CN109868309B - Single-stranded DNA amplification method based on universal base substitution insertion - Google Patents
Single-stranded DNA amplification method based on universal base substitution insertion Download PDFInfo
- Publication number
- CN109868309B CN109868309B CN201910164258.8A CN201910164258A CN109868309B CN 109868309 B CN109868309 B CN 109868309B CN 201910164258 A CN201910164258 A CN 201910164258A CN 109868309 B CN109868309 B CN 109868309B
- Authority
- CN
- China
- Prior art keywords
- stranded dna
- dna
- primer
- nascent
- universal base
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention provides a brand-new PCR reaction strategy: aiming at single-stranded DNA, universal bases are substituted and inserted in one-way PCR amplification to form a new DNA sequence containing the universal bases, more design schemes for selecting primers are provided, and the method has wide application values of selectively amplifying the DNA, changing the sequence of the DNA and the like. Meanwhile, the selected primer is designed to selectively amplify a new DNA sequence converted from the target single-stranded DNA, and the primer is applied to the qualitative or quantitative detection of the DNA, so that the influence of a target DNA complementary sequence is avoided, and the sensitivity and the specificity of the detection can be improved.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a single-stranded DNA amplification method based on universal base substitution insertion.
Background
In the conventional PCR amplification technology, a forward primer and a reverse primer (fig. 1A) are added simultaneously to a reaction system, and they are respectively paired with the 3' end region of the antisense strand and the sense strand of a double-stranded DNA molecule of a target sequence, and an extension reaction is started, and a large amount of double-stranded DNA products identical to the target sequence are finally obtained by performing exponential amplification on a template through multiple cycles. This amplification technique can amplify a target sequence only in the presence of a single-stranded DNA (sense strand) or a single-stranded DNA complementary to the target sequence only in the reaction system, and can finally obtain a large amount of double-stranded DNA products identical to the target sequence without distinction. For example, in the PCR reaction using a single-stranded sense strand DNA as a template in FIG. 1B, the reverse primer is paired therewith to start extension, forming an antisense strand DNA; thereafter, the forward primer can be paired with the nascent antisense strand DNA; finally, the forward primer and the reverse primer carry out exponential amplification on the double-stranded DNA template together to obtain a large number of double-stranded DNA products with the same target sequence. This is also true of the PCR reaction using single-stranded antisense strand DNA as a template in FIG. 1C.
Disclosure of Invention
The invention aims to provide a brand-new PCR amplification method aiming at target single-stranded DNA, and the method does not amplify a complementary sequence of the target single-stranded DNA.
In order to achieve the purpose, the invention provides a single-stranded DNA amplification method based on universal base insertion substitution, which comprises the following specific technical scheme:
a single-stranded DNA amplification method based on universal base insertion substitution comprises the following steps:
(1) Step 1, pairing a primer with a 3' end region of a target single-stranded DNA, and starting a one-way PCR reaction by taking the target single-stranded DNA as a template to obtain a new single-stranded DNA molecule; one of the common bases A, T, G, C in the nascent single-stranded DNA molecule is replaced with a universal base; the universal base is a base which can be complementarily paired with at least two bases;
(2) Adding a selective primer in the step 2, and selectively amplifying the nascent single-stranded DNA molecules in the step 1 to obtain selectively amplified products; the selection primer is capable of pairing with the nascent single-stranded DNA molecule, but is not capable of pairing with the complementary sequence of the target single-stranded DNA.
The invention also provides the application of the single-stranded DNA amplification method in DNA quantitative detection or DNA qualitative detection.
Based on the technical scheme, the invention has the following beneficial effects:
the invention provides a brand-new PCR reaction strategy through a great deal of creative work, a target single strand is subjected to single strand DNA amplification based on insertion substitution of universal bases by designing a primer to obtain a new single strand DNA containing the universal bases, and a specific primer is designed according to the new single strand DNA, so that the new single strand DNA can be specifically combined with the new single strand DNA and cannot be combined with a complementary sequence of the target single strand DNA, and the selective amplification of the target single strand DNA is realized without amplifying the complementary sequence of the target single strand DNA. Meanwhile, the method can realize the possibility of changing the DNA sequence in the DNA amplification by inserting universal bases with different complementary preferences and designing different primers, and has important research significance and application value. Furthermore, the PCR amplification method of the present invention is a "one-pot" (one-pot) reaction, i.e., in the reaction setup, only components are added to the reaction system without steps such as separation and purification. Therefore, the utilization rate of the target DNA sample is ensured, the repeatability can be improved in detection application, and the operation is simple.
Drawings
FIG. 1 is a schematic diagram of a conventional PCR method;
FIG. 2 is a schematic diagram of a single-stranded PCR amplification method based on universal base insertion substitution according to the present invention;
FIG. 3 shows the DNA sequence and PCR amplification principle used in example 1;
FIG. 4 is an electrophoretogram for detection of specific amplification of one single-stranded DNA of double-stranded DNAs based on I insertion in example 1;
FIG. 5 is an electrophoretogram for detection of single-stranded DNA amplification based on I insertion in example 2;
FIG. 6 is a graph showing the amplified fluorescent signal of double-stranded DNA detected by Q-PCR in example 3;
FIG. 7 is a graph showing the results of fitting analysis of the logarithm of the copy number of a gradient diluted sample and the corresponding Ct value in the fluorescent quantitative PCR in example 3;
FIG. 8 is an electrophoretogram for detection of specific amplification of one single-stranded DNA based on I insertion in example 5.
Detailed Description
In order that the invention may be more readily understood, reference will now be made to the following more particular description of the invention, examples of which are set forth below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. These embodiments are provided so that this disclosure will be thorough and complete. It will be appreciated that the experimental procedures for the following examples, where specific conditions are not indicated, are generally followed by conventional conditions, such as Sambrook et al, molecular cloning: conditions described in a Laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. The various reagents used in the examples are commercially available.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
Principle of reaction
As shown in FIG. 2A, in the unidirectional PCR reaction system of step 1, a primer is added, the primer is paired with the 3' end region of the target single-stranded DNA, and unidirectional PCR extension is performed by using the target single-stranded DNA as a template; in the reaction system, all 4 commonly used dNTP reaction raw materials (dATP, dTTP, dGTP and dCTP) were not added, but 3 of them were added, and one of them was replaced with universal base deoxynucleoside triphosphate. By this method, a DNA polymerase can only pair with a universal base by inserting it when encountering a corresponding complementary base on the template due to the absence of a dNTP source, thereby replacing the inserted universal base on the newly synthesized DNA strand and obtaining a new single-stranded DNA molecule containing the universal base. Then adding the selective primer to start the 2 nd selective PCR reaction. In the reaction of this step, the selective primer can only be complementarily paired with the newly synthesized DNA sequence containing universal base, but cannot be paired with the complementary sequence of the target single-stranded DNA, thereby realizing selective amplification.
According to this principle, the reaction can be started and amplified also when only the target DNA is single-stranded in the sample to be tested. However, when only the complementary DNA single strand of the target sequence is present in the sample to be tested, the reaction does not proceed because neither the primer nor the selection primer can pair with the complementary DNA single strand.
In the selective PCR reaction of step 2, the added selective primers may be 1 primer paired with the 3' end region of the nascent single-stranded DNA molecule, or 2 (or more) primer pairs respectively paired with the 3' end region and the 5' end region of the nascent single-stranded DNA molecule.
In some preferred embodiments (e.g., FIG. 2B), 2 opposite selection primers can be added to the step 2 selective PCR reaction system, and both primers can only complementarily pair with a newly synthesized DNA sequence containing universal bases, thereby further improving the selectivity.
In some preferred embodiments (e.g., FIG. 2C), a selective fluorescent probe can be added to the step 2 selective PCR reaction system, and only complementary pairing with the newly synthesized DNA sequence containing universal base can be performed for specific fluorescent quantitative detection.
Universal base substitution insertions
In the step 1, adding deoxynucleoside triphosphates into the one-way PCR reaction system, wherein the deoxynucleoside triphosphates are any 3 of dATP, dTTP, dGTP and dCTP, and 1 universal base deoxynucleoside triphosphate; in this step of the PCR extension reaction, the DNA polymerase catalyzes the insertion of a universal base into the nascent DNA strand, and one of the commonly used bases A, T, G, C in the nascent single-stranded DNA molecule is replaced by a universal base.
Optionally, the universal base is selected from: hypoxanthine (Hypoxanthine, the nucleoside of which is Inosine), olfactory uracil BrU (5-Bromouridine), 3-nitropyrrole (3-nitropyrrone), 5-nitroindole (5-nitroindole), 7-Azaindole (7-Azaindole). Preferably, the universal base is hypoxanthine or olfactory uracil. More preferably, the universal base is hypoxanthine.
Specifically, in some preferred embodiments, dATP, dTTP, dCTP and hypoxanthine deoxynucleoside triphosphate (dITP) are added to the one-way PCR reaction system in step 1. In the subsequent extension process of the nascent DNA strand, because the system does not contain dGTP, the DNA polymerase can only insert hypoxanthine I to pair with cytosine C on the template, so that the universal base hypoxanthine is inserted into the nascent DNA strand, and the base G in the nascent single-stranded DNA molecule is replaced by I.
In the selective PCR reaction system of the step 2, the added selective primer is formed by pairing adenine A with I of a corresponding site in a newly generated single-stranded DNA molecule, and can start selective amplification to obtain a product; the selection primer cannot be paired with a target single-stranded DNA complementary sequence with cytosine C as a corresponding site.
Design of selection primers
The primer is selected so that a base that can pair with the universal base but cannot pair with the conventional base that the universal base replaces is selected at the position corresponding to the insertion of the base substitution. For example, in the case where it is determined that the substitution of guanine G with hypoxanthine I is paired with cytosine C, the selection primer is designed such that adenine A is selected to pair with universal base I in the nascent single-stranded DNA molecule, and adenine A at these positions does not pair with the corresponding cytosine C in the complementary sequence of the target single-stranded DNA, thereby allowing selective amplification.
Designing fluorescent probes
Optionally, the method of qualitative or quantitative detection comprises: electrophoresis, fluorescent dye method, fluorescent probe method, and fluorescent in situ hybridization.
Wherein the probe is marked with a fluorescent group and a quenching group.
In a specific example (FIG. 3) of pairing cytosine C with hypoxanthine I instead of guanine G, a sample plasmid double-stranded DNA (containing Plus-Chain/Minus-Chain), a primer R1610 (SEQ ID NO. 6), taq enzyme, dATP, dTTP, dCTP, and dITP are added to the step 1 one-way PCR reaction system. During the subsequent elongation of the nascent DNA strand, the DNA polymerase can only insert hypoxanthine I to pair with it when it encounters cytosine C on the template, since the system does not contain dGTP. Thus, a nascent DNA strand, R1-Chain, is formed with an I insertion, and I pairs with a C on the template. The selective PCR reaction of step 2 was carried out by adding the selection primer AF1538 (SEQ ID NO. 7) and dNTP (dATP, dTTP, dGTP, dCTP) to the reaction system. In this reaction, the selection primer AF1538 can be paired with the DNA strand with the I insertion (R1-Chain) and start to initiate the synthesis of the DNA strand (R2-Chain). In the presence of the commonly used base deoxynucleoside triphosphates such as A, T, G, C, the DNA polymerase will preferentially insert C on the opposite side of I, but will also insert a small amount of a. There may be multiple sequences in the R2-Chain thus formed. In the subsequent PCR step, the target DNA sequence is continuously amplified by the primer R1610 (SEQ ID NO. 6) and the selective primer AF1538 (SEQ ID NO. 7), the advantage of insertion of C on the opposite side of I is continuously enlarged, and finally, a PCR product mainly comprising R3-Chain/R4-Chain (SEQ ID NO.4/SEQ ID NO. 5) is obtained.
The formation of the PCR product can be detected by a specific probe P1558 (SEQ ID NO. 9) or a combined fluorescent probe DP1558 (5' -KcKccaKaKKKKcaKacacK, K = T/G, SEQ ID NO. 35) in a fluorescent quantitative manner.
Since the selection primer AF1538 (SEQ ID NO. 7) is not paired with the Minus strand DNA (Minus-Chain), i.e., the complementary strand of the target single-stranded DNA (Plus-Chain), but is only paired with the newly generated DNA strand containing the I insertion (R1-Chain), the specificity of detection is ensured.
Alternatively, the target single-stranded DNA may be: a free single-stranded DNA molecule, a complete continuous single-stranded DNA from a double-stranded DNA molecule, or a complete continuous single-stranded DNA from a DNA-containing molecule having a complex structure.
The method for amplifying the single-stranded DNA can be applied to DNA quantitative detection or DNA qualitative detection, optionally, the detection method can be electrophoresis, a fluorescent dye method, a fluorescent probe method, a fluorescent in-situ hybridization method and the like, and the detected single-stranded DNA molecules can be newly generated single-stranded DNA molecules containing universal bases obtained by amplifying the target single-stranded DNA as a template in the step 1, and can also be selectively amplified products obtained by amplifying the selected primers in the step 2. Specifically, taking a fluorescent probe method as an example, the single-stranded DNA amplification method is adopted for amplification, and a specific probe for the nascent single-stranded DNA molecule is added to an amplification system for detection, or a specific probe for the selectively amplified product is added for detection; wherein the specific probe is marked with a fluorescent group and a quenching group.
Wherein, the terms involved in the present invention are explained as follows:
DNA: deoxyribonucleic acid, as used herein broadly refers to a DNA molecule.
Base pairing: base Pairing, as used herein, generally refers to the relationship formed by hydrogen bonding between the 2 nucleobases that are in the para position in the DNA duplex structure. This includes classical Watson-Crick complementary pairings, as well as unusual pairings between specific bases.
Primer pairing: primer pairing, as used herein, generally refers to the formation of an ordered relationship between (or within) DNA molecules based on base-complementary pairing interactions. This includes complete pairing in which base pairs in the complementary regions all follow the base-complementary principle, and also includes partial pairing in which a small number of non-classical specific inter-base pairing or unmatched pairing occurs in the complementary regions.
Starting a primer: in this context, one (or more) primer(s) is/are paired with the 3' end region of the target single-stranded DNA sequence. Particularly used for starting the unidirectional PCR reaction of the step 1, and extending the 5 'end to the 3' end of the unidirectional PCR to obtain a new single-stranded DNA molecule. The primer can be amplified exponentially in step 2 selective PCR reaction with the selection primer.
Unidirectional PCR: refers to a PCR reaction that is initiated by pairing a primer (or multiple primers in the same direction) with a single-stranded DNA and extends in only one direction. Unlike the geometric exponential amplification in a conventional bidirectional PCR reaction using 2 opposing primers, the amplification by one-way PCR is arithmetic.
Selecting a primer: this is referred to herein as a primer (or primers) that pairs with the nascent single-stranded DNA molecule containing universal bases, but does not pair with the complementary sequence of the target single-stranded DNA. Particularly for starting the 2 nd selective PCR reaction, selectively amplifying the newly generated single-stranded DNA containing universal base to obtain the product with changed sequence.
Degenerate fluorescent Probe (Degenerate Probe): similar to Degenerate primers, degenerate fluorescent probes are mixtures of oligonucleotide sequences, some of which contain many possible bases at some positions, giving a population of oligonucleotide sequences with similar sequences that can be paired with all possible nucleotide combinations in a given sequence.
Universal base (univeral nuclear acid base): bases that can be complementarily paired with at least two commonly used bases, such as Hypoxanthine (Hypoxanthine, whose nucleoside is Inosine), can be paired with either A, T, G or C, and have a binding capacity of I: C > I: a > I: G > I: T; or for example, olfactory uracil BrU (5-Bromouridine), which can be paired with A or G; alternatively, other universal bases having complementary pairings with at least two of the commonly used bases may be used in the present invention, such as 3-nitropyrrole (3-nitropyrrone), 5-nitroindole (5-nitroindole), 7-Azaindole (7-Azaindole), and the like. These universal bases can be inserted into the nascent DNA strand in a PCR reaction catalyzed by DNA polymerase.
Hypoxanthine deoxynucleoside triphosphates, i.e., deoxyinosine triphosphate, dITP, CAS 95648-77-4.
Bromodeoxyuridine triphosphate, 5-Bromo-2'-deoxyuridine 5' -triphosphate, brdUTP, CAS 102212-99-7.
Example 1 specific amplification of one of the double-stranded DNAs based on I insertion
A control plasmid was constructed by chemically synthesizing the assembly target sequence pDR2p (SEQ ID NO. 1), treating with EcoRI/SacI endonuclease, and inserting into pUC57 plasmid. Sequencing confirmed that the pDR2p sequence was correct.
Insertion sequence of control plasmid pDR2p (SEQ ID No. 1):
5’-gaattcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcccaccggaacttgcccaaggtctgagctc-3’
this example uses the following regions in the pDR2p plus strand as detection targets.
Target single-stranded DNA (SEQ ID NO. 2):
5’-ggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcc-3’
design of single-stranded DNA amplification experiment:
(1) The control plasmid was mixed with a primer R1610 (SEQ ID NO. 6), taq enzyme, dATP, dTTP, dCTP, and dITP, and subjected to the one-way PCR of step 1.
(2) In the above reaction system, the selection primer AF1538 (SEQ ID NO. 7) and dNTP (dATP, dTTP, dGTP, dCTP) were further added to conduct the 2 nd selective PCR reaction.
The reaction scheme of the above steps is shown in figure 3.
Meanwhile, a positive control experiment and a negative control experiment are set. Wherein the positive control used a primer R1610 (SEQ ID NO. 6) in the amplification experiment and a primer F1538 (SEQ ID NO. 8) that perfectly matched the target sequence in the control plasmid, and the negative control used a primer R1610 (SEQ ID NO. 6) in the amplification experiment and a selection primer AF1538 (SEQ ID NO. 7). The reaction system of the positive control and the negative control is added with a conventional dATP, dTTP, dGTP and dCTP mixed solution instead of the dATP, dTTP, dCTP and dITP mixed solution.
The primer sequences are as follows:
primer R1610 (SEQ ID NO. 6):
5’-ggcgttcacggtggtctcc-3’
selection primer AF1538 (SEQ ID NO. 7):
5’-ggAAgaAAaAggggAgAaAAtAtAttta-3’
primer F1538 (SEQ ID NO. 8):
5’-acggggcgcacctctcttta-3’
placing the mixture in a PCR instrument for reaction, and setting the program as follows:
And (3) carrying out electrophoresis detection on the PCR product, wherein the result is shown in figure 4, and M is a molecular weight Marker. The positive control (Lane 1) gave a clear band indicating that primer R1610 (SEQ ID NO. 6) and F1538 (SEQ ID NO. 8), which is perfectly matched to the target sequence in the control plasmid, can amplify the target sequence and its complement. While the negative control (Lane 2) had no band under the same conditions, indicating that the primer R1610 and the selection primer AF1538 were not able to amplify the target sequence and its complement, since the selection primer AF1538 was not able to pair with the complementary strand of the target sequence (Minus-Chain). Single-stranded DNA amplification experiments (Lane 3) gave clear bands, indicating that exponential amplification could begin only after insertion of I and formation of a nascent DNA strand with I pairing to C on the template (R1-Chain in FIG. 3), with selection of primer AF1538 and primer R1610.
Sequencing the final amplification product of the single-stranded DNA amplification experiment confirms that the sequence of the PCR product is R3-Chain/R4-Chain (SEQ ID NO.4/SEQ ID NO. 5).
R3-Chain sequence (SEQ ID NO. 4):
5’-ggAAgaAAaAggggAgAaAAtAtAtttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcc-3’
R4-Chain sequence (SEQ ID NO. 5):
5’-ggcgttcacggtggtctccatgcgacgtgcagaggtgaagcgaagtgcacacggtccggcagatgagaaggcacagacggggagaccgcgtaaaTaTaTTtTcTccccTtTTtcTTcc-3’
this example demonstrates that the single-stranded DNA amplification method of the invention can be achieved, and also demonstrates that the selection primer cannot be paired with the target single-stranded DNA complementary sequence, ensuring the specificity of amplification.
Example 2 Single-stranded DNA specific amplification based on I insertion
Chemically synthesizing single-stranded DNA of ChP (SEQ ID NO. 2) and ChM (SEQ ID NO. 3), desalting and purifying to obtain the single-stranded DNA to be detected.
The ChP sequence: target DNA Single Strand (SEQ)
ID
NO.2)：
5’-ggccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcc-3’
ChM sequence: complementary sequence of the target DNA single-stranded ChP sequence (SEQ ID NO. 3):
5’-ggcgttcacggtggtctccatgcgacgtgcagaggtgaagcgaagtgcacacggtccggcagatgagaaggcacagacggggagaccgcgtaaagagaggtgcgccccgtggtcggcc-3’
ChP and ChM correspond to the positive and antisense sequences, respectively, of the single-stranded DNA of interest on the control plasmid pDR2p in example 1. This example uses ChP as a detection target.
Design of single-stranded DNA amplification experimental group:
(1) The ChP and ChM to be detected are mixed with a primer R1610 (SEQ ID NO. 6), taq enzyme, dATP, dTTP, dCTP and dITP respectively to carry out the 1 st one-way PCR reaction.
(2) In the above reaction system, the selective primer AF1538 (SEQ ID NO. 7) and dNTPs (dATP, dTTP, dGTP, dCTP) were added to carry out the 2 nd selective PCR reaction.
Meanwhile, for the ChP and ChM to be detected, a positive control group and a negative control group were set for reaction according to example 1.
The setup was performed according to the PCR procedure in example 1.
And (3) carrying out electrophoresis detection on the PCR products of the positive control group, the negative control group and the single-stranded DNA amplification experimental group, wherein the results are shown in figure 5. The electrophoretic channels in fig. 5 are described as follows:
m: a molecular weight Marker;
lane 1: chP-positive control reaction;
lane 2: chP-negative control reaction;
lane 3: chP-single-stranded DNA amplification experiments;
lane 4: chM-positive control reaction;
lane 5: chM-negative control reaction;
lane 6: chM single stranded DNA amplification experiments.
The positive control groups (Lane 1, 4) all gave amplification bands, indicating that in the conventional PCR reaction, single-stranded DNA (ChP or ChM), i.e., the single-stranded target DNA strand or its complementary DNA strand, can be used as a template to start amplification, and obtain an undifferentiated result. None of the negative controls (Lane 2, 5) gave an amplification band, indicating that the selective primer AF1538 was selective and unable to pair with ChP or ChM and begin amplification. The ChP amplification experiment (Lane 3) gave a clear amplification band, indicating that the selective primer AF1538 and the primer R1610 could start amplifying the new DNA strand only after the insertion of I and the formation of the new DNA strand with I pairing with C on the template. In the ChM amplification experiment (Lane 6), the primer R1610 cannot be paired with ChM in the 1 st step of unidirectional PCR reaction, and cannot start to extend; furthermore, in the 2 nd selective PCR reaction, the selective primer AF1538 and the primer R1610 have no correct template and cannot start amplification.
This example further demonstrates the specificity of the method, i.e., only the target single stranded DNA is amplified, and the complementary sequence of the target DNA is not amplified.
Example 3 fluorescent quantitation of I-insertion
In order to quantitatively detect the target DNA and further enhance the specificity and selectivity of the detection, a specific fluorescent probe may be added to the reaction system to perform fluorescent quantitative detection (Q-PCR).
Design of single-stranded DNA amplification experimental group:
(1) Gradient dilutions of control plasmids were prepared, each 5. Mu.L containing 5ng, 0.5ng, 50pg, 5pg, 0.5pg, 50fg, 5fg, 0.5fg, corresponding to 1.65E9, 1.65E8, 1.65E7, 1.65E6, 1.65E5, 1.65E4, 1.65E3, 1.65E2 copies, respectively. The control plasmid pDR2p was 2950bp in length and the molecular weight was calculated to be 1.82E6Dalton.
(2) 5uL of the gradient dilution solution of the control plasmid was added to a PCR reaction system (containing a primer R1610 (SEQ ID NO. 6), taq enzyme, dATP, dTTP, dCTP, and dITP) to carry out the one-way PCR reaction of step 1.
(3) In the above reaction system, a selective primer AF1538 (SEQ ID NO. 7), dNTPs (dATP, dTTP, dGTP, dCTP), and a fluorescent probe P1558 (SEQ ID NO. 9) were added, and the mixture was placed in a Q-PCR apparatus to perform the 2 nd selective PCR reaction, and a fluorescent signal was monitored.
At the same time, a blank reaction without control plasmid was set up.
Fluorescent probe P1558 (SEQ ID NO. 9):
5’-cgcggtctccccgtctgtgc-3’
the PCR reaction program was set up as follows:
the selective PCR reaction of step 2 was carried out in a Q-PCR instrument (GeneLight 9800) of Xiamenapril bioengineering Co., ltd: 120sec at 95 ℃;45cycles × (95 ℃,15sec, 45 ℃,50 sec).
The Q-PCR results are shown in FIG. 6. Where no Ct value is shown for the blank. The logarithm of the copy number of the sample diluted in the gradient and the corresponding Ct value were subjected to fitting analysis, and the result is shown in FIG. 7, where R is 2 0.997, with a minimum detection of 0.5fg, corresponding to 165 plasmids.
This example demonstrates that the single-stranded DNA amplification method of the present invention can be used for fluorescent quantitative detection.
Example 4 DNA amplification based on the insertion of bromouracil BrU
This example provides a single-stranded DNA-specific amplification based on the insertion of bromouracil BrU.
This example also used the region (SEQ ID NO. 2) in the positive strand sequence of the control plasmid pDR2p in example 1 as the detection target.
Design of single-stranded DNA amplification experiment:
(1) The control plasmid was subjected to the 1 st one-way PCR reaction with the primer R1610 (SEQ ID NO. 6) and Taq enzyme, dATP, dGTP, dCTP, 5-bromodeoxyuridine triphosphate (5-Bromo-2 '-deoxyuridine 5' -triphosphate, CAS 102212-99-7, brdUTP).
In this reaction, since the system does not contain dTTP, the DNA polymerase can only insert BrU to pair with it when it encounters A on the template. Thus, a nascent DNA strand, R5-Chain (SEQ ID NO. 10), with BrU inserted and BrU paired with A on the template was formed.
R5-Chain(SEQ ID NO.10)：
5’-GGCGTTCACGGTGGTCTCCaBrUgcgacgBrUgcagaggBrUgaagcgaagBrUgcacacggBrUccggcagaBrUgagaaggcacagacggggagaccgcgBrUaaagagaggBrUgcgccccgBrUggBrUcggccggaacggcagacggagaaggggacggBrUagagccccaagcggccccgagacgggBrUcgBrUccgcgggaBrUBrUca gcgccgacgggacgBrUagacaaaggacgBrUccc-3’
(2) In the above reaction system, selection primer G1445 (SEQ ID NO. 11) and dNTP (dATP, dTTP, dGTP, dCTP) were added to conduct the 2 nd selective PCR reaction.
Selection primer G1445 (SEQ ID NO. 11):
5’-gtcccgtcggcgctgGG
in this reaction, after the end G of the selection primer G1445 is paired with BrU in the new DNA strand (R5-Chain), the selection primer G1445 and the primer R1610 can begin to amplify the new DNA strand. BrU can be paired with A or G, and in the presence of a deoxynucleotide triphosphate of the commonly used base such as A, T, G, C, DNA polymerase inserts A or G on the opposite side of BrU to form R6-Chain (SEQ ID NO. 12). Wherein degenerate base R = A/G.
R6-Chain(SEQ ID NO.12)：
5’-gtcccgtccggcgctgGGtcccgcggRcgRcccgtctcggggccgcttggggctctRccgtccccttctccgtctgccgttccggccgRccRcggggcgcRcctctctttRcgcggtctccccgtctgtgccttctcRtctgccggRccgtgtgcRcttcgcttcRcctctgcRcgtcgcRtggagaccaccgtgaacgcc-3’
Example 6 specific amplification of one of the double stranded DNAs based on the I insertion
In this example, a sequence of a commonly used engineering plasmid (e.g., pUC17/18, pUC 57/58) was used as a detection target.
Target sequence (SEQ ID NO. 13)
5’-ccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatg agtgagc-3’
Design of single-stranded DNA amplification experiment:
(1) The target plasmid was mixed with a primer R161 (SEQ ID NO. 14), taq enzyme, dATP, dTTP, dCTP, and dITP, and subjected to the one-way PCR of step 1.
Primer R161 (SEQ ID NO. 14):
5’-gctcactcattaggcacccc-3’
(2) In the above reaction system, selection primers cAF (SEQ ID NO. 15) and dNTPs (dATP, dTTP, dGTP, dCTP) were added to perform the 2 nd selective PCR reaction.
Primer cAF (SEQ ID No. 15) was selected:
5’-AAgAtAaAaattAAaAaAaaAataAgag-3’
meanwhile, a negative control experiment was set up as in example 1.
The PCR procedure was set up as in example 1.
And (3) carrying out electrophoresis detection on the PCR product, wherein the result is shown in FIG. 8, and M is a molecular weight Marker. The negative control (Lane 1) gave a lower molecular weight band indicating that the initiator primer R161 and the selection primer cAF136 were unable to amplify the target sequence and its complement. While the single-stranded DNA amplification experiment (Lane 2) gives an amplified band at the correct position (72 bp), which shows that the selection of primer cAF and the primer R161 can start exponential amplification only after I is inserted and a new DNA strand is formed, I is paired with C on the template.
The technical features of the above embodiments can be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the above embodiments are not described, however, as long as there is no contradiction between the combinations of the technical features, the scope of the present description should be considered as being described in the present specification.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is specific and detailed, but not to be understood as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Anmeijie bioengineering, inc., xiamen City
<120> Single-stranded DNA amplification method based on Universal base substitution insertion
<160> 35
<170> SIPOSequenceListing 1.0
<210> 1
<211> 252
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaattcggga cgtcctttgt ctacgtcccg tcggcgctga atcccgcgga cgacccgtct 60
cggggccgct tggggctcta ccgtcccctt ctccgtctgc cgttccggcc gaccacgggg 120
cgcacctctc tttacgcggt ctccccgtct gtgccttctc atctgccgga ccgtgtgcac 180
ttcgcttcac ctctgcacgt cgcatggaga ccaccgtgaa cgcccaccgg aacttgccca 240
aggtctgagc tc 252
<210> 2
<211> 118
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggccgaccac ggggcgcacc tctctttacg cggtctcccc gtctgtgcct tctcatctgc 60
cggaccgtgt gcacttcgct tcacctctgc acgtcgcatg gagaccaccg tgaacgcc 118
<210> 3
<211> 118
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggcgttcacg gtggtctcca tgcgacgtgc agaggtgaag cgaagtgcac acggtccggc 60
agatgagaag gcacagacgg ggagaccgcg taaagagagg tgcgccccgt ggtcggcc 118
<210> 4
<211> 118
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggaagaaaaa ggggagaaaa tatatttacg cggtctcccc gtctgtgcct tctcatctgc 60
cggaccgtgt gcacttcgct tcacctctgc acgtcgcatg gagaccaccg tgaacgcc 118
<210> 5
<211> 118
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggcgttcacg gtggtctcca tgcgacgtgc agaggtgaag cgaagtgcac acggtccggc 60
agatgagaag gcacagacgg ggagaccgcg taaatatatt ttctcccctt tttcttcc 118
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggcgttcacg gtggtctcc 19
<210> 7
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ggaagaaaaa ggggagaaaa tatattta 28
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
<210> 10
<211> 218
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggcgttcacg gtggtctcca ugcgacgugc agaggugaag cgaagugcac acgguccggc 60
agaugagaag gcacagacgg ggagaccgcg uaaagagagg ugcgccccgu ggucggccgg 120
aacggcagac ggagaagggg acgguagagc cccaagcggc cccgagacgg gucguccgcg 180
ggauucagcg ccgacgggac guagacaaag gacguccc 218
<210> 11
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gtcccgtcgg cgctggg 17
<210> 12
<211> 201
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gtcccgtccg gcgctgggtc ccgcggrcgr cccgtctcgg ggccgcttgg ggctctrccg 60
tccccttctc cgtctgccgt tccggccgrc crcggggcgc rcctctcttt rcgcggtctc 120
cccgtctgtg ccttctcrtc tgccggrccg tgtgcrcttc gcttcrcctc tgcrcgtcgc 180
rtggagacca ccgtgaacgc c 201
<210> 13
<211> 72
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc 60
taatgagtga gc 72
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
<210> 15
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
aagataaaaa ttaaaaaaaa aataagag 28
<210> 16
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
cgttcacggt ggtctccat 19
<210> 17
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ttcacggtgg tctccatgc 19
<210> 18
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
acggtggtct ccatgcgac 19
<210> 19
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
ggtggtctcc atgcgacgt 19
<210> 20
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tggtctccat gcgacgtgc 19
<210> 21
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gtctccatgc gacgtgcag 19
<210> 22
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ctccatgcga cgtgcagag 19
<210> 23
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ccatgcgacg tgcagaggt 19
<210> 24
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gtatagggga agattgggga tataaagt 28
<210> 25
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gaaaaagggg agaaaatata tttaagaggt 30
<210> 26
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
aagtataggg gaagattggg gatataaa 28
<210> 27
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
aaggaagaaa aaggggagaa aatatatt 28
<210> 28
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
aagaaaaagg ggagaaaata tatttaagag 30
<210> 29
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
aaaaagggga gaaaatatat tta 23
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
<210> 31
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
tctccccgtc tgtgccttct c 21
<210> 32
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
cggggccgct tggggctct 19
<210> 33
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
gtccccttct ccgtctgccg t 21
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
Claims (10)
1. A method for amplifying a single-stranded DNA based on universal base insertion substitution, comprising the steps of:
step 1, pairing a primer with a 3' end region of a target single-stranded DNA, and starting a one-way PCR reaction by using the target single-stranded DNA as a template to obtain a new single-stranded DNA molecule; one of the common bases A, T, G, C in the nascent single-stranded DNA molecule is replaced with a universal base; the universal base is a base which can be complementarily paired with at least two common bases;
adding a selective primer in the step 2, and selectively amplifying the nascent single-stranded DNA molecules in the step 1 to obtain selectively amplified products; the selection primer can be paired with the 3' end of the nascent single-stranded DNA molecule, but cannot be paired with the complementary sequence of the target single-stranded DNA.
2. The method for amplifying a single-stranded DNA according to claim 1, wherein the deoxynucleotide triphosphates added in the one-way PCR reaction system of step 1 are any 3 of dATP, dTTP, dGTP and dCTP, and 1 universal base deoxynucleotide triphosphate; in this step of the PCR extension reaction, the DNA polymerase catalyzes the insertion of a universal base into the nascent DNA strand, and one of the commonly used bases A, T, G, C in the nascent single-stranded DNA molecule is replaced by a universal base.
3. The method for amplifying a single-stranded DNA according to claim 1, wherein the universal base is selected from the group consisting of: hypoxanthine, olfactory uracil, 3-nitropyrrole, 5-nitroindole or 7-azaindole.
4. The method for amplifying a single-stranded DNA according to any one of claims 1 to 3, wherein dATP, dTTP, dCTP and hypoxanthine deoxynucleoside triphosphate (dITP) are added to the one-way PCR reaction system of the step 1; in this step of the PCR extension reaction, the DNA polymerase catalyzes the insertion of inosine into the nascent DNA strand and the base G in the nascent single-stranded DNA molecule is replaced by I.
5. The method for amplifying single-stranded DNA according to any one of claims 1 to 3, wherein in the selective PCR reaction system of the step 2, the added selective primer is adenine A for pairing with I at a corresponding site in a newly generated single-stranded DNA molecule, and selective amplification can be initiated to obtain a product; the selection primer cannot be paired with a target single-stranded DNA complementary sequence with cytosine C as a corresponding site.
6. The method for amplifying a single-stranded DNA according to any one of claims 1 to 3, wherein the target single-stranded DNA is: free single-stranded DNA molecules, a complete continuous single-stranded DNA in double-stranded DNA molecules, or a complete continuous single-stranded DNA in DNA-containing molecules with complex structures; and/or
The selection primers added in the step 2 are as follows: 1 primer paired with the 3' end region of the nascent single-stranded DNA molecule, or at least 2 primer pairs paired with the 3' end region and the 5' end region of the nascent single-stranded DNA molecule, respectively.
7. Use of the method for amplifying single-stranded DNA according to any one of claims 1 to 6 for quantitative DNA detection or qualitative DNA detection.
8. The use according to claim 7, wherein the method for the quantitative or qualitative detection of DNA comprises: electrophoresis, fluorescent dye method, fluorescent probe method, and fluorescent in situ hybridization.
9. The use according to claim 7, wherein the quantitative or qualitative detection of DNA is: specifically detecting the nascent single-stranded DNA molecule in step (1), or specifically detecting the selectively amplified product in step (2).
10. The use according to claim 7, wherein the quantitative or qualitative detection of DNA is: and adding a specific probe into the amplification system for detection, wherein the specific probe is marked with a fluorescent group and a quenching group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910164258.8A CN109868309B (en) | 2019-03-05 | 2019-03-05 | Single-stranded DNA amplification method based on universal base substitution insertion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910164258.8A CN109868309B (en) | 2019-03-05 | 2019-03-05 | Single-stranded DNA amplification method based on universal base substitution insertion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109868309A CN109868309A (en) | 2019-06-11 |
| CN109868309B true CN109868309B (en) | 2022-11-11 |
Family
ID=66919769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910164258.8A Active CN109868309B (en) | 2019-03-05 | 2019-03-05 | Single-stranded DNA amplification method based on universal base substitution insertion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109868309B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1578841A (en) * | 2001-12-08 | 2005-02-09 | 视基因公司 | Annealing control primer and the use of the same annealing control primer |
| CN101072882A (en) * | 2004-09-10 | 2007-11-14 | 塞昆纳姆股份有限公司 | Methods for long-range sequence analysis of nucleic acids |
| CN101835903A (en) * | 2007-08-23 | 2010-09-15 | 诺瓦提斯公司 | Methods for detecting oligonucleotides |
| CN102559667A (en) * | 2011-12-31 | 2012-07-11 | 浙江工业大学 | Application of deoxyinosine to oligodeoxynucleotide chain connection reaction |
| CN103484458A (en) * | 2013-10-10 | 2014-01-01 | 东南大学 | Oligonucleotide sequence containing universal base and application thereof to DNA hybridization analysis |
| CN105916999A (en) * | 2013-10-01 | 2016-08-31 | 艾皮斯托姆有限公司 | Mutation analysis using melting temperature and universal bases |
| WO2018057846A1 (en) * | 2016-09-22 | 2018-03-29 | Sigma-Aldrich Co, Llc | Single primer to dual primer amplicon switching |
-
2019
- 2019-03-05 CN CN201910164258.8A patent/CN109868309B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1578841A (en) * | 2001-12-08 | 2005-02-09 | 视基因公司 | Annealing control primer and the use of the same annealing control primer |
| CN101072882A (en) * | 2004-09-10 | 2007-11-14 | 塞昆纳姆股份有限公司 | Methods for long-range sequence analysis of nucleic acids |
| CN101835903A (en) * | 2007-08-23 | 2010-09-15 | 诺瓦提斯公司 | Methods for detecting oligonucleotides |
| CN102559667A (en) * | 2011-12-31 | 2012-07-11 | 浙江工业大学 | Application of deoxyinosine to oligodeoxynucleotide chain connection reaction |
| CN105916999A (en) * | 2013-10-01 | 2016-08-31 | 艾皮斯托姆有限公司 | Mutation analysis using melting temperature and universal bases |
| CN103484458A (en) * | 2013-10-10 | 2014-01-01 | 东南大学 | Oligonucleotide sequence containing universal base and application thereof to DNA hybridization analysis |
| WO2018057846A1 (en) * | 2016-09-22 | 2018-03-29 | Sigma-Aldrich Co, Llc | Single primer to dual primer amplicon switching |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109868309A (en) | 2019-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230099446A1 (en) | Fast pcr for str genotyping | |
| US9057110B2 (en) | Method for direct amplification from crude nucleic acid samples | |
| US5869251A (en) | Use of primers containing nucleotides having altered base pairing characteristics in the amplification of nucleic acid molecules | |
| WO2011060014A1 (en) | Small rna detection assays | |
| EP3036343B1 (en) | Helicase dependent amplification of dna molecules using nucleotide analogs | |
| JP6021230B2 (en) | Method for quantifying human DNA using internal controls | |
| EP0666927A1 (en) | Nucleic acids extension assay. | |
| AU2015270774B2 (en) | Optimization of DNA amplification reactions | |
| EP4019647B1 (en) | Modified multiplex and multistep amplification reactions and reagents therefor | |
| CN109868309B (en) | Single-stranded DNA amplification method based on universal base substitution insertion | |
| JPWO2009119331A1 (en) | Reagent containing primer for detection of cytokeratin 7 mRNA | |
| CN109852727B (en) | HBV-cccDNA detection method and kit based on universal base substitution insertion | |
| US20200002740A9 (en) | Methods for amplification of nucleic acids utilizing a circularized template prepared from a target nucleic acid | |
| CN111334562A (en) | Nucleic acid amplification method and kit containing modified primer | |
| JP7306722B2 (en) | Primer and its use | |
| KR100844010B1 (en) | Method for Simultaneous Amplification of Multi-gene | |
| CA3223987A1 (en) | Methods, compositions, and kits for preparing sequencing library | |
| Manual | Taq PCR Kit | |
| EP3516072A1 (en) | Method for quantifying and/or detecting human male dna | |
| Oliver | Polymerase Chain Reaction and Reverse Transcription&## x2014; Polymerase Chain Reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20220915 Address after: Room 1315, 13 / F, Kangyang building, 406 Chunfeng Road, Huangdai Town, Xiangcheng District, Suzhou City, Jiangsu Province Applicant after: Suzhou Enke Medical Technology Co.,Ltd. Address before: No. 10, Sunshine Road, Haicang District, Xiamen City, Fujian Province, 361026 Applicant before: XIAMEN ANMEIJIE BIOLOGICAL ENGINEERING Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |