CN109825650A - A kind of while four kinds of duck susceptible virus of detection multiple fluorescence quantitative PCR detection primers and probe combinations and detection method - Google Patents
A kind of while four kinds of duck susceptible virus of detection multiple fluorescence quantitative PCR detection primers and probe combinations and detection method Download PDFInfo
- Publication number
- CN109825650A CN109825650A CN201910301084.5A CN201910301084A CN109825650A CN 109825650 A CN109825650 A CN 109825650A CN 201910301084 A CN201910301084 A CN 201910301084A CN 109825650 A CN109825650 A CN 109825650A
- Authority
- CN
- China
- Prior art keywords
- duck
- virus
- seq
- kinds
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of multiple fluorescence quantitative PCR detection primers of four kinds of duck susceptible virus of detection simultaneously and probe combinations and detection method, the primer, sequence are respectively as follows: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11；The probe, sequence are respectively as follows: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12；Four kinds of duck susceptible virus are duck source avian influenza virus, duck source newcastle disease virus, A type duck hepatitis virus, duck tembusu virus.The present invention can detect four kinds of viruses simultaneously and can accomplish quantitative detection to cause of disease, fast and convenient, time saving and energy saving.
Description
Technical field
The invention belongs to technical field of molecular biological detection, and in particular to a kind of four kinds of duck susceptible virus of detection simultaneously
Multiple fluorescence quantitative PCR detection primer and probe combinations and detection method.
Background technique
China is that maximum duck producing country and country of consumption, the duck number of animals raised account for 60% or more of world's total amount in the world.
With the fast development of duck culturing industry in recent years, cultivate that the expansion of scale, the increasing of mixed breed mode, the mobility of people and animals increases
By force, many factors such as deteriorating water quality caused by pollution of waterhead are that the propagation of virus creates advantage, endemy disease
Viral disease increased significantly, and new epidemic situation constantly occurs, and cause serious financial consequences to duck aquaculture.Currently, duck source fowl is flowed
Influenza Virus (AIV), duck source newcastle disease virus (NDV), A type duck hepatitis virus (DHAV), duck tembusu virus (DTMUV) are tight
The common susceptible virus of duck culturing industry is endangered again.These diseases clinically usually exist in the form of mixed infection, only by naked eyes
Observe disease symptom, dissect variation and pathogeneticing characteristic etc., it is difficult to make rapid differential diagnosis, therefore foundation can generally be applicable in this
It is extremely urgent that the fast high-flux of a little virus infections identifies detection method.
Clinically, Virus Isolation, Serologic detection, ELISA, immuno-electron microscope, Standard PCR have been separately applied to this
The detection of a little virus infections, but time-consuming for conventional method such as Virus Isolation, serology and ELISA detect time and effort consuming,
It is often limited by factors such as clinical pathological material of disease freshness, pollution level or the courses of disease, Standard PCR sensitivity shortcoming, immuno-electron microscope is to setting
The disadvantages of standby and viral purification requirements are higher, brings limitation to clinical diagnosis.And clinically these diseases are often
A variety of mixed infections, antidiastole are just more difficult.
Summary of the invention
The purpose of this section is to summarize some aspects of the embodiment of the present invention and briefly introduce some preferable implementations
Example.It may do a little simplified or be omitted to avoid our department is made in this section and the description of the application and the title of the invention
Point, the purpose of abstract of description and denomination of invention it is fuzzy, and this simplification or omit and cannot be used for limiting the scope of the invention.
In view of above-mentioned technological deficiency, the present invention is proposed.
Therefore, as one aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides a kind of same
When detect four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection primer and probe combinations.
In order to solve the above technical problems, the present invention provides the following technical scheme that a kind of four kinds of ducks of detection simultaneously are easily susceptible
Poison multiple fluorescence quantitative PCR detection primer and probe combinations, in which: the primer, sequence be respectively as follows: SEQ ID NO:1,
SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ
ID NO:11；The probe, sequence are respectively as follows: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:
12；
Four kinds of duck susceptible virus are duck source avian influenza virus, duck source newcastle disease virus, A type duck hepatitis virus, duck
Tembusu virus.
As one aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides a kind of while examining
Survey the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus.
In order to solve the above technical problems, the present invention provides the following technical scheme that a kind of four kinds of ducks of detection simultaneously are easily susceptible
The multiple fluorescence quantitative PCR detection method of poison, in which: combined including primer and probe described in claim 1；Four kinds of ducks
Susceptible virus is duck source avian influenza virus, duck source newcastle disease virus, A type duck hepatitis virus, duck tembusu virus.
As it is of the present invention when detection four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection method one kind it is excellent
Select scheme: multiple fluorescence quantitative PCR detection, response procedures are as follows: 95 DEG C of initial denaturation 2min, 95 DEG C of denaturation 10s, 54 DEG C
Annealing and extension 30s.
As it is of the present invention when detection four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection method one kind it is excellent
Select scheme: the multiple fluorescence quantitative PCR detects, final concentration of 0.2 μM of primer in reaction system, probe final concentration of 0.1
μM。
As it is of the present invention when detection four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection method one kind it is excellent
Select scheme: the multiple fluorescence quantitative PCR detects, the final concentration of 0.05U/ μ l of archaeal dna polymerase in reaction system.
As it is of the present invention when detection four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection method one kind it is excellent
Select scheme: the multiple fluorescence quantitative PCR detects, the final concentration of 0.25mM of dNTP in reaction system.
As it is of the present invention when detection four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection method one kind it is excellent
Select scheme: the multiple fluorescence quantitative PCR detects, Mgcl in reaction system2Final concentration of 4.125mM.
As it is of the present invention when detection four kinds of duck susceptible virus multiple fluorescence quantitative PCR detection method one kind it is excellent
Select scheme: four kinds of duck susceptible virus, testing goal gene are respectively the stromatin of the antigen-4 fusion protein gene of NDV, AIV
The Envelope Protein Gene of gene, the Nucleocapsid Protein Gene of DHAV, DTMUV.
Beneficial effects of the present invention: the present invention detects four kinds of viruses while can be accurate, special, sensitive, for clinically
Extensive virus monitor, epidemiological survey and the prevention and control of these diseases of AIV, NDV, DHAV, DTMUV, which provide one kind, to be had
The detection means of effect, it is detection sensitivity height, high specificity, reproducible.Four kinds of viruses can be detected simultaneously and cause of disease can be accomplished
Quantitative detection, fast and convenient, time saving and energy saving, the present invention detects specificity and reaches 100%, and sensibility reaches 1x101copies/μ
l。
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, required use in being described below to embodiment
Attached drawing be briefly described, it should be apparent that, drawings in the following description are only some embodiments of the invention, for this
For the those of ordinary skill of field, without any creative labor, it can also be obtained according to these attached drawings other
Attached drawing.Wherein:
Fig. 1 is the melt curve analysis of four kinds of viral primers.Figure 1A: AIV；Figure 1B: NDV；Fig. 1 C:DHAV；Fig. 1 D:DTUMV.
Fig. 2 is the specific test of four kinds of viral primed probes.A-AIV；B-NDV；C-DHAV； D-DTUMV.
Fig. 3: standard curve.A-AIV；B-NDV；C-DHAV；D-DTUMV.
Specific embodiment
In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, right combined with specific embodiments below
A specific embodiment of the invention is described in detail.
In the following description, numerous specific details are set forth in order to facilitate a full understanding of the present invention, but the present invention can be with
Implemented using other than the one described here other way, those skilled in the art can be without prejudice to intension of the present invention
In the case of do similar popularization, therefore the present invention is not limited by the specific embodiments disclosed below.
Secondly, " one embodiment " or " embodiment " referred to herein, which refers to, may be included at least one realization side of the invention
A particular feature, structure, or characteristic in formula." in one embodiment " that different places occur in the present specification not refers both to
The same embodiment, nor the individual or selective embodiment mutually exclusive with other embodiments.
The present invention establishes a kind of multiple fluorescence quantitative PCR method can detect 4 kinds of ducks such as NDV, AIV, DHAV, DTMUV simultaneously
Virus comprising following steps:
1) genome prepares:
4 kinds of viruses are extracted respectively according to ViralRNAExtractionKit kit specification and have strain genome, are pressed
Book reverse transcription is cDNA as directed, and all cDNA are placed in -80 DEG C and save backup.
2) design and synthesis of primer and probe:
The gene order that this 4 kinds of viruses of NDV, AIV, DHAV, DTMUV have been announced in GenBank is compared respectively, and selection is protected
Defending zone domain carries out the evaluation and screening of primer and probe using PrimerPremier5, designs specific primer and probe SEQ ID
NO:1-12 (table 1) and building standard plasmid primer SEQ ID NO:13-20 (table 2) are shown, and primer is by Nanjing Jin Sirui biology section
The synthesis of skill Co., Ltd.
3) standard plasmid constructs:
Using above-mentioned design for constructing the primer of plasmid, PCR amplification goes out target fragment, is building up to pMD18-T carrier
On, by recombinant plasmid transformed into DH5 α competent escherichia coli cell, used after expanding culture
TIANprepMiniPlasmidKit kit extracts the plasmid of each virus, is used for subsequent experimental or standby in -80 DEG C of preservations
With.
4) primer specificity is verified:
Respectively using the plasmid of 4 kinds of viruses toxic strain as template, using the specific primer of above-mentioned design, amplification is corresponding
Target fragment.Reaction system is 20 μ l, including 2xSYBRGreen10.0 μ l, each 0.5 μ l of upstream and downstream primer, single virus particle
1 μ l of template, deionized water supply 20 μ l；Response procedures are as follows: 95 DEG C of 2min, 95 DEG C of 10s, 54 DEG C of 30s after 40 recycle, increase
Add melting curve program: 95 DEG C of 10s, 60 DEG C of 30s, 97 DEG C of 1s, for determining whether product is single.
5) multiple fluorescence quantitative PCR Establishing:
Reaction system is 20 μ l, including 10xtaqbuffer (no Mg2+) 2 μ l, TaqDNAPolymerase (5U/ul) 0.2
μ l, dNTPmix (10mMeach) 0.5 μ l, Mgcl2(25mM) 3.3 μ l, each 0.4 μ l of the upstream and downstream primer of each virus, probe are each
0.2 μ l, single 1 μ l of virus particle template, deionized water supply 20 μ l；Response procedures are as follows: 95 DEG C of initial denaturation 2min, 95 DEG C of denaturation
10s, 54 DEG C of annealing extend 30s, and 40 circulations collect fluorescence signal after 54 DEG C.
6) multiple fluorescence quantitative PCR specific detection:
According to established multiple fluorescence quantitative PCR method, respectively with these four virus particles and other common duck diseases
The nucleic acid of poison is expanded as template, and reaction system is 20 μ l, including 10xtaqbuffer (no Mg2+) 2 μ l,
TaqDNAPolymerase (5U/ul) 0.2 μ l, dNTPmix (10mMeach) 0.5 μ l, Mgcl2(25mM) 3.3 μ l, each virus
Each 0.4 μ l of upstream and downstream primer, probe each 0.2 μ l, single 1 μ l of cause of disease template, deionized water supplies 20 μ l；Response procedures are same
On, while the blank control group of deionized water is set.
7) multiple fluorescence quantitative PCR sensitivity assessment:
It is extracted using PlasmidMiniprepKit and correct recombinant plasmid is sequenced, quantitatively recombinated using Nanodrop2000
Plasmid concentration, with aseptic double-distilled water by recombinant plasmid according to 1x107copies/μl-1x100Copies/ μ l10 times gradient dilution
Prepare plasmid standard.Using the plasmid standard of 10 times of gradient dilutions as template, template copy numbers and critical cycle number are obtained
(Cq) standard curve.Single viral template passes through the Cq value of various concentration standard items, determines the minimum that this method can be detected
DNA copy number is the sensibility of substance；Multiple sensibility similarly, four kinds of viral same concentration plasmid standards is mixed, are obtained
The standard curve new to one, therefore, it is determined that multiple sensibility.Using quantitative fluorescence analysis software, amplification is analyzed.
Embodiment 1:
The design and screening of primer
According to the conservative gene of virus each in GenBank, the antigen-4 fusion protein gene (F gene) of NDV, the matrix egg of AIV
White gene (M gene), the Nucleocapsid Protein Gene (VP1 gene) of DHAV, the Envelope Protein Gene (E gene) of DTMUV are used
DNAMAN software carries out homology analysis, using Primer Premier5.0 software, designs specificity in its conservative region and visits
Needle, and flag F AM, JOE, ROX, the fluorescent emissions group such as Cy5, in 3 ' end label BHQ1 or BHQ2 fluorescent quenching bases are held 5 '
Group, while it being directed to probe location, the two or more kinds of primers of every kind of viral design are screened, and are selected specifically good anti-without intersecting
It answers and primer that amplification efficiency is good.Each virus specific primers and probe are shown in Table 1.
Table 1
Embodiment 2:
Plasmid standard preparation
Step 1: primer synthesizes
4 pairs of virus particle building primers designed by the present invention are shown in Table 2, are closed by Nanjing Jin Sirui Bioisystech Co., Ltd
At.
Step 2: virus total RNA is extracted
4 kinds of viral RNAs are extracted respectively according to Viral RNA Extraction Kit kit specification, and are carried out at once
Reverse transcription step.
Step 3: reverse transcription PCR
Each 1 μ l of RNA of NDV, AIV, DHAV and DTMUV are added in the PCR pipe of no RNase, uses
ThermoScientific RevertAidFirstStrand cDNASynthesisKit carries out RT-PCR reaction, wherein 5x
4 μ l, 10mM dNTP of Buffer, 2 μ l, Random Primers, 1 μ l, 20U/ μ l Ribolock RNase, 1 μ l, 200U/ μ l
1 μ l, DEPC water of ReverAid M-MuLVRTase 10 μ l, 20 μ l of total system obtain cDNA after reaction.
Step 4: PCR amplification
The PCR reaction system of 50 μ l: 5 μ l, 5U/ul DNA Polymerase of 10x taq buffer 0.5 μ l, 10mM
2 μ l, 25mM Mgcl of dNTP mix28 μ l, with the 1 μ l of primer of each virus synthesized in the first step, what third step obtained
CDNA/DNA is template, adds deionized water to complement to 50 μ l, carries out PCR amplification respectively.The response parameter of PCR instrument are as follows: 95 DEG C pre-
It is denaturalized 5min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, 35 recycle, 72 DEG C of extension 10min.
Step 5: prepared by plasmid standard
The amplified production that 4th step is obtained carries out agarose gel electrophoresis, grasps according to DNA Gel Extraction Kit
Make method recycling target fragment, recovery product be connected on pMD18-T carrier, is converted by DH5 α E. coli competent,
Plate is drawn to be incubated overnight rear picking wherein white single colonie is identified, recombinant plasmid sequence entrust Shanghai Sheng Gong biotech firm into
Row sequencing.It is extracted using PlasmidMiniprep Kit and correct recombinant plasmid is sequenced, it is fixed using Nanodrop 2000
Recombinant plasmid concentration is measured, with aseptic double-distilled water by recombinant plasmid according to 1x107-1x10010 times of gradient dilution preparations of copies/ μ l
Plasmid standard.
Table 2
| Name | Sequence(5’-3’) | Targeted gene | Length |
| AIV-F | ATGAGTCTTCTAACCGAGGTC | M | 982bp |
| AIV-R | TTACTCCAGCTTTATGTTGAC | ||
| NDV-F | GCATTGCTGCAACCAATGAAG | F | 1173bp |
| NDV-R | ATCTGATCAAGGGCATTATT | ||
| DHAV-F | TGAGCCAGTTTGCTTTCT | VP1 | 616bp |
| DHAV-R | TCCACCTCCTCTTCATTTTAG | ||
| DTMUV-F | CCGCTGAGATGGAGGATT | E | 500bp |
| DTMUV-R | CGACATGGATATGGGAAC |
Embodiment 3:
Primer specificity verifying
Respectively using the standard plasmid of 4 kinds of virus formulations as template, corresponding target fragment is expanded, each reaction system is 20
μ l, including 10.0 μ l of 2x SYBR Green, upstream and downstream primer each 0.4 μ l, single 1 μ l of virus particle template, deionized water are mended
20 μ l of foot；Response procedures are as follows: 95 DEG C of 3min, 95 DEG C of 10s, 54 DEG C of 30s increase a melt curve analysis program after 40 recycle:
95 DEG C of 10s, 60 DEG C of 30s, 97 DEG C of 1s, the results showed that products therefrom is single, primer specificity 100%.
Embodiment 4:
Annealing temperature optimization
Annealing temperature determines PCR specificity and yield: temperature high specific is strong, but excessively high then primer cannot be secured with template
In conjunction with DNA amplification efficiency decline；Temperature low yield is high, but too low causes primer and template mispairing, nonspecific products increasing
Add.There are 4 pairs of primers and 4 kinds of probes in the reaction of quadruple quantitative fluorescent PCR, the suitable annealing temperature of respective primer is also different
, we have groped the optimal annealing temperature of quadruple quantitative fluorescent PCR reaction thus.
Embodiment 5:
The optimization of primer and probe
Different primers and probe is different with the joint efficiency of template, is then embodied in quantitative fluorescent PCR reaction final
Cq value have biggish difference.For example, the template of same concentration, two different primers have different Cq values, Cq value is small
Then illustrate that this primer is easier to combine with template, design relatively preferably, it is on the contrary then poor, be shown in Table 3.
Table 3
Embodiment 6:
The optimization of reaction system
We match the reaction system of multiplex PCR using the Premix that company buys, and quadruple reaction can only come out two.Later
We optimize the composition proportion of mix, have been successfully established multiple fluorescence quantitative PCR reaction system table 4).Mix ingredient is mainly
TaqDNA Polymerase, dNTP mix, Mgcl2And buffer.Different enzymes has a different amplification characteristics, and the use of enzyme
Amount is then related to cost problem, we optimize the type and dosage of polymerase thus.DNTP is to extend step in PCR to provide original
Material, in PCR reaction, using low dNTP concentration, nucleotide mistake when can reduce the starting of non-target position and extend is mixed, and is
We have groped optimal dNTP concentration for this.The effect of magnesium ion is mainly dNTP-Mg2+With nucleic acid backbone interaction and energy shadow
The activity of enzyme is rung, magnesium ion concentration is high, and amplification efficiency is just high, but specificity can decline；Magnesium ion concentration is low, amplification efficiency meeting
Decline, but specificity can improve, we have groped optimal magnesium ion concentration thus, are shown in Table 4.
Table 4
Embodiment 7:
The setting of fluorescence threshold
Threshold value setting principle is random just above the amplification curve of normal negative controls and negative sample with threshold line
Noise line highest point, not occurrence and subject to intersecting with the exponential phase of positive control.Click assay surface, take 3-10 or
The fluorescence signal of 3-15 circulation determines baseline.
Result judgement: detection value≤35 sample Cq, and curve has apparent Exponential growth stage, measurement result is effective, can be straight
It is informed of a case and accuses the sample positive；When detecting sample Cq value > 35 or can't detect sample Cq value, sample feminine gender can be reported.
Embodiment 8:
Multiple fluorescence quantitative PCR Establishing
Multiple fluorescence quantitative PCR reaction system is finally established by optimizing above, reaction system is 20 μ l, 4 kinds of viruses
Recombinant plasmid be template, be separately added into 4 kinds of viral specific primers and probe, final concentration of 0.2 μM of primer, probe is dense eventually
Degree is 0.1 μM；Response procedures after optimized are as follows: 95 DEG C of initial denaturations 2min, 95 DEG C of denaturation 10s, 54 DEG C of 30s that anneal and extend,
After carrying out 40 circulations, the acquisition of multi-fluorescence signal carries out after each extend.Standard plasmid goes out as positive control
Bacterium distilled water does 3 repetitions as negative control, each reaction.
Embodiment 9:
Multiple fluorescence quantitative PCR specific detection
According to established multiple fluorescence quantitative PCR method, the specificity of single primer is verified.Respectively with the matter of each virus
Grain be template as positive control, and be added the susceptible cause of disease of other ducks for example goose parvovirus, duck plague virus, reovirus,
The nucleic acid of the cause of diseases such as Escherichia coli, salmonella, pest of duck Li bacillus, Pasteurella, each reaction system are 20 μ l, including with
1 μ l of upper viral template, every kind of viral primed probe mixture totally 1 μ l, 10x taq buffer (no Mg2+) 2 μ l, Taq DNA
0.2 μ l, dNTP mix (10mM each) of Polymerase (5U/ul) 0.5 μ l, Mgcl2 (25mM) 3.3 μ l, deionized water are mended
20 μ l of foot；Response procedures are as follows: 95 DEG C of initial denaturations 2min, 95 DEG C of denaturation 10s, 54 DEG C of 30s that anneal and extend carry out 40 circulations
Afterwards, the acquisition of multi-fluorescence signal carries out after each extend.Standard plasmid is as positive control, and sterilize distilled water conduct
3 repetitions are done in negative control, each reaction.The experimental results showed that multiple fluorescence quantitative PCR detection specificity of the present invention is
100%.
Embodiment 10:
Multiple fluorescence quantitative PCR sensitivity assessment
It is extracted using PlasmidMiniprep Kit and correct recombinant plasmid is sequenced, quantitatively weighed using Nanodrop2000
Group plasmid concentration, with aseptic double-distilled water by recombinant plasmid according to 1x107copies/μl-1x10010 times of gradients of copies/ μ l are dilute
It releases and prepares plasmid standard.4 single template isoconcentrations are mixed into assembling multiple forms, from 1x107copies/μl-
1x100Copies/ μ l does the multiple fluorescence quantitative PCR of 8 gradients, measures the sensibility of multiple fluorescence quantitative PCR method.According to
The relationship of plasmid concentration and Cq value makes standard curve, and the sensibility of this method reaches 1x101copies/μl.See Fig. 3.
Embodiment 11:
Clinical sample detection
Clinical sample detection and virus purification.The method that Preliminary Applications are established detected 60 parts of clinical sample: to 2017 9
The moon picks up from the sample of Jiangsu Province in January, 2019, and the prevalence of these viruses is tested and analyzed using multiple fluorescence quantitative PCR method
Situation.
60 portions of pathological material of disease lapping liquids are extracted into viral RNA and reverse transcription, are detected according to the method for embodiment 8.It is multiple glimmering
Fluorescent Quantitative PCR testing result is shown, in 60 parts of pathological material of diseases, identifies 7 plants of AIV positive-virus, NDV virus-4 strain, DHAV virus 6
Strain, 2 plants of DTMUV virus；2 plants of AIV+NDV coinfection, 1 plant of AIV+DHAV coinfection.
It can be seen from the results above that the multiple fluorescence quantitative PCR detection method of virus has compared with virus isolation procedure
Have the characteristics that the used time is short, sensibility is high, the positive findings of virus purification are the positive in multiplex PCR detection, and accuracy in detection is
100%.
As seen from the above embodiment, NDV, AIV, DHAV, DTMUV virus specific primers probe that the present invention designs
Combination has very strong specificity, is all feminine gender to virus of the detection in addition to NDV, AIV, DHAV, DTMUV virus, detection is special
The opposite sex is 100%；Batch interior experiment shows that the multi-PCR detection method of building is with good stability between batch.
The design of probe of the present invention is particularly important, and probe needs are matched with primer, and probe is needed prior to primer combination mould
Plate, otherwise will lead to archaeal dna polymerase can not cut probe, can not generate fluorescence signal, and detection is caused to fail, while probe needs
Guarantee the efficient combination with template, otherwise can not be effectively in conjunction with template, fluorescence signal can not be generated by also resulting in, and cause to detect
Failure；It needs to guarantee between probe, will not polymerize between probe and primer and mispairing simultaneously.
Testing goal gene selects of the present invention are reasonable, and the design of primer and probe and combination are excellent, can it is accurate, special,
Four kinds of viruses are detected while sensitive, for the clinically extensive virus monitor of AIV, NDV, DHAV, DTMUV, epidemiology tune
It looks into and the prevention and control of these diseases provides a kind of effective detection means, it is detection sensitivity height, high specificity, reproducible.
A variety of viruses can be detected simultaneously and can accomplish quantitative detection to cause of disease, it is fast and convenient, it is time saving and energy saving.
It should be noted that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although referring to preferable
Embodiment describes the invention in detail, those skilled in the art should understand that, it can be to technology of the invention
Scheme is modified or replaced equivalently, and without departing from the spirit and scope of the technical solution of the present invention, should all be covered in this hair
In bright scope of the claims.
Claims (8)
1. the multiple fluorescence quantitative PCR detection primer and probe combinations, feature of a kind of four kinds of duck susceptible virus of detection simultaneously exist
In: the primer, sequence are respectively as follows: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:5, SEQ
ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11；The probe, sequence are respectively as follows: SEQ ID
NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12；
Four kinds of duck susceptible virus are duck source avian influenza virus, duck source newcastle disease virus, A type duck hepatitis virus, the smooth cloth of duck
Soviet Union's virus.
2. a kind of multiple fluorescence quantitative PCR detection method for detecting four kinds of duck susceptible virus simultaneously, it is characterised in that: including right
It is required that primer and probe described in 1 combines；Four kinds of duck susceptible virus, be duck source avian influenza virus, duck source newcastle disease virus,
A type duck hepatitis virus, duck tembusu virus.
3. detecting the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus when as claimed in claim 2, feature exists
In multiple fluorescence quantitative PCR detection, response procedures are as follows: 95 DEG C of initial denaturation 2min, 95 DEG C of denaturation 10s, 54 DEG C anneal and
Extend 30s.
4. the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus is detected when as claimed in claim 2 or claim 3, it is special
Sign is: the multiple fluorescence quantitative PCR detection, final concentration of 0.2 μM of primer in reaction system, final concentration of 0.1 μ of probe
M。
5. the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus is detected when as claimed in claim 2 or claim 3, it is special
Sign is: the multiple fluorescence quantitative PCR detection, the final concentration of 0.05U/ μ l of archaeal dna polymerase in reaction system.
6. the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus is detected when as claimed in claim 2 or claim 3, it is special
Sign is: the multiple fluorescence quantitative PCR detection, the final concentration of 0.25mM of dNTP in reaction system.
7. the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus is detected when as claimed in claim 2 or claim 3, it is special
Sign is: the multiple fluorescence quantitative PCR detection, Mgcl in reaction system2Final concentration of 4.125mM.
8. the multiple fluorescence quantitative PCR detection method of four kinds of duck susceptible virus is detected when as claimed in claim 2 or claim 3, it is special
Sign is: four kinds of duck susceptible virus, testing goal gene are respectively the stromatin of the antigen-4 fusion protein gene of NDV, AIV
The Envelope Protein Gene of gene, the Nucleocapsid Protein Gene of DHAV, DTMUV.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910301084.5A CN109825650A (en) | 2019-04-15 | 2019-04-15 | A kind of while four kinds of duck susceptible virus of detection multiple fluorescence quantitative PCR detection primers and probe combinations and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910301084.5A CN109825650A (en) | 2019-04-15 | 2019-04-15 | A kind of while four kinds of duck susceptible virus of detection multiple fluorescence quantitative PCR detection primers and probe combinations and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109825650A true CN109825650A (en) | 2019-05-31 |
Family
ID=66875117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910301084.5A Pending CN109825650A (en) | 2019-04-15 | 2019-04-15 | A kind of while four kinds of duck susceptible virus of detection multiple fluorescence quantitative PCR detection primers and probe combinations and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109825650A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112646895A (en) * | 2021-01-22 | 2021-04-13 | 深圳科诺医学检验实验室 | Primer, probe, kit, detection method and application for detecting gene expression level |
| CN113403428A (en) * | 2020-09-14 | 2021-09-17 | 广西大学 | Primer for detecting 1 type and 3 type duck hepatitis A virus and duck tembusu virus and application |
| CN113832260A (en) * | 2021-08-28 | 2021-12-24 | 江西省农业科学院畜牧兽医研究所 | Goose astrovirus, goose parvovirus and goose calicivirus multiplex nano PCR (polymerase chain reaction) detection primer pair, kit and application method |
| CN114214466A (en) * | 2022-02-09 | 2022-03-22 | 江西省农业科学院畜牧兽医研究所 | Novel goose astrovirus and duck tembusu virus multiplex fluorescence quantitative PCR detection primer probe set, kit and application |
| CN114438266A (en) * | 2022-04-11 | 2022-05-06 | 潍坊华卓生物科技有限公司 | Kit and method for detecting multiple common duck-origin viruses |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624716A (en) * | 2018-05-18 | 2018-10-09 | 南京农业大学 | Septuple PCR primer group and its detection method a kind of while that detect seven kinds of aquatic bird susceptible virus |
-
2019
- 2019-04-15 CN CN201910301084.5A patent/CN109825650A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624716A (en) * | 2018-05-18 | 2018-10-09 | 南京农业大学 | Septuple PCR primer group and its detection method a kind of while that detect seven kinds of aquatic bird susceptible virus |
Non-Patent Citations (3)
| Title |
|---|
| CHENG,A.等: "Duck hepatitis A virus 1 strain DY140903 VP1 gene, partial cds，GenBank: KX523282.1，711bp RNA linear", 《NCBI GENBANK》 * |
| LOMAKINA,N.F.等: "Influenza A virus (A/duck/Moscow/4652/2011(H4N6)) segment 7 matrix protein 2 (M2) and matrix protein 1 (M1) genes, complete cds，GenBank: KX518717.1，1028bp cRNA linear", 《NCBI GENBANK》 * |
| YUFANG,F.等: "Duck Tembusu virus strain WH2014 polyprotein gene, partial cds，GenBank: KY235382.1，1503bp ss-RNA linear", 《NCBI GENBANK》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113403428A (en) * | 2020-09-14 | 2021-09-17 | 广西大学 | Primer for detecting 1 type and 3 type duck hepatitis A virus and duck tembusu virus and application |
| CN112646895A (en) * | 2021-01-22 | 2021-04-13 | 深圳科诺医学检验实验室 | Primer, probe, kit, detection method and application for detecting gene expression level |
| CN113832260A (en) * | 2021-08-28 | 2021-12-24 | 江西省农业科学院畜牧兽医研究所 | Goose astrovirus, goose parvovirus and goose calicivirus multiplex nano PCR (polymerase chain reaction) detection primer pair, kit and application method |
| CN113832260B (en) * | 2021-08-28 | 2023-07-14 | 江西省农业科学院畜牧兽医研究所 | Multiplex nano PCR detection primer pair, kit and application method for goose astrovirus, goose parvovirus and goose embedded cup virus |
| CN114214466A (en) * | 2022-02-09 | 2022-03-22 | 江西省农业科学院畜牧兽医研究所 | Novel goose astrovirus and duck tembusu virus multiplex fluorescence quantitative PCR detection primer probe set, kit and application |
| CN114214466B (en) * | 2022-02-09 | 2022-07-22 | 江西省农业科学院畜牧兽医研究所 | Novel goose astrovirus and duck tembusu virus multiplex fluorescence quantitative PCR detection primer probe set, kit and application |
| CN114438266A (en) * | 2022-04-11 | 2022-05-06 | 潍坊华卓生物科技有限公司 | Kit and method for detecting multiple common duck-origin viruses |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109825650A (en) | A kind of while four kinds of duck susceptible virus of detection multiple fluorescence quantitative PCR detection primers and probe combinations and detection method | |
| CN104169439B (en) | The composition and method of respiratory pathogen are detected using nucleic acid probe and bead subgroup | |
| CN113278733B (en) | Primer and probe combination for detecting mutant strain of novel coronavirus | |
| CN114375341A (en) | Method and kit for detecting African swine fever virus | |
| CN103074334B (en) | Method for detecting CHO cell DNA | |
| CN107475459A (en) | Differentiate the detection method of american type PRRSV classical strainses, variation strain and new virus class NADC30 strains simultaneously | |
| CN105039586A (en) | Primer and kit for detecting duck type-II adenovirus | |
| CN115044710B (en) | Primer group and kit for detecting pangolin beta coronavirus and application of primer group and kit | |
| KR102007951B1 (en) | Primer and probe set for detection of type A avian influenza virus and the avian H5 and H7 subtype and uses thereof | |
| CN113913557B (en) | Kit for rapidly detecting Hantavirus SEOV-S4 subtype and detection method thereof | |
| CN104328222A (en) | Kit capable of detecting and parting dengue viruses by reverse transcription PCR and detection method of kit | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN113151590A (en) | Novel coronavirus 2019-nCoVORF1ab and N, E gene detection kit and preparation and detection methods thereof | |
| CN108624716A (en) | Septuple PCR primer group and its detection method a kind of while that detect seven kinds of aquatic bird susceptible virus | |
| CN110724767B (en) | Triple real-time fluorescent quantitative PCR (polymerase chain reaction) primer, probe and kit for detecting dengue fever, chikungunya and Zika viruses | |
| CN117025846A (en) | Primer group for detecting novel coronavirus by multiple ddPCR and application thereof | |
| CN113481325B (en) | Method and kit for detecting novel coronavirus B.1.1.7 mutant strain | |
| CN114807449A (en) | Prawn yellow head virus nucleic acid detection kit capable of avoiding false negative | |
| CN114196786A (en) | Poultry adenovirus type 4 and 8 dual fluorescent quantitative PCR rapid detection kit and method | |
| CN109234457A (en) | A kind of nano PCR method detecting Canine parvovirus infection | |
| CN107937610A (en) | For differentiating the triple real-time fluorescence PCR primers of highly pathogenic H7N9 influenza viruses and probe | |
| CN113462814A (en) | RPA primer, probe, kit and detection method for detecting sweet potato golden vein virus | |
| CN102634605A (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN113981140B (en) | Novel coronavirus delta mutant strain detection method and nucleic acid detection kit | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |