNPA1-a isoform of the protein and/or an antibody directed against the hnRNPA1-b isoform of the protein.

Images