CN109811088B - Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit - Google Patents
Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit Download PDFInfo
- Publication number
- CN109811088B CN109811088B CN201811568475.5A CN201811568475A CN109811088B CN 109811088 B CN109811088 B CN 109811088B CN 201811568475 A CN201811568475 A CN 201811568475A CN 109811088 B CN109811088 B CN 109811088B
- Authority
- CN
- China
- Prior art keywords
- primer
- concentration
- claf
- fcv
- fhv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A primer for detecting upper respiratory infection pathogens of cats, a kit and application thereof are disclosed, which comprises three primer groups of an FHV primer group, an FCV primer group and a CLaF primer group, wherein each primer group consists of 6 primers of an F3 primer, a B3 primer, a FIP primer, a BIP primer, an LF primer and an LB primer, and the sequence is different according to the pathogens to which the primers are directed. The detection kit comprises three detection reagents of feline herpesvirus type I, feline calicivirus and feline chlamydia, and also comprises a negative control, a pretreatment solution A and a pretreatment solution B; the using method of the kit comprises the steps of dipping a diseased cat sample, placing the treated diseased cat sample into each detection reagent for reaction at a constant temperature of 65 ℃, and judging whether the detected cat sample is negative or positive according to color change after the reaction is finished. The invention is based on LAMP technology, specifically amplifies pathogen gene segments, can complete the sampling-detection process within 45-60min, and realizes high-precision detection results by using the most easily mastered operation mode.
Description
Technical Field
The invention belongs to the field of biology, and particularly relates to a primer and a kit for detecting upper respiratory infection pathogens of cats and application of the primer and the kit.
Background
At present, three modes of colloidal gold test paper, PCR (polymerase chain reaction) test and third-party detection service are mainly used for detecting the pet pathogens, and the colloidal gold test paper is the most commonly used technology. The colloidal gold test paper has the advantages of early technical development and simplest operation, so that the current market share is the highest, about 7 percent of the pathogen detection market, and represents that the company is the industry of giant lovely dess, forest medicine and the like. However, the technical precision is low, the positive compliance rate is only about 6, the precision can not meet the market demand gradually, and the detectable pathogen types are not complete, such as the most common pathogens of upper respiratory tract infection of cats, and the like, so the market share is reduced year by year.
The PCR test is started from the human medical market to the pet medical market in nearly two years, the greatest advantage is high precision, but the equipment cost is very high, the price of each instrument is more than 5 thousands, the operation is also very complex, and common pet doctors are difficult to operate. Moreover, the installation of the equipment needs to build an experimental space by itself, and the good ventilation of the experimental environment needs to be ensured, otherwise, false positive is easy to generate, and most pet hospitals do not have installation conditions. For the reasons, the popularization of the in-hospital detection of the existing PCR detection technology is not good, and only a few central hospitals of the leading enterprises of the chain pet hospitals are equipped.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a primer and a kit for detecting pathogens of upper respiratory tract infection of cats and application of the primer and the kit. The invention is based on LAMP technology, specifically amplifies pathogen gene segments, can complete the sampling-detection process within 45-60min, and realizes high-efficiency and high-precision detection results by using the most easily mastered operation mode, thereby achieving the purpose of accurate detection. Compared with the prior art, the method has the characteristics of high accuracy, convenience and quickness in operation, low cost, no dependence on operation environment and the like.
The primer for detecting the upper respiratory tract infection pathogens of the cats comprises three primer groups, namely an FHV primer group, an FCV primer group and a ClaF primer group, wherein each primer group consists of 6 primers, namely an F3 primer, a B3 primer, a FIP primer, a BIP primer, an LF primer and an LB primer, and the sequence is different due to the pathogens; the FHV primer group comprises an outer primer pair FHV-F3 and FHV-B3, an inner primer pair FHV-FIP and FHV-BIP, and a loop primer pair FHV-LF and FHV-LB; the FCV primer group comprises an outer primer pair FCV-F3 and FCV-B3, an inner primer pair FCV-FIP and FCV-BIP, and a loop primer pair FCV-LF and FCV-LB; the CLaF primer group comprises an outer primer pair CLaF-F3 and CLaF-B3, an inner primer pair CLaF-FIP and CLaF-BIP, and a loop primer pair CLaF-LF and CLaF-LB; the detailed sequence is shown below:
FHV-F3：TCCAGGACCGGAAACGAC
FHV-B3：acaaaatatcttgcgagtggga
FHV-FIP：gtgcggcaaatcttgcttgatagtGGTGAATTATCAGCTGAAGATGC
FHV-BIP：AAGTTGTATGTGAGGAACACCCCGagaccagagaggcgagag
FHV-LF：gggcggtgatataggca
FHV-LB：GTGACCCTAATCATAGATAG
FCV-F3：GATGAACTACCCGCCAATC
FCV-B3：cagtgtctcagcatagcagg
FCV-FIP：gataggtgacggcgaagagcACATGTGGTAACCGTTAACTC
FCV-BIP：CTGGGCAGTTTCAGGCCAattttgtcggggacagttagc
FCV-LF：caggccaaatcaaacac
FCV-LB：TCAGAGCCGCATATGATGT
ClaF-F3：TTTATCCTTGCGAAGGCG
ClaF-B3：cgcaatcttttttacctactgc
ClaF-FIP：acgaacactatacattttgccgtagGTCAATGCCAATCATCCG
ClaF-BIP：ATTGTAACGTTGAAATTAGCCAAGCaatttcaataggataaggagatcc
ClaF-LF：caagattcttgtctagtgtc
ClaF-LB：TGTACCTGAATATGCAACAG
the invention also provides a kit for detecting pathogens of upper respiratory tract infection of cats, which comprises the three primer groups.
The kit for detecting the pathogens of the upper respiratory tract infection of the cat comprises three detection reagents of a feline herpesvirus I, a feline calicivirus and a feline chlamydia, wherein each reagent consists of two parts, the first part is a universal RM part, and the three reagents of the part have the same components and consist of the following components: bst enzyme, hydroxynaphthol blue with the concentration of 37.5uM, mgSO4 with the concentration of 100mM, 10xBst buffer, deionized water, dNTP with the concentration of 10mM and betaine with the concentration of 5M; the second part is a specific type of PM part, and the PM parts of the three reagents are respectively composed of the aqueous solutions of the corresponding primer sets described above.
Preferably, the kit for detecting pathogens infecting the upper respiratory tract of cats has the RM part in each reagent with the volume of 17 microliters, and comprises the following components:
1 microliter of Bst enzyme
1 microliter of hydroxynaphthol blue at a concentration of 37.5. Mu.M
2 microliter MgSO4 at a concentration of 100mM
2.5 microliter 10xBst buffer
3 microliter of deionized water
3.5 microliters of dNTP with a concentration of 10mM
4 microliters of betaine at a concentration of 5M;
the concentration of the aqueous solution of each primer in the specific PM part is 20 μ M, and the volume of the PM part of each reagent is 7 microliters, which is as follows:
PM portion of the detection reagent for feline herpesvirus type I:
0.5 microliter of FHV-F3 primer with the concentration of 20 MuM, 0.5 microliter of FHV-B3 primer with the concentration of 20 MuM, 2 microliter of FHV-FIP primer with the concentration of 20 MuM, 2 microliter of FHV-BIP primer with the concentration of 20 MuM, 1 microliter of FHV-LF primer with the concentration of 20 MuM, and 1 microliter of FHV-LB primer with the concentration of 20 MuM;
PM portion of detection reagent for feline calicivirus:
0.5 microliter of FCV-F3 primer with concentration of 20 MuM, 0.5 microliter of FCV-B3 primer with concentration of 20 MuM, 2 microliter of FCV-FIP primer with concentration of 20 MuM, 2 microliter of FCV-BIP primer with concentration of 20 MuM, 1 microliter of FCV-LF primer with concentration of 20 MuM, and 1 microliter of FCV-LB primer with concentration of 20 MuM;
PM portion of detection reagent for chlamydia felis:
0.5. Mu.l of ClaF-F3 primer at a concentration of 20. Mu.M, 0.5. Mu.l of ClaF-B3 primer at a concentration of 20. Mu.M, 2. Mu.l of ClaF-FIP primer at a concentration of 20. Mu.M, 2. Mu.l of ClaF-BIP primer at a concentration of 20. Mu.M, 1. Mu.l of ClaF-LF primer at a concentration of 20. Mu.M, and 1. Mu.l of ClaF-LB primer at a concentration of 20. Mu.M.
The kit for detecting the upper respiratory tract infection pathogens of the cats further comprises a negative control, a pretreatment solution A and a pretreatment solution B; the negative controls each had a volume of 25 microliters and consisted of the following components: 3.5 microliters of dNTP at a concentration of 10mM, 4 microliters of betaine at a concentration of 5M, 1 microliter of hydroxynaphthol blue at a concentration of 37.5. Mu.M, 2 microliters of MgSO4 at a concentration of 100mM, 2.5 microliters of 10xBst buffer,12 microliters of deionized water;
the pretreatment solution A comprises: the effective component is Triton X-100 lysate accounting for 1% and 200 microliter per cell;
the pretreatment liquid B is diluent, the components of the pretreatment liquid B are pure deionized water, and the volume of each pretreatment liquid B is 200 microliters.
Preferably, the kit for detecting pathogens of upper respiratory tract infection of cats comprises the following components:
3 cat herpes virus I-type detection reagents,
3 cat calicivirus detection reagents are adopted,
3 cat chlamydia detection reagents, namely 3 cat chlamydia detection reagents,
the number of negative controls is 3,
3 pieces of the pretreatment liquid A are pretreated,
and 3 branches of pretreatment liquid B.
The invention also provides application of the kit in detection of pathogens causing upper respiratory tract infection of cats, and a using method of the kit comprises the following steps:
(1) Dipping a sterile cotton swab in a sample of the diseased cat by first taking eye and nose secretions, such as no available saliva;
(2) Immersing the diseased cat sample into the pretreatment solution A, cracking, slightly shaking and uniformly mixing for 30 seconds;
(3) Sucking out 5 microliters of the liquid after cracking and mixing uniformly, transferring the liquid into a pretreatment liquid B, and diluting;
(4) Respectively sucking 1 microliter of diluted sample, adding the diluted sample into 3 detection reagents, slightly shaking and uniformly mixing, putting the mixture into constant temperature equipment, and reacting at the temperature of 65 ℃.
(5) And after the reaction is finished, observing the color change of the reagent, and comparing with a negative control to judge whether the reaction is negative or positive.
The detection of upper respiratory tract infectious pathogens in cats according to the invention is used for non-diagnostic purposes.
Advantageous effects
The method is based on LAMP technology, specifically amplifies pathogen gene segments, completes the sampling-detection process of several common pathogens of cat upper respiratory tract infection within 45-60min, and realizes high-efficiency and high-precision detection results by using the most easily mastered operation mode, thereby achieving the purpose of accurate detection, and can detect in time at the latent period of the infected pathogens and increase the cure rate of sick individuals. Compared with the prior art, the method has the characteristics of high precision, convenience in operation, low cost, complete product types, high specificity, high sensitivity, simplicity and convenience in operation, good repeatability, easiness in judgment of results and the like. In addition, the primer set provided by the invention has extremely high specificity, so that the DNA of a sample is not required to be extracted and amplified directly in LAMP amplification, the detection time is further shortened, and the operation is simplified. Can replace the laggard colloidal gold test paper and become a new standard of the industry.
Drawings
FIG. 1 shows the establishment of the detection method of the present invention
The arrangement sequence of the reagents is as follows from left to right: FHV negative, FHV positive, FCV negative, FCV positive, claF negative, claF positive.
FIG. 2 shows the results of the method of the present invention for detecting a sample 8
Wherein the arrangement sequence of the reagents is as follows: the left 1 is negative control, and the left 2-4 are reagents for detecting FHV, FCV and ClaF respectively.
FIG. 3 is a diagram showing FHV detection results of samples with different dilution ratios detected by using the kit of the present invention
The test stock solution, the diluted 10-fold sample, the diluted 100-fold sample, the diluted 1000-fold sample and the negative control are sequentially arranged from left to right.
FIG. 4 is a diagram showing the FCV detection result of samples with different dilution ratios detected by the kit of the present invention
The order of sample arrangement is the same as in FIG. 3.
FIG. 5 is a ClaF detection result chart of samples with different dilution ratios detected by the kit of the invention
The order of sample arrangement is the same as in FIG. 3.
FIG. 6 is a diagram of the result of FHV detection electrophoresis in which samples of different dilution ratios are detected by PCR
The first left column is a 100bp DNA marker (all gold), and the five other lanes are, from left to right: 1-test stock, 2-10 times diluted sample, 3-100 times diluted sample, 4-1000 times diluted sample, 5-negative control.
FIG. 7 is a diagram of the result of FCV detection electrophoresis in the PCR method for detecting samples with different dilution ratios
The lane arrangement of the sample is the same as that of FIG. 6.
FIG. 8 is a ClaF detection electrophoresis result chart of samples with different dilution ratios detected by the PCR method
The order of lanes of the sample is the same as that of FIG. 6.
Detailed Description
The present invention will be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments of the invention are shown to illustrate how the invention may be practiced, and which will make apparent and understood by those skilled in the art. While this invention is susceptible of embodiment in many different forms, there is shown in the drawings and will herein be described in detail, specific embodiments with the understanding that the present disclosure is to be considered as an exemplification and is not intended to limit the invention to that as illustrated and described herein.
The experimental procedures in the following examples are conventional unless otherwise specified.
The raw materials, reagents and the like used in the following examples are commercially available or disclosed unless otherwise specified.
1 materials and methods
1.1 pathogens
The pathogen sample of the present invention is not specifically described, but is derived from a living sample of a pet hospital.
1.2 Primary reagents
Deionized water was purchased from Tiangen Biochemical technology, inc.;
bst enzyme, 10xBst buffer, mgSO4, dNTP from NEB;
betaine was purchased from Beijing Tianenzze Gene science and technology, inc.;
hydroxynaphthol blue was purchased from Dubestt reagent, inc.;
the primers were purchased from Suzhou Hongxn science and technology Co., ltd;
centrifuge tubes were purchased from Axygen corporation.
1.3 primer design
Firstly, searching a TK gene sequence of a feline herpes virus type 1 (FHV-1), an ORF2 sequence of a Feline Calicivirus (FCV) and an omp2 gene sequence of a feline chlamydia (ClaF) in a Genbank database, and performing sequence alignment by ClustalX software; then, LAMP Primer design is carried out on the specific conserved sequences respectively through LAMP Primer Explorer software (version 5.0), manual selection and correction are carried out according to professional experience, and then the Primer group disclosed by the invention is screened out from the synthesized Primer combination according to multiple experimental tests.
Example 1 preparation of primers for detecting pathogens causing upper respiratory tract infections in cats
The primer for detecting the upper respiratory tract infection pathogens of the cats comprises three primer groups, namely an FHV primer group, an FCV primer group and a ClaF primer group, wherein each primer group consists of 6 primers, namely an F3 primer, a B3 primer, an FIP primer, a BIP primer, an LF primer and an LB primer, and the sequence of the primers is different according to the pathogens to which the primers are directed; the FHV primer group comprises an outer primer pair FHV-F3 and FHV-B3, an inner primer pair FHV-FIP and FHV-BIP, and a loop primer pair FHV-LF and FHV-LB; the FCV primer group comprises an outer primer pair FCV-F3 and FCV-B3, an inner primer pair FCV-FIP and FCV-BIP, and a loop primer pair FCV-LF and FCV-LB; the CLaF primer group comprises an outer primer pair CLaF-F3 and CLaF-B3, an inner primer pair CLaF-FIP and CLaF-BIP, and a loop primer pair CLaF-LF and CLaF-LB; the detailed sequence is shown below:
FHV-F3：TCCAGGACCGGAAACGAC
FHV-B3：acaaaatatcttgcgagtggga
FHV-FIP：gtgcggcaaatcttgcttgatagtGGTGAATTATCAGCTGAAGATGC
FHV-BIP：AAGTTGTATGTGAGGAACACCCCGagaccagagaggcgagag
FHV-LF：gggcggtgatataggca
FHV-LB：GTGACCCTAATCATAGATAG
FCV-F3：GATGAACTACCCGCCAATC
FCV-B3：cagtgtctcagcatagcagg
FCV-FIP：gataggtgacggcgaagagcACATGTGGTAACCGTTAACTC
FCV-BIP：CTGGGCAGTTTCAGGCCAattttgtcggggacagttagc
FCV-LF：caggccaaatcaaacac
FCV-LB：TCAGAGCCGCATATGATGT
ClaF-F3：TTTATCCTTGCGAAGGCG
ClaF-B3：cgcaatcttttttacctactgc
ClaF-FIP：acgaacactatacattttgccgtagGTCAATGCCAATCATCCG
ClaF-BIP：ATTGTAACGTTGAAATTAGCCAAGCaatttcaataggataaggagatcc
ClaF-LF：caagattcttgtctagtgtc
ClaF-LB：TGTACCTGAATATGCAACAG
example 2 detection of sample to be tested Using kit for detection of pathogens of Upper respiratory infection in Cat
1. Preparation of detection kit
The kit for detecting the pathogen infecting the upper respiratory tract of the cat comprises three detection reagents of cat herpes disease type I, cat calicivirus and cat chlamydia, wherein each reagent consists of two parts, the first part is a universal RM part, and the three reagents of the part have the same components and consist of the following raw materials:
1 microliter of Bst enzyme
1 microlitre hydroxynaphthol blue (37.5. Mu.M)
2 microliter MgSO4 (100 mM)
2.5 microliter 10xBst buffer
3 microliter of deionized water
3.5 microliter dNTP (10 mM)
4 microliters of betaine (5M); totaling 17 microliters.
The second part is a special-shaped PM part which is an aqueous solution of each primer, the concentration of the aqueous solution is 20 mu M, the volume of the PM part in each reagent is 7 microliter, and the specific content is as follows:
PM portion of the detection reagent for feline herpesvirus type I:
0.5. Mu.l FHV-F3 primer (20. Mu.M), 0.5. Mu.l FHV-B3 primer (20. Mu.M),
2 microliter FHV-FIP primer (20. Mu.M), 2 microliter FHV-BIP primer (20. Mu.M),
1 microliter FHV-LF primer (20. Mu.M), 1 microliter FHV-LB primer (20. Mu.M);
PM portion of detection reagent for feline calicivirus:
0.5. Mu.l of FCV-F3 primer (20. Mu.M), 0.5. Mu.l of FCV-B3 primer (20. Mu.M),
2 microliters of FCV-FIP primer (20. Mu.M), 2 microliters of FCV-BIP primer (20. Mu.M),
1 microliter FCV-LF primer (20. Mu.M), 1 microliter FCV-LB primer (20. Mu.M);
PM portion of detection reagent for chlamydia felis:
0.5. Mu.l of ClaF-F3 primer (20. Mu.M), 0.5. Mu.l of ClaF-B3 primer (20. Mu.M),
2. Mu.l of a ClaF-FIP primer (20. Mu.M), 2. Mu.l of a ClaF-BIP primer (20. Mu.M),
1 uL of ClaF-LF primer (20. Mu.M), and 1 uL of ClaF-LB primer (20. Mu.M).
The kit of this example also included a negative control and pretreatment solution a and pretreatment solution B. The negative controls each had a volume of 25 microliters and consisted of the following components: 3.5 microliters of dNTP (10 mM), 4 microliters of betaine (5M), 1 microliter of hydroxynaphthol blue (37.5. Mu.M), 2 microliters of MgSO4 (100 mM), 2.5 microliters of 10xBst buffer,12 microliters of deionized water;
in this embodiment, the pretreatment solution a is: triton X-100 lysate with 1% of effective component for lysing tissue cells and releasing pathogens; the volume of each tube is 200 microliter;
the pretreatment liquid B is diluent, the components of the pretreatment liquid B are pure deionized water, and the volume of the pretreatment liquid B is 200 microliters per bag.
The kit of this example comprises the following components:
3 cat herpes virus type I detection reagents,
3 cat calicivirus detection reagents are adopted,
3 cat chlamydia detection reagents, namely,
the number of negative controls is 3,
3 pieces of the pretreatment liquid A are pretreated,
the number of the pretreatment liquid B is 3,
the preparation method of the kit described in this embodiment comprises the following steps:
preparation of three detection reagents:
(1) A general RM part is prepared, the preparation method and raw materials of the three reagents of the part are the same, and the preparation steps are as follows:
taking a 0.5ml centrifuge tube, and adding the following reagents in sequence by using a micropipette:
2.5 microliter 10xBst buffer
3 microliter of deionized water
4 microliter betaine
3.5 microliter dNTP (10 mM)
2 microliter MgSO4 (100 mM)
1 microlitre hydroxynaphthol blue (37.5. Mu.M)
1 microliter of Bst enzyme
A total of 17 microliters was gently mixed to obtain RM fractions.
(2) The PM portion of the three detection reagents was then prepared:
PM portion of the detection reagent for feline herpesvirus type I:
0.5. Mu.l FHV-F3 primer (20. Mu.M), 0.5. Mu.l FHV-B3 primer (20. Mu.M),
2 microliter FHV-FIP primer (20. Mu.M), 2 microliter FHV-BIP primer (20. Mu.M),
1 microliter FHV-LF primer (20. Mu.M), 1 microliter FHV-LB primer (20. Mu.M);
PM portion of detection reagent for feline calicivirus:
0.5. Mu.l of FCV-F3 primer (20. Mu.M), 0.5. Mu.l of FCV-B3 primer (20. Mu.M),
2. Mu.l of FCV-FIP primer (20. Mu.M), 2. Mu.l of FCV-BIP primer (20. Mu.M),
1 microliter FCV-LF primer (20. Mu.M), 1 microliter FCV-LB primer (20. Mu.M);
PM portion of detection reagent for chlamydia felis:
0.5. Mu.l of ClaF-F3 primer (20. Mu.M), 0.5. Mu.l of ClaF-B3 primer (20. Mu.M),
2. Mu.l of a ClaF-FIP primer (20. Mu.M), 2. Mu.l of a ClaF-BIP primer (20. Mu.M),
1 microliter of ClaF-LF primer (20. Mu.M), 1 microliter of ClaF-LB primer (20. Mu.M).
(3) Respectively adding PM parts of the three reagents into the RM part prepared in the step (1), and then uniformly mixing. Namely: adding a PM part of a feline herpesvirus I detection reagent into 17 microliter of a universal RM part to obtain the feline herpesvirus I detection reagent; adding a PM part of a feline calicivirus detection reagent into 17 microliter of a universal RM part to obtain the feline calicivirus detection reagent; the PM portion of the detection reagent for feline Chlamydia was added to 17. Mu.l of the universal RM portion to obtain a detection reagent for feline calicivirus.
(II) preparation of negative control solution:
sequentially adding 3.5 microliters of dNTP (10 mM), 4 microliters of betaine (5M), 1 microliter of hydroxynaphthol blue (37.5. Mu.M), 2 microliters of MgSO4 (100 mM), 2.5 microliters of 10xBst buffer and 12 microliters of deionized water, and uniformly mixing to obtain the compound.
The kit of the embodiment is used for detecting pathogens of upper respiratory tract infection of cats, and the detection method comprises the following steps:
(1) Dipping a sterile cotton swab in a sample of the diseased cat by taking eye and nose secretions of the diseased cat, such as no available saliva;
(2) Soaking the cat sample into the pretreatment solution A for cracking, and gently shaking and uniformly mixing for 30 seconds;
(3) Sucking out 5 microliters of the liquid after cracking and mixing uniformly, transferring the liquid into a pretreatment liquid B, and diluting;
(4) Respectively sucking 1 microliter of diluted samples, adding the diluted samples into 3 detection reagents, tightly covering tube covers of centrifugal tubes containing the reagents, slightly shaking and uniformly mixing the samples, putting the mixed samples into constant temperature equipment, and reacting at the temperature of 65 ℃ for 45-60 minutes.
(5) After the reaction is finished, the color change of the three detection reagents is respectively observed, and the negative and positive are judged by comparing with the negative control. If blue is present, it is positive, and if similar to the negative control, it is negative for purple.
The final display of the detection method of this example for three different pathogens is shown in figure 1.
Example 3 accuracy test
The cat suffering from the upper respiratory tract infection can simultaneously carry three types of the feline herpesvirus type I, the feline calicivirus and the feline chlamydia, and can also carry any two or one of the three types of the feline herpesvirus type I, the feline calicivirus and the feline chlamydia. Taking a healthy cat as a sample 1 to be tested, and setting samples 2-8 to be tested according to different conditions of determined pathogens carried by the sick cat, wherein the detailed conditions are shown in a table 1:
TABLE 1
Note: "-" represents "none" and "+" represents "presence".
Each group of samples to be detected is detected by the detection method of embodiment 2, and the detection result is observed after the detection is completed, as shown in fig. 2, which is the detection result of the sample to be detected 8, the arrangement sequence of the reagents in fig. 2 is: the left 1 is negative control, and the left 2-4 are reagents for detecting FHV, FCV and ClaF respectively. As can be seen from FIG. 2, the negative control at left 1 is purple, and the reagents for FHV, FCV and ClaF detection at left 2-left 4 are all blue, so that the detection results of FHV, FCV and ClaF of the sample 8 to be detected in this embodiment are all positive, and the results are compared with the information provided in Table 1, and the detection results are correct.
The test results of each sample to be tested were summarized as shown in table 2 below:
TABLE 2
| Negative control | FHV detection reagent | FCV detection reagent | ClaF | |
| Sample | ||||
| 1 to be tested | Purple color | Purple color | Purple color | |
| Sample | ||||
| 2 to be tested | Purple color | Blue color | Purple color | Purple color |
| Sample to be tested 3 | Purple color | Purple color | Blue color | Purple color |
| Sample to be tested 4 | Purple color | Purple color | Purple color | Blue color |
| Sample to be tested 5 | Purple color | Blue color | Blue colour | Purple color |
| Sample to be tested 6 | Purple color | Blue color | Purple color | Blue color |
| Sample 7 to be tested | Purple color | Purple color | Blue color | Blue color |
| Sample to be tested 8 | Purple color | Blue color | Blue color | Blue colour |
Comparing the test results in Table 2 with the corresponding contents in Table 1, it can be seen that the test results of each sample to be tested using the kit of the present invention are all correct. The primers and the kit provided by the invention can accurately distinguish the corresponding viruses, and the detection result is good in accuracy. And each group of detection samples are respectively subjected to 10 repeated detections, and each detection result of each group is the same, so that the accuracy and the repeatability are good.
Detection application:
testing of 48 cats suffering from upper respiratory tract infection pathogens in a companion pet hospital, 20 of which were FHV +, FCV-, and ClaF-;17 examples FHV-, FCV +, claF-;5 cases FHV +, FCV +, claF-;3 example FHV +, FCV +, claF-;2 example FHV-, FCV-, claF-; the verification proves that the detection results of 1 case of FHV-, FCV-, claF + are all correct.
Example 4 specificity test
Referring to the detection method of embodiment 2 of the invention, the samples to be detected are respectively changed into the domestic seven-conjugate attenuated freeze-dried vaccine and the feline coronavirus samples (hospital living samples) of the far east Changchun, the feline pestivirus samples (hospital living samples) are detected, 3 times of repetition are set for each group, and the detection results show that: all showed purple color, and no positive reaction was observed. The detection primers and the detection method have good specificity.
Example 5 sensitivity test
A diseased cat sample is collected and is FHV +, FCV + and ClaF + three positive, and the method is respectively used for comparing with PCR and electrophoresis running glue detection. The experimental procedure was as follows:
firstly, preparing testing stock solution
(1) 200 microliters of the diseased cat sample was taken, and a nucleic acid extract (including DNA and RNA) of the sample was obtained by using EasyPure Viral DNA/RNA Kit (Kyoto Seikagaku Co., ltd.) according to the instructions thereof. (http:// www.transgen.com.cn/atteched/down/ER 201-01 \u2017050515. Pdf);
(2) Taking 10 microliter of sample nucleic acid extract, carrying out reverse transcription to obtain a sample nucleic acid reverse transcription product, namely the test stock solution. The reverse transcription was performed using a reverse transcription kit from Thermo Fisher Scientific, according to the protocol. The reference website is: (https:// www.thermofisher.com/cn/zh/home/life-science/pcr/reverse-t description/rt-pcr. Html).
The test stock solution is diluted by 10, 100 and 1000 times in a gradient way respectively, and then relevant tests are carried out.
Secondly, the test stock solution prepared in the first step and each liquid after gradient dilution are respectively detected by the kit, and the steps of each sample during test are as follows: and (2) directly and respectively adding each sample to be detected into 3 detection reagents in the kit, wherein the amount of each reagent added into each sample to be detected is 1 microliter, covering a tube cover of a centrifugal tube for tightly holding the reagents, slightly shaking and uniformly mixing, putting the sample to be detected into constant temperature equipment, and reacting at the temperature of 65 ℃ for 50 minutes. After the reaction is finished, the color change of the three detection reagents is respectively observed, and the negative and positive are judged by comparing with the negative control. The results of the measurements for each sample are summarized in table 3 below:
TABLE 3
| Sample stock solution | Diluting by 10 times | Diluting by 100 times | Diluting 1000 times | Negative control | |
| FHV detection reagent | Blue colour | Blue color | Blue color | Purple color | Purple color |
| FCV detection reagent | Blue color | Blue color | Blue color | Purple color | Purple color |
| ClaF detection reagent | Blue color | Blue color | Blue color | Purple color | Purple color |
As can be seen from Table 3, in the detection method of the present invention, the lowest detection concentrations of the three reagents were diluted 100 times.
FIG. 3 is a graph showing the FHV detection results of samples with different dilution ratios by the method of the present invention. The test stock solution, the diluted 10-fold sample, the diluted 100-fold sample, the diluted 1000-fold sample and the negative control are sequentially arranged from left to right. The results of the FCV and ClaF assays are shown in FIGS. 4 and 5.
Respectively carrying out PCR detection on the test stock solution and each liquid after gradient dilution, and operating according to an operation instruction by using a taq-PCR kit of Tiangen biochemical company, wherein the operation instruction is specifically shown as the following website: (http:// www.tiangen.com/asset/assay/application load/0718751001543655183. Pdf);) the addition of the sample to be detected is 1 microliter in each test, when the method is used for detecting the three pathogens, two primers are respectively adopted for each pathogen detection, the primers are standard and commonly used upstream and downstream primers, the concentration of each primer is 10 muM, and the use amount is 1 microliter.
(1) Wherein when FHV is detected, the primers used are as follows:
| FHV-F | TGCCGCACCATACCTTCT |
| FHV-B | tcgtggaagtgttgccatt |
the PCR product obtained by the PCR reaction is about 200bp in length, after the reaction is finished, the PCR product is electrophoresed by 2 percent agarose gel (added gel red, see http:// www.bosunlife.com/product/sp _ prod/gelRed _ gelGreen. Asp), electrophoresed for 20 minutes at 100v, and the picture is taken under ultraviolet light.
The test stock solution and the liquid with different dilution ratios are respectively detected, and the result is shown in figure 6.
(2) In addition, FCV and ClaF pathogens of each sample to be detected are detected respectively, and PCR detection methods and steps of the two pathogens are the same as those of FHV except for the difference of the primers. Wherein when detecting FCV, the primers used are:
| FCV-F | ATGGTGAATTCTGTTGCTTTCG |
| FCV-B | tgagtttcagtggaggttgtg |
(3) In the detection of ClaF, the primers used were:
| ClaF-F | ACAGATCAAATTTTGCCTACG |
| ClaF-B | gctctacaatgccttgagaa |
after the detection is completed, the electrophoresis result of the FCV detection is shown in FIG. 7, and the electrophoresis result of the ClaF detection is shown in FIG. 8.
As can be seen from FIGS. 6 to 8, the lowest detectable concentrations of the three reagents of the PCR method are 10-fold dilutions, while the lowest detectable concentrations of the three reagents of the method of the present invention are 100-fold dilutions, as can be seen from the above: the lowest detection concentration of the detection method of the present invention is 1/10 of that of PCR.
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Guangzhou Baka Biotechnology Ltd
<120> primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tccaggaccg gaaacgac 18
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acaaaatatc ttgcgagtgg ga 22
<210> 3
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtgcggcaaa tcttgcttga tagtggtgaa ttatcagctg aagatgc 47
<210> 4
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aagttgtatg tgaggaacac cccgagacca gagaggcgag ag 42
<210> 5
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gggcggtgat ataggca 17
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtgaccctaa tcatagatag 20
<210> 7
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gatgaactac ccgccaatc 19
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
cagtgtctca gcatagcagg 20
<210> 9
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gataggtgac ggcgaagagc acatgtggta accgttaact c 41
<210> 10
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ctgggcagtt tcaggccaat tttgtcgggg acagttagc 39
<210> 11
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
caggccaaat caaacac 17
<210> 12
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tcagagccgc atatgatgt 19
<210> 13
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tttatccttg cgaaggcg 18
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cgcaatcttt tttacctact gc 22
<210> 15
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
acgaacacta tacattttgc cgtaggtcaa tgccaatcat ccg 43
<210> 16
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
attgtaacgt tgaaattagc caagcaattt caataggata aggagatcc 49
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
caagattctt gtctagtgtc 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tgtacctgaa tatgcaacag 20
<210> 19
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
tgccgcacca taccttct 18
<210> 20
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tcgtggaagt gttgccatt 19
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
atggtgaatt ctgttgcttt cg 22
<210> 22
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
tgagtttcag tggaggttgt g 21
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
acagatcaaa ttttgcctac g 21
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gctctacaat gccttgagaa 20
Claims (4)
1. A kit for detecting pathogens of upper respiratory tract infection of cats is characterized by comprising three primer groups, namely an FHV primer group, an FCV primer group and a CLaF primer group, wherein each primer group consists of 6 primers, namely an F3 primer, a B3 primer, a FIP primer, a BIP primer, an LF primer and an LB primer, and the sequence of the primers is different according to the pathogens to which the primers are directed; the FHV primer group comprises an outer primer pair FHV-F3 and FHV-B3, an inner primer pair FHV-FIP and FHV-BIP, and a loop primer pair FHV-LF and FHV-LB; the FCV primer group comprises an outer primer pair FCV-F3 and FCV-B3, an inner primer pair FCV-FIP and FCV-BIP, and a loop primer pair FCV-LF and FCV-LB; the CLaF primer group comprises an outer primer pair CLaF-F3 and CLaF-B3, an inner primer pair CLaF-FIP and CLaF-BIP, and a loop primer pair CLaF-LF and CLaF-LB; the sequence is shown as follows:
FHV-F3：TCCAGGACCGGAAACGAC
FHV-B3：acaaaatatcttgcgagtggga
FHV-FIP：gtgcggcaaatcttgcttgatagtGGTGAATTATCAGCTGAAGATGC
FHV-BIP：AAGTTGTATGTGAGGAACACCCCGagaccagagaggcgagag
FHV-LF：gggcggtgatataggca
FHV-LB：GTGACCCTAATCATAGATAG
FCV-F3：GATGAACTACCCGCCAATC
FCV-B3：cagtgtctcagcatagcagg
FCV-FIP：gataggtgacggcgaagagcACATGTGGTAACCGTTAACTC
FCV-BIP：CTGGGCAGTTTCAGGCCAattttgtcggggacagttagc
FCV-LF：caggccaaatcaaacac
FCV-LB：TCAGAGCCGCATATGATGT
ClaF-F3：TTTATCCTTGCGAAGGCG
ClaF-B3：cgcaatcttttttacctactgc
ClaF-FIP：acgaacactatacattttgccgtagGTCAATGCCAATCATCCG
ClaF-BIP：ATTGTAACGTTGAAATTAGCCAAGCaatttcaataggataaggagatcc
ClaF-LF：caagattcttgtctagtgtc
ClaF-LB：TGTACCTGAATATGCAACAG
the kit comprises three detection reagents of herpesvirus cat I, feline calicivirus and chlamydia catEach reagent is composed of two parts, the first part is a general RM part, and the three reagents of the part have the same components and are composed of the following components: bst enzyme, hydroxynaphthol blue at 37.5. Mu.M, mgSO 100mM 4 10XBst buffer, deionized water, dNTP with the concentration of 10mM and betaine with the concentration of 5M; the second part is a specific PM part, and the PM parts of the three reagents respectively consist of aqueous solutions of primer sets for detecting the three pathogens.
2. A kit for detecting a pathogen of upper respiratory tract infection in a cat according to claim 1 wherein the RM moiety in each reagent has a volume of 17 μ l and consists of:
1 microliter of Bst enzyme
1 microliter of hydroxynaphthol blue at a concentration of 37.5. Mu.M
2 microliter of 100mM MgSO 4
2.5 microliter 10XBst buffer
3 microliter of deionized water
3.5 microliters of dNTP with a concentration of 10mM
4 microliters of betaine at a concentration of 5M;
the concentration of the aqueous solution of each primer in the specific PM part is 20 μ M, and the volume of the PM part of each reagent is 7 μ l, which is as follows:
PM portion of the detection reagent for feline herpesvirus type I:
0.5 microliter FHV-F3 primer with the concentration of 20 MuM, 0.5 microliter FHV-B3 primer with the concentration of 20 MuM,
2 microliter of FHV-FIP primer with the concentration of 20 MuM, 2 microliter of FHV-BIP primer with the concentration of 20 MuM,
FHV-LF primer 1 microliter with concentration of 20 MuM, FHV-LB primer 1 microliter with concentration of 20 MuM;
PM portion of detection reagent for feline calicivirus:
0.5. Mu.l of FCV-F3 primer at a concentration of 20. Mu.M, 0.5. Mu.l of FCV-B3 primer at a concentration of 20. Mu.M,
2. Mu.l of FCV-FIP primer at a concentration of 20. Mu.M, 2. Mu.l of FCV-BIP primer at a concentration of 20. Mu.M,
1 microliter of FCV-LF primer with the concentration of 20 MuM and 1 microliter of FCV-LB primer with the concentration of 20 MuM;
PM portion of detection reagent for chlamydia felis:
0.5. Mu.l of ClaF-F3 primer at a concentration of 20. Mu.M, 0.5. Mu.l of ClaF-B3 primer at a concentration of 20. Mu.M,
2. Mu.l of ClaF-FIP primer at a concentration of 20. Mu.M, 2. Mu.l of ClaF-BIP primer at a concentration of 20. Mu.M,
1. Mu.l of ClaF-LF primer at a concentration of 20. Mu.M and 1. Mu.l of ClaF-LB primer at a concentration of 20. Mu.M.
3. The kit for detecting pathogens causing upper respiratory tract infection in cats according to claim 2, wherein the kit further comprises a negative control and pretreatment solution a and a pretreatment solution B; the negative control had a volume of 25 microliters per arm and consisted of the following components: 3.5 microliters of dNTP at a concentration of 10mM, 4 microliters of betaine at a concentration of 5M, 1 microliter of hydroxynaphthol blue at a concentration of 37.5. Mu.M, 2 microliters of MgSO 5 at a concentration of 100mM 4 2.5 microliters of 10 × Bst buffer,12 microliters of deionized water;
the pretreatment liquid A comprises: the effective component is 1 percent Triton X-100 lysate, and the volume of each lysate is 200 microliters;
the pretreatment liquid B is diluent, the components of the pretreatment liquid B are pure deionized water, and the volume of the pretreatment liquid B is 200 microliters per bag.
4. The kit for detecting the upper respiratory tract infection pathogens of cats according to claim 3, characterized in that the kit comprises three detection reagents, a negative control, a pretreatment solution A and a pretreatment solution B, and specifically comprises:
3 cat herpes virus type I detection reagents,
3 cat calicivirus detection reagents are adopted,
3 cat chlamydia detection reagents, namely,
the number of negative controls is 3,
the pretreatment liquid A is divided into 3 branches,
and 3, pretreating the solution B.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811568475.5A CN109811088B (en) | 2018-12-21 | 2018-12-21 | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811568475.5A CN109811088B (en) | 2018-12-21 | 2018-12-21 | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109811088A CN109811088A (en) | 2019-05-28 |
| CN109811088B true CN109811088B (en) | 2022-10-04 |
Family
ID=66601809
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811568475.5A Active CN109811088B (en) | 2018-12-21 | 2018-12-21 | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109811088B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564895A (en) * | 2019-09-11 | 2019-12-13 | 南宁众册生物科技有限公司 | RAA constant-temperature fluorescence detection primer probe set, kit and method for feline herpesvirus FHV-1 |
| CN110643744B (en) * | 2019-11-19 | 2022-10-21 | 南京农业大学 | Quantitative detection method for simultaneously detecting three cat susceptible viruses and primer probe combination thereof |
| CN113388700B (en) * | 2021-06-29 | 2023-11-10 | 苏州艾可瑞动物检测技术服务有限公司 | Kit for detecting FCV, FPV and FHV-1 virus by using nucleic acid to take triple fluorescence RT-LAMP in hands-free mode |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0535740A1 (en) * | 1991-09-30 | 1993-04-07 | Akzo Nobel N.V. | Respiratory disease vaccine for cats |
| CN103517991A (en) * | 2010-10-27 | 2014-01-15 | 昆特拜克股份公司 | Capture of target DNA and RNA by probes comprising intercalator molecules |
| WO2017109045A1 (en) * | 2015-12-23 | 2017-06-29 | Intervet International B.V. | Feline calicivirus vaccine |
| CN107022644A (en) * | 2017-06-14 | 2017-08-08 | 山东省农业科学院农业质量标准与检测技术研究所 | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables |
| CN107099619A (en) * | 2017-05-03 | 2017-08-29 | 上海速创诊断产品有限公司 | A kind of LAMP primer composition thing and its kit for detecting respiratory pathogen |
-
2018
- 2018-12-21 CN CN201811568475.5A patent/CN109811088B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0535740A1 (en) * | 1991-09-30 | 1993-04-07 | Akzo Nobel N.V. | Respiratory disease vaccine for cats |
| CN103517991A (en) * | 2010-10-27 | 2014-01-15 | 昆特拜克股份公司 | Capture of target DNA and RNA by probes comprising intercalator molecules |
| WO2017109045A1 (en) * | 2015-12-23 | 2017-06-29 | Intervet International B.V. | Feline calicivirus vaccine |
| CN107099619A (en) * | 2017-05-03 | 2017-08-29 | 上海速创诊断产品有限公司 | A kind of LAMP primer composition thing and its kit for detecting respiratory pathogen |
| CN107022644A (en) * | 2017-06-14 | 2017-08-08 | 山东省农业科学院农业质量标准与检测技术研究所 | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables |
Non-Patent Citations (3)
| Title |
|---|
| Detection of feline upper respiratory tract disease pathogens using a commercially available real-time PCR test;A. Litster等;《The Veterinary Journal》;20151231;"Materials and methods"部分 * |
| Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter;Byeong-Teck Kang等;《Journal of Veterinary Science》;20081231;第9卷(第2期);第207页右栏最后1段-第208页左栏第3段和图1 * |
| 三重LAMP法检测食品中沙门氏菌、单增李斯特菌和金黄色葡萄球菌;姜侃等;《食品科学》;20131231;第34卷(第24期);前言、第1-2节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109811088A (en) | 2019-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Development of a novel quantitative real‐time PCR assay with lyophilized powder reagent to detect African swine fever virus in blood samples of domestic pigs in China | |
| CN109811088B (en) | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit | |
| WO2016188144A1 (en) | Str locus fluorescent labeling multiplex amplification kit having enhanced identification capability and use thereof | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN106435024B (en) | Fluorescent quantitative PCR primer, probe, kit and detection method for detecting avian influenza virus subtype | |
| CN110819736A (en) | Primer and kit for detecting infection of three common pathogens of dog and application of primer and kit | |
| Fischer et al. | Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis | |
| KR101707992B1 (en) | Composition for diagnosing porcine reproductive and respiratory syndrome virus and method for diagnosing the same | |
| Wang et al. | Visual detection of porcine epidemic diarrhea virus using a novel reverse transcription polymerase spiral reaction method | |
| CN105603120B (en) | GeXP multiple rapid detection primer and detection method for detecting bluetongue virus, bovine viral diarrhea virus and foot-and-mouth disease virus | |
| CN110819737A (en) | Primer and kit for detecting cat intestinal infection pathogens and application of primer and kit | |
| CN112899398A (en) | Fluorescent PCR (polymerase chain reaction) detection kit for African swine fever virus and use method thereof | |
| CN105586438B (en) | GeXP multiple rapid detection primers and detection method for detecting akabane virus, foot-and-mouth disease virus and bluetongue virus | |
| CN105567868B (en) | GeXP multiple rapid detection primers and detection method for detecting akabane virus, bovine viral diarrhea virus and bluetongue virus | |
| Orlowska et al. | Comparison of real-time PCR and heminested RT-PCR methods in the detection of rabies virus infection in bats and terrestrial animals | |
| CN111187863A (en) | Kit and method for detecting COVID-19 by double-enzyme method isothermal amplification | |
| CN107326103B (en) | Triple RT-PCR specific amplification primer group and triple-identification RT-PCR detection method | |
| CN107236827B (en) | Kit and method for detecting transmissible gastroenteritis virus of swine | |
| CN114703177A (en) | Pseudorabies virus detection composition, method and kit based on RPA (reverse transcriptase amplification) isothermal amplification and immunochromatography technology | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN112553357A (en) | Nested PCR (polymerase chain reaction) detection primer group and kit for equine piroplasmosis and application of nested PCR detection primer group and kit | |
| CN105567869B (en) | GeXP multiple primers and method for detecting akabane virus, bovine viral diarrhea virus and foot-and-mouth disease virus | |
| CN105586437B (en) | Establishment of detection method for GeXP virus carried by four entry cows | |
| CN106701961A (en) | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pest virus | |
| CN113444839B (en) | Kit for preparing reagent for detecting EP pathogen and ER pathogen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |