CN109880885B - Method for double-fluorescence screening of beta-alanine synthetase - Google Patents
Method for double-fluorescence screening of beta-alanine synthetase Download PDFInfo
- Publication number
- CN109880885B CN109880885B CN201910071013.0A CN201910071013A CN109880885B CN 109880885 B CN109880885 B CN 109880885B CN 201910071013 A CN201910071013 A CN 201910071013A CN 109880885 B CN109880885 B CN 109880885B
- Authority
- CN
- China
- Prior art keywords
- beta
- alanine
- fluorescence
- synthetase
- pand
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for screening beta-alanine synthetase by a double fluorescence method, which comprises the steps of introducing a fluorescence reporter gene and a beta-alanine synthetase gene into host bacteria together, inoculating a basic salt culture medium containing arabinose, and performing induction culture at 30-37 ℃ to obtain fermentation liquor; freeze thawing the fermented liquid to break cell, and taking the cell breaking liquid as crude enzyme liquid; adding the crude enzyme solution into L-aspartic acid, standing at 37 ℃ for 2h for conversion reaction to convert the substrate into beta-alanine, and measuring the fluorescence value of the conversion solution under the conditions of the absorption wavelength of 355nm and the emission wavelength of 445 nm; taking the fermentation liquor to measure the fluorescence value under the conditions of absorption wavelength 395nm and emission wavelength 509nm, and screening to obtain high-activity beta-alanine synthetase; the system has the advantages of simple and convenient operation, stable enzyme activity measurement, high enzyme activity detection sensitivity and the like, and has important application value in the aspect of directional modification of the beta-alanine synthetase.
Description
Technical Field
The invention relates to the field of genetic engineering and enzyme engineering, in particular to high-throughput screening system construction of beta-alanine synthetase.
Background
The beta-alanine is mainly used for synthesizing calcium pantothenate, carnosine, a sweetening agent, a water purification flocculant, an electroplating corrosion inhibitor and the like. The beta-alanine and the derivatives thereof are widely applied in the fields of medicine, beauty treatment, food, feed, chemical industry and the like, and the market demand is rising day by day. At present, β -Ala is synthesized mainly by chemical methods. However, the chemical synthesis method has high process requirements, generates a large amount of nitrile byproducts, inorganic salts and other 'industrial three wastes', has more side reactions, and is not beneficial to separation and purification of products. The beta-alanine produced by the biological enzyme method is more environment-friendly and has less pollution, meets the requirement of green production and has important application prospect.
Multiple microbial sourcesThe coding gene of the beta-alanine synthetase can be expressed in the genetic engineering bacteria. Among them, β -alanine synthetase (PanD) derived from corynebacterium glutamicum and bacillus subtilis has relatively high stability and activity. The panD derived from Corynebacterium glutamicum is cloned into Escherichia coli and Corynebacterium glutamicum for expression, and the activities of the generated crude enzyme solution can reach 27 μmol/g.h and 2073 μmol/g.h (Dusch, Applied)&Environmental Microbiology,1999,65: 1530-1539). The PanD enzyme from Escherichia coli has enzyme inactivation phenomenon in the catalytic process, which is probably caused by irreversible transamination with catalytic activity center acetone acyl group to cause enzyme activity loss (
Green Chemistry,2009,11: 1646-. The search for beta-alanine synthetase with high activity and high stability is the key to solve the problem of synthesizing beta-alanine by biological method.
Danesi et al use a fluorescent substance formed by beta-alanine, o-diacetylbenzene and mercaptoethanol to characterize the activity of PanD for catalytic conversion of aspartic acid, and establish single fluorescence high-throughput screening of PanD mutant protein (Danesi et al, proceedings of bioengineering, 2015, 31: 1184-93). However, the enzyme activity of PanD measured by the method is the total enzyme activity of the fermentation liquor, and is greatly influenced by gene expression conditions and bacterial growth states. In addition, the culture medium adopted by the method is rich, and the formed fluorescence background interference value is larger. On the basis of a single fluorescence method, the invention further utilizes GFP fluorescence intensity to indicate PanD expression quantity, thereby more stably and accurately reflecting the specific activity of PanD enzyme and improving the detection rate of high enzyme activity PanD. In addition, the invention adopts a basic salt culture medium, thereby greatly reducing the background fluorescence value and improving the sensitivity of enzyme activity detection.
Disclosure of Invention
The invention aims to provide a double-fluorescence detection method for detecting specific activity of beta-alanine synthetase, which utilizes recombinant plasmids to place a coding gene of the beta-alanine synthetase and a reporter gene under the same inducible promoter, thereby detecting the expression quantity of the beta-alanine synthetase through the expression level of the reporter gene; the total enzyme activity of the beta-alanine synthetase was determined by measuring the amount of fluorescent substance formed by beta-alanine with o-diacetylbenzene and mercaptoethanol. Calculating the enzyme activity of the beta-alanine synthetase according to the ratio of the two fluorescence intensities. Another object of the present invention is to provide the use of the above-mentioned detection method for screening β -alanine synthetase at high throughput.
The technical scheme adopted by the invention is as follows:
the invention provides a method for double-fluorescence high-throughput screening of beta-alanine synthetase, which comprises the following steps: introducing the fluorescent reporter gene and the beta-alanine synthetase gene into host bacteria together, inoculating a basic salt culture medium containing arabinose, and performing induced culture at 30-37 ℃ to obtain fermentation liquor; freeze thawing and cell breaking the fermentation liquid, and taking the cell breaking liquid as crude enzyme liquid; taking the crude enzyme solution (volume is recorded as V)2) Adding L-aspartic acid (volume of L-aspartic acid is recorded as V)1) Standing at 37 deg.C for 2 hr for conversion reaction to convert substrate into beta-alanine, collecting conversion solution (volume is denoted as V)3) The fluorescence value was measured at an absorption wavelength of 355nm and an emission wavelength of 445nm and was designated as R1(ii) a Taking the fermentation broth (volume is recorded as V)4) The fluorescence value was measured at an absorption wavelength of 395nm and an emission wavelength of 509nm and was designated as R2(ii) a Calculating the specific activity of the beta-alanine synthetase according to a formula (1), and screening to obtain the beta-alanine synthetase with high activity;
R1: fluorescence emission intensity of the conversion solution is measured under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
R2: fluorescence emission intensity of the fermentation liquid measured under the conditions of excitation wavelength of 395nm and emission wavelength of 509 nm;
V1: adding the L-aspartic acid into the beta-alanine conversion detection reaction to obtain the final concentration of 50g/L L-aspartic acid volume;
V2: crude enzyme added for detecting fluorescence emission intensity under the conditions of excitation wavelength of 355nm and emission wavelength of 445nmLiquid volume;
V3: the volume of the conversion solution added in the conversion detection reaction of L-aspartic acid to beta-alanine;
V4: volume of fermentation broth added at the time of detecting fluorescence emission intensity under excitation wavelength of 395nm and emission wavelength of 509 nm.
The basic salt culture medium comprises the following components: k2HPO4·3H2O 14g/L、KH2PO4 5.2g/L、(NH4)2SO4 2g/L、MgSO40.3g/L tryptone and 1g/L solvent are deionized water, the natural pH value is realized, the mixture is sterilized at the temperature of 115 ℃ for 30min and then is taken out from an autoclave, the mixture is cooled to the room temperature, fructose which is subjected to filtration sterilization by a 0.2-micron acetate fiber membrane is added until the concentration is 10g/L, and the mixture is uniformly mixed for later use.
Further, arabinose is added to the minimal medium at a final concentration of 1 to 10mM, preferably 10 mM.
Further, the L-aspartic acid was added to a final concentration of 50 g/L.
Further, the preparation method of the crude enzyme solution comprises the following steps: and (3) rapidly freezing the fermentation liquor at-80 ℃ for 30min, thawing the fermentation liquor at 37 ℃ for 30min, and repeatedly freezing and thawing for 3 times to obtain a crude enzyme solution.
Further, the fluorescent reporter gene comprises but is not limited to a green fluorescent protein coding gene (gfp), and the nucleotide sequence is shown in SEQ ID NO. 1.
Further, the host bacterium is escherichia coli deficient in a beta-alanine synthetase gene derived from bacillus subtilis.
Further, the beta-alanine synthetase gene is connected with an arabinose promoter and then is introduced into a host bacterium together with a fluorescent reporter gene, and the nucleotide sequence of the beta-alanine synthetase gene connected with the arabinose promoter is shown in SEQ ID NO. 3.
The invention places a beta-alanine synthetase coding gene panD and a fluorescent reporter gene gfp into the same inducible promoter ParaConstruction of recombinant plasmid pGLO-Para-panD; constructing beta-alanine synthetase deficient escherichia coli delta panD; by chemical conversionpGLO-Para-panD is introduced into E.coli Δ panD; after arabinose induction, the relative panD expression quantity is measured through green fluorescence intensity, and the relative content of beta-alanine is determined through the fluorescence intensity generated by the reaction of the beta-alanine and a fluorescent agent; the specific activity of the beta-alanine synthetase is determined by calculating the ratio of the two fluorescences.
The method for determining the relative expression of PanD by the double fluorescence method comprises the following steps: arabinose-induced Escherichia coli to express PanD and green fluorescent protein, and pGLO-P carried by the arabinose-induced Escherichia coli is detected under the conditions of 395nm of absorption wavelength and 509nm of emission wavelengtharaThe green fluorescence intensity of panD escherichia coli is detected, the green fluorescence intensity of the panD escherichia coli is detected when no arabinose is added, and the difference value of the green fluorescence intensity and the green fluorescence intensity is adopted to represent the PanD expression quantity, namely the fluorescence value of R1 is obtained by taking the fluorescence value without arabinose as background.
The method for determining the relative content of beta-alanine by using a double fluorescence method is disclosed in the literature (Medici R, de Maria PD, Otten LG, Stratahof AJJ (2011) A high-through put screening assay for amino acid deletion enzyme activity. adv Synth Cat 353:2369-2376), and the content of beta-alanine is characterized by fluorescence generated by a compound generated by the reaction of beta-alanine, 1, 2-o-diacetylbenzene and mercaptoethanol under the conditions of an absorption wavelength of 355nm and an emission wavelength of 445 nm.
Compared with the prior art, the invention has the following beneficial effects:
obtaining more target metabolites per enzyme conversion is the key for screening high-activity enzymes, and for this purpose, the expression amount of the enzyme and the expression amount of the target metabolites need to be detected. Conventionally known methods for quantitative detection of enzymes are SDS PAGE electrophoresis and Western Blot, and detection of metabolites is usually quantitative by high performance liquid chromatography, which is time-consuming and labor-consuming. The key point of the invention is to establish a novel high-throughput screening method, the method adopts two types of fluorescence to respectively indicate the enzyme expression quantity (excitation wavelength is 395nm and emission wavelength is 509nm) and the metabolite quantity (excitation wavelength is 355nm and emission wavelength is 445nm), and the fluorescence value in a sample is obtained by scanning with a microplate reader, so that the data of the beta-alanine enzyme expression quantity and the metabolite beta-alanine can be obtained. Dunhe et al established a single fluorescence detection method (report of bioengineering, 2015, 31: 1184-93) which can only achieve the purpose of rapid quantitative detection of metabolite beta-alanine and cannot rapidly detect beta-alanine synthetase. The key point of the invention is the expression quantity of the green fluorescence indication enzyme emitted by the green fluorescent protein, and the method is accurate and simple. The traditional SDS PAGE electrophoresis and Western Blot method can only detect 10-20 beta-alanine synthetase samples at one time, and the detection of one batch of samples usually needs 1-2 days. The detection method provided by the invention can detect 96 samples simultaneously in about 1 hour, thereby greatly improving the detection efficiency of the beta-alanine synthetase. Therefore, the method provided by the invention can be used for more efficiently and accurately detecting the activity of the beta-alanine synthetase, and has better application prospect.
In addition, the host bacteria adopted by the invention are strains with deleted beta-alanine synthetase coding genes, and the interference of the beta-alanine background value produced by the host bacteria to the test is reduced.
Drawings
FIG. 1 shows pGLO-Para-panD construction scheme.
Fig. 2 is a schematic diagram of the construction principle of CRISPR-Cas 9.
FIG. 3 is a graph showing the relationship between β -Ala production and arabinose concentration.
FIG. 4 is a graph showing the relationship between GFP fluorescence and the concentration of an inducer.
FIG. 5 is a graph showing the relationship between the enzyme activity of PanD and the concentration of an inducer.
FIG. 6 is a scheme showing the screening of beta-Ala synthetase.
Detailed Description
The basic salt culture medium comprises the following components: k2HPO4·3H2O 14g/L、KH2PO4 5.2g/L、(NH4)2SO42g/L、MgSO40.3g/L tryptone 1g/L solvent deionized water, natural pH value, sterilizing at 115 deg.C for 30min, taking out from autoclave, cooling to room temperature, adding fructose sterilized by 0.2 μm acetate membrane filtration to a concentration of 10 g/L.
Example 1: determination of Bacillus subtilis-derived beta-alanine synthetase (PanD) by double fluorescence methodBsu) Specific activity of
1、pGLO-ParaThe panD plasmid map is shown in FIG. 1 and is constructed as follows:
1) the pGLO plasmid containing the green fluorescent protein coding gene (gfp) is digested by XbaI and KpnI to obtain a linearized plasmid vector (the nucleotide sequence is shown in SEQ ID NO. 1).
2) The panD gene derived from Bacillus subtilis and containing arabinose promoter was obtained by whole-gene synthesis and ligated to a plasmid pUC57, a plasmid designated pUC57-panDBsuAnd the nucleotide sequence is shown as SEQ ID NO. 2.
3)pUC57-panDBsuThe DNA fragment of the panD gene derived from Bacillus subtilis carrying the arabinose promoter (nucleotide sequence shown in SEQ ID NO.3) was obtained by digestion with XbaI and KpnI.
4) The linearized vector from step 1) was ligated with the Bacillus subtilis-derived panD gene carrying the arabinose promoter from step 3) by means of DNA ligase. The ligation product was transformed into E.coli MG 1655. delta. panD (see example 2) to obtain the harboring plasmid pGLO-Para-panDBsuThe E.coli MG 1655. delta. panD, from which the recombinant plasmid pGLO-P was extractedara-panDBsu. The recombinant plasmid was identified by PCR and sequencing.
2. Detection of arabinose-induced PanD by fluorescence methodBsuSpecific activity for producing beta-alanine
Will carry plasmid pGLO-Para-panDBsuThe E.coli MG 1655. delta. panD was inoculated into 96-well plates containing 200. mu.L of minimal salt medium supplemented with arabinose at various final concentrations (1mM, 5mM, 10mM, 20mM, 30mM) (as a control in minimal salt medium without arabinose), and the panD enzyme was induced at 30 ℃ for 20 hours. And (3) rapidly freezing each culture solution at-80 ℃ for 30min, thawing at 37 ℃ for 30min, performing freeze-thawing and cell-breaking treatment, and repeating for 3 times to obtain a culture solution after freeze-thawing and cell-breaking, namely a crude enzyme solution. Taking 50 mu L of crude enzyme liquid, adding L-aspartic acid with substrate concentration of 50g/L, standing at 37 ℃ for 2h for conversion reaction to convert the substrate into beta-alanine, taking the conversion liquid, and detecting fluorescence emission by adopting a fluorescence method under the conditions of excitation wavelength of 355nm and emission wavelength of 445nmThe intensity (reflecting the content of beta-alanine) is shown in FIG. 3. When the arabinose concentration is 1-10mM, the yield of the beta-alanine is positively correlated with the concentration of the inducer. After arabinose concentration reached 10mM, the yield of beta-alanine approached the peak.
3. Detection of arabinose-induced PanD by fluorescence methodBsuExpression level of GFP
GFP and PanDBsuThe expression of (a) is regulated by the arabinose promoter, so that PanD can be indicated by the expression amount of GFPBsuThe expression level.
Will carry plasmid pGLO-Para-panDBsuThe E.coli MG 1655. delta. panD was inoculated into a 96-well plate containing 200. mu.L of a basic salt medium supplemented with arabinose at various final concentrations (1mM, 5mM, 10mM, 20mM, 30mM) (as a control) and induced to express GFP protein at 30 ℃ for 20 hours to obtain a fermentation broth; the fluorescence emission intensity (reflecting GFP content) of the fermentation broth at an excitation wavelength of 395nm and an emission wavelength of 509nm was measured by fluorescence, and the results are shown in FIG. 4. When the arabinose concentration is 1-10mM, the green fluorescence value of the cell expression is gradually increased along with the increase of the arabinose concentration, which shows that the expression quantity of GFP protein is continuously increased, and when the concentration of the inducer reaches 10mM, the fluorescence value of GFP is basically maintained to be stable, which shows that the expression quantity of GFP is close to the peak value. Therefore, the arabinose concentration in the culture medium is within 1-10mM, and the expression quantity of the GFP protein is positively correlated with the concentration of the inducer; accordingly, PanDBsuThe expression level should be positively correlated with the concentration of the inducer.
4. Calculation of PanDBsuSpecific Activity of the enzyme
Will carry plasmid pGLO-Para-panDBsuThe E.coli MG 1655. delta. panD was inoculated into a 96-well plate containing 200. mu.L of a basic salt medium supplemented with arabinose at various final concentrations (1mM, 5mM, 10mM, 20mM, 30mM) (as a control with a basic salt medium supplemented with no arabinose), and the panD enzyme was induced at 30 ℃ for 20 hours to obtain fermentation broths, respectively. And (3) rapidly freezing each fermentation liquor at-80 ℃ for 30min, thawing at 37 ℃ for 30min, performing freeze-thawing and cell-breaking treatment, and repeating for 3 times to obtain a culture solution after freeze-thawing and cell-breaking, namely a crude enzyme solution. Collecting crude enzyme25 μ L of liquid (denoted as V)2) Adding 175 mu L of L-aspartic acid (marked as V)1) Allowing the substrate to stand at 37 ℃ for 2 hours to convert the substrate to beta-alanine at a final substrate concentration of 50g/L, and collecting 50. mu.L of the conversion solution (volume is denoted as V)3) Detecting fluorescence emission intensity (reflecting content of beta-alanine) by fluorescence method under excitation wavelength of 355nm and emission wavelength of 445nm, and recording as R1(ii) a Taking 100 μ L of fermentation broth (marked as V)4) The fluorescence emission intensity (reflecting the GFP protein content) by fluorescence method at excitation 395nm and emission 509nm is recorded as R2Calculating PanD according to equation (1)BsuSpecific activity of the enzyme.
PanDBsuThe specific activity of the enzyme can be calculated by the following method: the specific activity calculation formula of the recombinant protein gene is as follows:
R1: fluorescence emission intensity of the conversion solution is measured under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
R2: fluorescence emission intensity of the fermentation liquid measured under the conditions of excitation wavelength of 395nm and emission wavelength of 509 nm;
V1: adding the L-aspartic acid into the reaction for detecting the conversion of the beta-alanine into the L-aspartic acid, wherein the final concentration of the L-aspartic acid is 50g/L L-aspartic acid volume;
V2: the volume of the added crude enzyme liquid is used for detecting the fluorescence emission intensity under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
V3: the volume of the conversion solution added in the conversion detection reaction of L-aspartic acid to beta-alanine;
V4: volume of fermentation broth added at the time of detecting fluorescence emission intensity under excitation wavelength of 395nm and emission wavelength of 509 nm.
The results of calculating the specific activities of PanD enzymes at different arabinose concentrations based on the data measured by the dual fluorescence method (see fig. 5) show that the specific activities for a specific PanD enzyme are related to the properties of the protein itself, regardless of the inducer concentration and the expression amount of the protein. Therefore, the method can reflect the own enzymological properties of the PanD enzyme more stably.
Example 2 high-throughput screening of beta-alanine synthetase by Bifluorescence
1. Mutant library construction
The literature reports that the enzyme activity and stability of PanD derived from the Bacillus subtilis are both significantly better than those of other sources (Wanli Pei et al, Appl Microbiol Biotechnol, 2017, 101: 6015-. The vector plasmid pGLO-P carrying the panD gene of Bacillus subtilis constructed in example 1ara-panDBsuAs a template, error-prone PCR was performed by using primers P1 and P2, the conditions of error-prone PCR are shown in tables 1 and 2, and PCR products were obtained by cutting, recovering and purifying the gel. PCR product as large primer pGLO-Para-panDBsuThe plasmid is used as a template, full-length plasmid is amplified, the initial plasmid template is eliminated after the PCR product is treated by DpnI, and then the initial plasmid template is introduced into Escherichia coli MG1655 delta panD by an electric shock conversion method, and the Escherichia coli MG1655 delta panD is coated in a basal salt medium plate containing 10mM arabinose and cultured overnight at the constant temperature of 37 ℃, and finally about 1000 transformants are obtained.
Primer P1: CTTTAAGAAGGAGATATACAT
Primer P2: GCCTGCAGGTCGACTCTAGA
TABLE 1 error prone PCR System
TABLE 2 PCR reaction conditions
2. The Escherichia coli MG1655 delta panD is constructed by a CRISPR/Cas9 system, the construction principle is shown in figure 2, and the specific method is as follows:
1) the vector plasmid pTargetF-panD for expressing the sgRNA of the target panD gene is constructed by performing PCR amplification by using pTargetF as a template through primers P3 and P4, and transforming Escherichia coli DH5 alpha through a PCR product after eliminating template DNA by DpnI.
Primer P3: CATCGCCTGCTTCGTTAACGAGCGATTGTGTAGGCTGGAG is added.
Primer P4: TAACCAGCCGCAGGGATAACCACTTAACGGCTGACATGGG are provided.
2) Taking Escherichia coli MG1655 genome DNA as a template, carrying out PCR by primers P5 and P6, and amplifying an upstream homologous arm H1 (the nucleotide sequence is shown as SEQ ID NO. 4); the downstream homology arm H2 (nucleotide sequence shown as SEQ ID NO.5) was amplified by PCR with primers P7 and P8. A fragment M (nucleotide sequence shown as SEQ ID NO.6) carrying a chloramphenicol resistance gene was amplified by PCR using pKD3 plasmid as a template and primers P9 and P10. The upstream and downstream homology arms H1 and H2 and the segment M carrying the resistance gene are connected by a one-step cloning method mediated by homologous recombination to construct a gene editing template H1MH 2.
Primer P5: AGATAACCGGGATTGCCCT are provided.
Primer P6: TGAGCCGCTATGCGTATCC is added.
Primer P7: CTTTAAGAAGGAGATATACAT are provided.
Primer P8: GCCTGCAGGTCGACTCTAGA are provided.
Primer P9: CATCGCCTGCTTCGTTAACGAGCGATTGTGTAGGCTGGAG are provided.
Primer P10: TAACCAGCCGCAGGGATAACCACTTAACGGCTGACATGGG are provided.
3) Preparing competent cells: carrying pCas9 wild type Escherichia coli MG1655 in LB medium, at 30 deg.C, shake culture to OD600About 0.2 add arabinose to a final concentration of 15mM and continue growth to OD600Approximately 0.4 hours competent cells were prepared and resuspended in 50mM CaCl containing 10% glycerol2In the solution, the solution is frozen and stored in a refrigerator at the temperature of minus 80 ℃ for later use.
4) And (3) transformation: the gene editing template H1MH2 and pTarget-panD plasmid are transferred into Escherichia coli competent cells carrying pCas9 by a chemical transformation method, and the Escherichia coli competent cells are coated on a resistance selective LB plate containing kanamycin with the final concentration of 50 mu g/mL and spectinomycin with the final concentration of 50 mu g/mL, and are cultured at the constant temperature of 30 ℃ overnight to obtain a transformant.
5) The transformant colony is used as a template, PCR is carried out through primers P11 and P12, and agarose gel electrophoresis is carried out to detect whether the size of a target band is correct (1381bp) or whether a comparison sequence is consistent with a resistance gene sequence after sequencing, so that whether a target gene is replaced by the resistance gene is indicated, and the Escherichia coli MG1655 delta panD is obtained.
Primer P11: AGATAACCGGGATTGCCCT
Primer P12: TGAGCCGCTATGCGTATCC
3. High throughput screening procedure for beta-alanine synthetase (FIG. 6)
Respectively inoculating wild type Escherichia coli MG1655 strain, transformant strain prepared in step 1, and Escherichia coli MG 1655. delta. panD prepared in step 2 into 96-well plate containing 10mM arabinose basal salt culture medium, culturing overnight at 37 deg.C, and measuring OD by enzyme-labeling instrument600Eliminating culture liquid OD obviously lower than wild type colibacillus MG1655600The transformant sample of (1). Mu.l of the remaining transformant culture was inoculated into another 96-well plate to which 180. mu.L of a minimal salt medium containing 10mM arabinose was added, and after culturing at 30 ℃ for 20 hours, the amount of beta-alanine and PanD in the culture were measured by a fluorescence method (same as example 1)BsuThe amount of expression, PanD in the transformantBsuSpecific activity of the mutant. From 1,000 PanDBsuScreening a library of mutants to obtain a panD with specific activity which is obviously higher than that of the wild type panDBsuThe mutant of (3) is sequenced, and the mutation site and the corresponding amino acid change of the coding gene are shown in Table 3.
TABLE 3
Comparative example 1: single fluorescence method for determining bacillus subtilis-derived beta-alanine synthetase (PanD)Bsu) Specific activity of
pGLO-ParaConstruction method of panD plasmid and detection of arabinose-induced panD by fluorescence methodBsuReference to experimental methods for the production of beta-alanineExample 1.
1.PanDBsuDetection of expression level
Will carry plasmid pGLO-Para-panDBsuThe E.coli MG 1655. delta. panD was inoculated into a 96-well plate, 200. mu.L of a basic salt medium containing 10mM arabinose was added to each well (with a basic salt medium containing no arabinose as a control), and panD enzyme was induced to express at 30 ℃ for 20 hours to obtain a fermentation broth; and (3) quickly freezing the fermentation liquor at-80 ℃ for 30min, thawing at 37 ℃ for 30min, performing freeze thawing and cell breaking treatment, and repeating for 3 times to obtain a culture solution after freeze thawing and cell breaking, namely a crude enzyme solution. 25 μ L of crude enzyme solution (denoted as V)2) Adding 175. mu.L of L-aspartic acid (V)1) The substrate was allowed to stand at 37 ℃ for 2 hours to convert the substrate to beta-alanine at a final substrate concentration of 50g/L, and 50. mu.L of the conversion solution (volume V)3) Detecting fluorescence emission intensity (reflecting content of beta-alanine) by fluorescence method under excitation wavelength of 355nm and emission wavelength of 445nm, and recording as R1(ii) a 100. mu.L of fermentation broth (volume V)4) Measuring the OD of each well by using a microplate reader600Is denoted as R2Seeing it as reflecting PanDBsuAn expression amount parameter.
2.PanDBsuComparison of enzyme activities
PanDBsuThe enzyme activity parameter can be calculated by the following method: PanD enzyme Activity per Unit volume OD600(beta-alanine fluorescence value per unit volume of bacterial suspension OD produced by conversion solution)600The calculation formula is as follows:
R1: fluorescence emission intensity of the conversion solution is measured under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
R2: the optical density value of the fermentation liquor is measured under the condition that the absorption wavelength is 600 nm;
V1: adding the L-aspartic acid into the beta-alanine conversion detection reaction to obtain the final concentration of 50g/L L-aspartic acid volume;
V2: the volume of the added crude enzyme liquid is used for detecting the fluorescence emission intensity under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
V3: the volume of the conversion solution added in the conversion detection reaction of L-aspartic acid to beta-alanine;
V4: volume of fermentation broth added when the optical density value was measured at an absorption wavelength of 600 nm.
Comparative example 1 detection of wild type PanDBsuThe results of the relative enzyme activity measurements are shown in Table 4. It is apparent that, compared to the bifluorescence method used in example 1, the monofluorescence method used in comparative example 1 obtains the estimated PanD of the amount of fermentation broth by optical density onlyBsuThe protein content causes that the relative enzyme activity measured value of the same protein is greatly different, and the PanD cannot be accurately reflectedBsuProtein content. PanD in this exampleBsuSharing a promoter with GFP and determining PanD by GFP fluorescence emission intensityBsuThe expression level can more accurately reflect PanDBsuTrue expression level. Therefore, the activity of beta-alanine synthetase can be accurately reflected by the adoption of the double fluorescence method.
TABLE 4
Sequence listing
<110> Zhejiang industrial university
<120> a method for double-fluorescence screening of beta-alanine synthetase
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 5360
<212> DNA
<213> Unknown (Unknown)
<400> 1
ctagagtcga cctgcaggca tgcaagcttg gctgttttgg cggatgagag aagattttca 60
gcctgataca gattaaatca gaacgcagaa gcggtctgat aaaacagaat ttgcctggcg 120
gcagtagcgc ggtggtccca cctgacccca tgccgaactc agaagtgaaa cgccgtagcg 180
ccgatggtag tgtggggtcc cccatgcgag agtagggaac tgccaggcat caaataaaac 240
gaaaggctca gtgcaaagac tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc 300
tcctgagtag gacaaatccg ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag 360
ggtggcgggc aggacgcccg ccataaactg ccaggcatca aattaagcag aaggccatcc 420
tgacggatgg cctttttgcg tttctacaaa ctctttgttt atttttctaa atacattcaa 480
atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 540
agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 600
ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 660
gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 720
gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 780
tatcccgtgt tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 840
acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 900
aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 960
cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 1020
gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 1080
cgatgcctgc agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 1140
tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 1200
tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 1260
ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 1320
tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 1380
gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 1440
ttgatttacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcagc 1500
gtgaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt cccttccttt 1560
ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc 1620
cgatttagtg ctttacggca cctcgacccc aaaaaacttg atttgggtga tggttcacgt 1680
agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt 1740
aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggg ctattctttt 1800
gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa 1860
aaatttaacg cgaattttaa caaaatatta acgtttacaa tttaaaagga tctaggtgaa 1920
gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt tccactgagc 1980
gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat 2040
ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga 2100
gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt 2160
ccttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata 2220
cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac 2280
cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg 2340
ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg 2400
tgagcattga gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag 2460
cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct 2520
ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc 2580
aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt 2640
ttgctggcct tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg 2700
tattaccgcc tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga 2760
gtcagtgagc gaggaagcgg aagagcgcct gatgcggtat tttctcctta cgcatctgtg 2820
cggtatttca caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt 2880
aagccagtat acactccgct atcgctacgt gactgggtca tggctgcgcc ccgacacccg 2940
ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc cggcatccgc ttacagacaa 3000
gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt caccgtcatc accgaaacgc 3060
gcgaggcagc aaggagatgg cgcccaacag tcccccggcc acggggcctg ccaccatacc 3120
cacgccgaaa caagcgctca tgagcccgaa gtggcgagcc cgatcttccc catcggtgat 3180
gtcggcgata taggcgccag caaccgcacc tgtggcgccg gtgatgccgg ccacgatgcg 3240
tccggcgtag aggatctaat tctcatgttt gacagcttat catcgatgca taatgtgcct 3300
gtcaaatgga cgaagcaggg attctgcaaa ccctatgcta ctccgtcaag ccgtcaattg 3360
tctgattcgt taccaattat gacaacttga cggctacatc attcactttt tcttcacaac 3420
cggcacggaa ctcgctcggg ctggccccgg tgcatttttt aaatacccgc gagaaataga 3480
gttgatcgtc aaaaccaaca ttgcgaccga cggtggcgat aggcatccgg gtggtgctca 3540
aaagcagctt cgcctggctg atacgttggt cctcgcgcca gcttaagacg ctaatcccta 3600
actgctggcg gaaaagatgt gacagacgcg acggcgacaa gcaaacatgc tgtgcgacgc 3660
tggcgatatc aaaattgctg tctgccaggt gatcgctgat gtactgacaa gcctcgcgta 3720
cccgattatc catcggtgga tggagcgact cgttaatcgc ttccatgcgc cgcagtaaca 3780
attgctcaag cagatttatc gccagcagct ccgaatagcg cccttcccct tgcccggcgt 3840
taatgatttg cccaaacagg tcgctgaaat gcggctggtg cgcttcatcc gggcgaaaga 3900
accccgtatt ggcaaatatt gacggccagt taagccattc atgccagtag gcgcgcggac 3960
gaaagtaaac ccactggtga taccattcgc gagcctccgg atgacgaccg tagtgatgaa 4020
tctctcctgg cgggaacagc aaaatatcac ccggtcggca aacaaattct cgtccctgat 4080
ttttcaccac cccctgaccg cgaatggtga gattgagaat ataacctttc attcccagcg 4140
gtcggtcgat aaaaaaatcg agataaccgt tggcctcaat cggcgttaaa cccgccacca 4200
gatgggcatt aaacgagtat cccggcagca ggggatcatt ttgcgcttca gccatacttt 4260
tcatactccc gccattcaga gaagaaacca attgtccata ttgcatcaga cattgccgtc 4320
actgcgtctt ttactggctc ttctcgctaa ccaaaccggt aaccccgctt attaaaagca 4380
ttctgtaaca aagcgggacc aaagccatga caaaaacgcg taacaaaagt gtctataatc 4440
acggcagaaa agtccacatt gattatttgc acggcgtcac actttgctat gccatagcat 4500
ttttatccat aagattagcg gatcctacct gacgcttttt atcgcaactc tctactgttt 4560
ctccataccc gtttttttgg gctagaaata attttgttta actttaagaa ggagatatac 4620
atatggctag caaaggagaa gaacttttca ctggagttgt cccaattctt gttgaattag 4680
atggtgatgt taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgctacat 4740
acggaaagct tacccttaaa tttatttgca ctactggaaa actacctgtt ccatggccaa 4800
cacttgtcac tactttctct tatggtgttc aatgcttttc ccgttatccg gatcatatga 4860
aacggcatga ctttttcaag agtgccatgc ccgaaggtta tgtacaggaa cgcactatat 4920
ctttcaaaga tgacgggaac tacaagacgc gtgctgaagt caagtttgaa ggtgataccc 4980
ttgttaatcg tatcgagtta aaaggtattg attttaaaga agatggaaac attctcggac 5040
acaaactcga gtacaactat aactcacaca atgtatacat cacggcagac aaacaaaaga 5100
atggaatcaa agctaacttc aaaattcgcc acaacattga agatggatcc gttcaactag 5160
cagaccatta tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc 5220
attacctgtc gacacaatct gccctttcga aagatcccaa cgaaaagcgt gaccacatgg 5280
tccttcttga gtttgtaact gctgctggga ttacacatgg catggatgag ctctacaaat 5340
aatgaattcg agctcggtac 5360
<210> 2
<211> 3341
<212> DNA
<213> Unknown (Unknown)
<400> 2
tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60
cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120
ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180
accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240
attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300
tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360
tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt accccgctta 420
ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt aacaaaagtg 480
tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca ctttgctatg 540
ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta tcgcaactct 600
ctactgtttc tccatacccg tttttttggg ctagaaataa ttttgtttaa ctttaagaag 660
gagatataca tatgtatcga acaatgatga gcggcaaact tcacagggca actgttacgg 720
aagcaaacct gaactatgtg ggaagcatta caattgatga agatctcatt gatgctgtgg 780
gaatgcttcc taatgaaaaa gtacaaattg tgaataataa taatggagca cgtcttgaaa 840
cgtatattat tcctggtaaa cggggaagcg gcgtcatatg cttaaacggt gcagccgcac 900
gccttgtgca ggaaggagat aaggtcatta ttatttccta caaaatgatg tctgatcaag 960
aagcggcaag ccatgagccg aaagtggctg ttctgaatga tcaaaacaaa attgaacaaa 1020
tgctggggaa cgaaccagcc cgtacaattt tgtagtctag atatcggatc ccgggcccgt 1080
cgactgcaga ggcctgcatg caagcttggc gtaatcatgg tcatagctgt ttcctgtgtg 1140
aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc 1200
ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt 1260
ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg 1320
cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt 1380
tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc 1440
aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa 1500
aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa 1560
tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc 1620
ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc 1680
cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag 1740
ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga 1800
ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc 1860
gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac 1920
agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat ttggtatctg 1980
cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca 2040
aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa 2100
aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa 2160
ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt 2220
aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag 2280
ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat 2340
agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc 2400
cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa 2460
ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca 2520
gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa 2580
cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt 2640
cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc 2700
ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact 2760
catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc 2820
tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg 2880
ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct 2940
catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc 3000
cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag 3060
cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac 3120
acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg 3180
ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt 3240
tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta ttatcatgac 3300
attaacctat aaaaataggc gtatcacgag gccctttcgt c 3341
<210> 3
<211> 644
<212> DNA
<213> Unknown (Unknown)
<400> 3
cccgcttatt aaaagcattc tgtaacaaag cgggaccaaa gccatgacaa aaacgcgtaa 60
caaaagtgtc tataatcacg gcagaaaagt ccacattgat tatttgcacg gcgtcacact 120
ttgctatgcc atagcatttt tatccataag attagcggat cctacctgac gctttttatc 180
gcaactctct actgtttctc catacccgtt tttttgggct agaaataatt ttgtttaact 240
ttaagaagga gatatacata tgtatcgaac aatgatgagc ggcaaacttc acagggcaac 300
tgttacggaa gcaaacctga actatgtggg aagcattaca attgatgaag atctcattga 360
tgctgtggga atgcttccta atgaaaaagt acaaattgtg aataataata atggagcacg 420
tcttgaaacg tatattattc ctggtaaacg gggaagcggc gtcatatgct taaacggtgc 480
agccgcacgc cttgtgcagg aaggagataa ggtcattatt atttcctaca aaatgatgtc 540
tgatcaagaa gcggcaagcc atgagccgaa agtggctgtt ctgaatgatc aaaacaaaat 600
tgaacaaatg ctggggaacg aaccagcccg tacaattttg tagt 644
<210> 4
<211> 938
<212> DNA
<213> Unknown (Unknown)
<400> 4
ctccagccta cacaatcgct cgttaacgaa gcaggcgatg cctgctttga ggaaattctc 60
acgcagtatt gcccgatttt tgtttagtgt ctactcatct gacggcattt gcgtcagcag 120
tttgcgtacc gcgccgaagc gtgccatgta tcgcctgtaa cgaattgata tttctctgaa 180
cgctgctcgg taaacaataa agaggtggct gacgatagcg cgccttgact ggatactgcc 240
ttcacgcaaa gccacacgga agacagggaa gatggatgca ccgagtacca caccgcatga 300
cgcggtattt aaacaatttt taatgcatgc ggagacggct cgcgactttc tggagataca 360
tttgccagtg gaattacgcg aactttgtga cctcaacacg cttcatttag agtcggggag 420
tttcattgaa gagagcctga aaggacacag cacggacgtg ctctattccg tgcaaatgca 480
gggcaatccc ggttatctgc atgttgtgat tgaacaccaa agcaagccgg ataagaaaat 540
ggcctttcgc atgatgcgtt attctatagc cgccatgcac cggcatctgg aggctgacca 600
cgataagctg ccgctggtgg tgccgatact gttttatcag ggcgaggcca caccttatcc 660
gctatcaatg tgctggtttg atatgtttta ctcgccggag ctggcgcgac gcgtctataa 720
cagtcctttc ccgctggtgg atatcaccat cacaccggat gacgaaatca tgcaacatcg 780
gcggattgcg attctcgaac tactgcaaaa acatattcgc cagcgcgact taatgttatt 840
gcttgagcaa ctggtcacgc tgatcgacga agggtacact agcggaagtc agttagttgc 900
catgcaaaac tatatgctgc aacgcggtca tactgaac 938
<210> 5
<211> 1006
<212> DNA
<213> Unknown (Unknown)
<400> 5
ggttcagggg cgacaaaaag ttgaagacgg tttgggcgac ctcaacaagc cgctgagtaa 60
tcagaactta gttacctgga aagatacgcc ggtctataac gcgccgagtg cgggaagtgc 120
gccatttggg gtactggcgg acaatttgcg ctacccgatt ttgcataaac tgaaagacag 180
gttaaatcaa acctggtatc agatccgtat tggcgatcga ctggcctata tcagcgcact 240
ggatgcccaa cccgataatg gcctgtcggt gctaacctat caccatattc tgcgcgacga 300
agaaaacacc cgttttcgcc atacttcgac gaccacatcg gtacgcgctt tcaataacca 360
gatggcctgg ctgcgtgaca ggggatacgc gacactgagc atggtgcagc tggaaggcta 420
cgtgaagaat aagatcaatc tccctgcgcg agcggtggtg attacctttg atgatggcct 480
caagtcggtg agccgctatg cgtatcctgt gttgaaacaa tatggcatga aggcgacggc 540
gtttattgtt acctcacgca tcaaacgtca cccgcagaag tggaacccaa aatcgctgca 600
atttatgagc gtttctgagc ttaacgaaat tcgcgatgta tttgatttcc agtcacatac 660
ccattttttg catcgggtag atggttatcg ccgacccata ttactgagcc gtagtgagca 720
caatattctg tttgattttg cacgttcacg ccgcgctctg gcgcaattta atccgcatgt 780
ctggtatctt tcgtatccgt ttggcggatt taatgacaac gccgtgaagg cagcaaacga 840
tgccggattt cacctggcgg tgacaaccat gaaaggcaaa gtaaaaccgg gggataatcc 900
gttgttacta aaacgacttt atatcttaag aacggattcg ctggagacga tgtcgcggct 960
ggtgagtaac cagccgcagg gataaccact taacggctga catggg 1006
<210> 6
<211> 1097
<212> DNA
<213> Unknown (Unknown)
<400> 6
catcgcctgc ttcgttaacg agcgattgtg taggctggag ctgcttcgaa gttcctatac 60
tttctagaga ataggaactt cggaatagga acttcattta aatggcgcgc cttacgcccc 120
gccctgccac tcatcgcagt actgttgtaa ttcattaagc attctgccga catggaagcc 180
atcacaaacg gcatgatgaa cctgaatcgc cagcggcatc agcaccttgt cgccttgcgt 240
ataatatttg cccatggtga aaacgggggc gaagaagttg tccatattgg ccacgtttaa 300
atcaaaactg gtgaaactca cccagggatt ggctgagacg aaaaacatat tctcaataaa 360
ccctttaggg aaataggcca ggttttcacc gtaacacgcc acatcttgcg aatatatgtg 420
tagaaactgc cggaaatcgt cgtggtattc actccagagc gatgaaaacg tttcagtttg 480
ctcatggaaa acggtgtaac aagggtgaac actatcccat atcaccagct caccgtcttt 540
cattgccata cgtaattccg gatgagcatt catcaggcgg gcaagaatgt gaataaaggc 600
cggataaaac ttgtgcttat ttttctttac ggtctttaaa aaggccgtaa tatccagctg 660
aacggtctgg ttataggtac attgagcaac tgactgaaat gcctcaaaat gttctttacg 720
atgccattgg gatatatcaa cggtggtata tccagtgatt tttttctcca ttttagcttc 780
cttagctcct gaaaatctcg acaactcaaa aaatacgccc ggtagtgatc ttatttcatt 840
atggtgaaag ttggaacctc ttacgtgccg atcaacgtct cattttcgcc aaaagttggc 900
ccagggcttc ccggtatcaa cagggacacc aggatttatt tattctgcga agtgatcttc 960
cgtcacaggt aggcgcgccg aagttcctat actttctaga gaataggaac ttcggaatag 1020
gaactaagga ggatattcat atggaccatg gctaattccc atgtcagccg ttaagtggtt 1080
atccctgcgg ctggtta 1097
Claims (7)
1. A method for double-fluorescence screening of beta-alanine synthetase is characterized by comprising the following steps: introducing a GFP fluorescent reporter gene and a beta-alanine synthetase gene into a host bacterium together, inoculating a basic salt culture medium containing arabinose, and performing induced culture at 30-37 ℃ to obtain a fermentation broth; freeze thawing the fermented liquid to break cell, and obtaining crude enzyme liquid as cell breaking liquid; adding L-aspartic acid and 1, 2-o-diethyl into the crude enzyme solutionStanding acyl benzene and mercaptoethanol at 37 deg.C for 2 hr for conversion reaction, taking conversion solution, measuring fluorescence value at absorption wavelength of 355nm and emission wavelength of 445nm, and recording as R1(ii) a Taking the fermentation liquor to measure the fluorescence value under the conditions of absorption wavelength of 395nm and emission wavelength of 509nm, and recording as R2(ii) a Calculating the specific activity of the beta-alanine synthetase according to a formula (1), and screening to obtain the beta-alanine synthetase; the host bacterium is beta-alanine synthetase gene deficient escherichia coli;
R1: fluorescence emission intensity of the conversion solution is measured under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
R2: fluorescence emission intensity of the fermentation liquid measured under the conditions of excitation wavelength of 395nm and emission wavelength of 509 nm;
V1: adding the L-aspartic acid into the beta-alanine conversion detection reaction to obtain the final concentration of 50g/L L-aspartic acid volume;
V2: the volume of the added crude enzyme liquid is used for detecting the fluorescence emission intensity under the conditions of excitation wavelength of 355nm and emission wavelength of 445 nm;
V3: the volume of the conversion solution added in the conversion detection reaction of L-aspartic acid to beta-alanine;
V4: volume of fermentation broth added at the time of detecting fluorescence emission intensity under excitation wavelength of 395nm and emission wavelength of 509 nm.
2. The method for the dual fluorescent screening of β -alanine synthetase as claimed in claim 1, wherein the minimal salt medium consists of: k2HPO4·3H2O 14g/L、KH2PO4 5.2g/L、(NH4)2SO4 2g/L、MgSO40.3g/L, 1g/L tryptone, 10g/L fructose, deionized water as solvent and natural pH value.
3. The method for the dual fluorescent screening of β -alanine synthetase as claimed in claim 1, characterized in that arabinose is added to the basal salt medium to a final concentration of 1-10 mM.
4. The method for the dual fluorescent screening of β -alanine synthetase as claimed in claim 1, wherein the L-aspartic acid is added to a final concentration of 50 g/L.
5. The method for double-fluorescence screening of β -alanine synthetase as claimed in claim 1, wherein the crude enzyme solution is prepared by the following steps: and (3) rapidly freezing the fermentation liquor at-80 ℃ for 30min, thawing the fermentation liquor at 37 ℃ for 30min, and repeatedly freezing and thawing for 3 times to obtain a crude enzyme solution.
6. The method for double-fluorescence screening of β -alanine synthetase according to claim 1, wherein the nucleotide sequence of the GFP fluorescence reporter gene is represented by SEQ ID No. 1.
7. The method for dual-fluorescence screening of β -alanine synthetase according to claim 1, characterized in that the β -alanine synthetase gene is linked to an arabinose promoter and then introduced into a host bacterium together with a fluorescence reporter gene, and the nucleotide sequence of the β -alanine synthetase gene linked to the arabinose promoter is shown in SEQ ID No. 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910071013.0A CN109880885B (en) | 2019-01-25 | 2019-01-25 | Method for double-fluorescence screening of beta-alanine synthetase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910071013.0A CN109880885B (en) | 2019-01-25 | 2019-01-25 | Method for double-fluorescence screening of beta-alanine synthetase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109880885A CN109880885A (en) | 2019-06-14 |
| CN109880885B true CN109880885B (en) | 2022-06-21 |
Family
ID=66926803
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910071013.0A Active CN109880885B (en) | 2019-01-25 | 2019-01-25 | Method for double-fluorescence screening of beta-alanine synthetase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109880885B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112662732A (en) * | 2020-12-04 | 2021-04-16 | 浙江工业大学 | High-throughput rapid screening method of pantothenate synthetase mutants |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102830189A (en) * | 2012-09-19 | 2012-12-19 | 江南大学 | High performance liquid chromatography (HPLC) measurement method of activity of L-Aspartic acid-decarboxylase |
| CN107164361A (en) * | 2017-07-07 | 2017-09-15 | 南京工业大学 | A kind of immobilization L aspartic acids α decarboxylases and preparation method and application |
-
2019
- 2019-01-25 CN CN201910071013.0A patent/CN109880885B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102830189A (en) * | 2012-09-19 | 2012-12-19 | 江南大学 | High performance liquid chromatography (HPLC) measurement method of activity of L-Aspartic acid-decarboxylase |
| CN107164361A (en) * | 2017-07-07 | 2017-09-15 | 南京工业大学 | A kind of immobilization L aspartic acids α decarboxylases and preparation method and application |
Non-Patent Citations (2)
| Title |
|---|
| A High-Throughput Screening Assay for Amino Acid Decarboxylase Activity;Rosario Médici等;《Adv. Synth. Catal》;20110830;第353卷;摘要，第2370页左栏第2段、右栏第1段 * |
| An activator for pyruvoyl-dependent L-aspartate-α-decarboxylase is conserved in a small group of the γ-proteobacteria including Escherichia coli;Shingo Nozaki等;《MicrobiologyOpen》;20120930;第1卷(第3期);第305页右栏第3-4段，第306页右栏第1-3段、表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109880885A (en) | 2019-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108070611B (en) | Method for editing plant base | |
| CN107475267B (en) | 4-hydroxyisoleucine production plasmid and strain and synthesis method of 4-hydroxyisoleucine | |
| CN111592990B (en) | Recombinant expression strain of feruloyl esterase, preparation method and application thereof | |
| CN110540989A (en) | Primer and method for cloning unknown DNA sequence adjacent to known region based on PCR technology | |
| CN111171132B (en) | Snakehead antibacterial peptide | |
| CN101302531B (en) | Bacillus coli-streptomycete-pseudomonas shuttling expressing BAC vector and construction method thereof | |
| CN109880885B (en) | Method for double-fluorescence screening of beta-alanine synthetase | |
| CN101775410B (en) | Fowlpox virus vector shuttle plasmid and application thereof | |
| CN101693901B (en) | Colibacillus-corynebacterium inducible expression carrier pDXW-8 and building method thereof | |
| WO1994026913A9 (en) | Marker gene | |
| PT698106E (en) | GENETIC MARKER | |
| KR101578444B1 (en) | Recombinant foot-and-mouth disease virus using Korean isolated strain of FMDV A serotype and the manufacturing method | |
| KR101891603B1 (en) | Recombinant foot-and-mouth disease virus expressing protective antigen of type A, Korean and standard strains | |
| CN114438083A (en) | sgRNA for identifying pig PERV gene and coding DNA and application thereof | |
| CN102241763A (en) | Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof | |
| CN110305873A (en) | Editor's label ben-1sgRNA target site and its CRISPR/Cas9 are total to editing system and application altogether | |
| CN110747216A (en) | Multigene co-expression complete vector and application thereof | |
| CN115369099B (en) | Rhizomucor miehei lipase mutant and method for improving activity and/or methanol tolerance of Rhizomucor miehei lipase | |
| US20100304461A1 (en) | Portable, Temperature and Chemically Inducible Expression Vector for High Cell Density Expression of Heterologous Genes in Escherichia Coli | |
| CN104450768B (en) | A kind of shuttle vector for targeting yeast mitochondrial and its application | |
| CN114317605B (en) | Construction method of microglial cell potassium ion probe transgenic mouse model | |
| CN109750005A (en) | A kind of porcine pseudorabies recombinant virus and its construction method | |
| CN114773448B (en) | Recombinant kappa-casein, preparation method thereof and artificial milk | |
| CN113373163B (en) | Codon-optimized Chlamydia trachomatis ctl0286 gene and application thereof | |
| KR101629345B1 (en) | Foot and mouth disease virus expressing P1-protective antigen of Asia1 type, IV genotype and the manufacturing method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |