CN109811088A - A kind of primer, kit and application detecting cat infection of the upper respiratory tract pathogen - Google Patents
A kind of primer, kit and application detecting cat infection of the upper respiratory tract pathogen Download PDFInfo
- Publication number
- CN109811088A CN109811088A CN201811568475.5A CN201811568475A CN109811088A CN 109811088 A CN109811088 A CN 109811088A CN 201811568475 A CN201811568475 A CN 201811568475A CN 109811088 A CN109811088 A CN 109811088A
- Authority
- CN
- China
- Prior art keywords
- primer
- concentration
- claf
- fcv
- fhv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of primer, kit and application detecting cat infection of the upper respiratory tract pathogen, it includes three FHV primer sets, FCV primer sets and CLaF primer sets primer sets, every group is all made of 6 F3 primer, B3 primer, FIP primer, BIP primer, LF primer, LB primer primers, and sequence is different because of targeted pathogen.Detection kit includes three kinds of feline herpetovirus I type, feline calicivirus and chlamydia felis detection reagents, and there are also negative controls and pretreatment fluid A and pretreatment fluid B；The application method of kit is to dip to suffer from cat sample, puts it into after processing in each detection reagent and is reacted under 65 degree of constant temperature, determines yin and yang attribute according to color change after the completion.The present invention is based on LAMP technology, and specific amplification pathogen gene segment can complete sampling-detection process in 45-60min, with the mode of operation most easily grasped, realize high-precision testing result.
Description
Technical field
The invention belongs to biological field, in particular to a kind of primer, kit for detecting cat infection of the upper respiratory tract pathogen
And application.
Background technique
Pet pathogen detection mainly has three ways, such as colloid gold test paper, PCR inspection, third party's detection service, glue at present
Body gold test paper is most common technology.The development of colloid gold test paper technology is more early, and operation is most simple, therefore existing market occupation rate is most
Height accounts for about 7 one-tenth or so that pathogen examines market, represents company as industry giant Ai Deshi, woods spy's medicine etc..But due to this
One technology accuracy is low, and positive coincidence rate is only 6 one-tenth or so, and accuracy is not able to satisfy the market demand gradually, and can examine disease
Substance type is simultaneously not perfect, such as the most common cat infection of the upper respiratory tract pathogen cannot detect, therefore its market share is year by year
Tighten.
PCR inspection is to start for nearly 2 years by human medical's market access Medical pet market, and maximum advantage is essence
Exactness is high, but its equipment cost is also very high, and for the price of separate unit instrument and equipment 50,000 or more, operation is also sufficiently complex, general
Logical pet doctor is difficult to operate.Also, its equipment is installed and needs self-built lab space, and need to guarantee the ventilation of experimental situation
Property it is good, be otherwise also easy to produce false positive, and pet clinic does not have mounting condition mostly.Because of the above reason, existing PCR is examined
The popularization and bad detected in the institute of technology, there is outfit in the central hospital of only a small number of chain leading enterprises, pet clinic.
Summary of the invention
It is an object of the present invention to overcome the deficiencies of the prior art and provide a kind of detection cat infection of the upper respiratory tract cause of disease
Primer, kit and the application of body.The present invention is based on LAMP technology, and specific amplification pathogen gene segment can be in 45-
Sampling-detection process is completed in 60min, with the mode of operation most easily grasped, realizes efficient, high-precision testing result, thus
Achieve the purpose that precisely to detect, and the present invention can detect in time in the stage in incubation period of pathogen infection, increases illness
Body cure rate.Compared with prior art, the present invention is provided simultaneously with that accuracy is high, operation is convenient, at low cost, relies on without operating environment
The features such as.
A kind of primer of detection cat infection of the upper respiratory tract pathogen of the invention is to include that FHV primer sets, FCV draw
Three primer sets of object group and CLaF primer sets, every group is all drawn by F3 primer, B3 primer, FIP primer, BIP primer, LF primer, LB
6 primer compositions of object, sequence are different because of targeted pathogen；Wherein FHV primer sets include outer primer to FHV-F3 and FHV-
B3, inner primer is to FHV-FIP and FHV-BIP and loop primer pair FHV-LF and FHV-LB；FCV primer sets include outer primer pair
FCV-F3 and FCV-B3, inner primer is to FCV-FIP and FCV-BIP and loop primer pair FCV-LF and FCV-LB；CLaF primer sets
Including outer primer to CLaF-F3 and CLaF-B3, inner primer to CLaF-FIP and CLaF-BIP and loop primer pair CLaF-LF and
CLaF-LB；Detailed sequence is as follows:
FHV-F3:TCCAGGACCGGAAACGAC
FHV-B3:acaaaatatcttgcgagtggga
FHV-FIP:gtgcggcaaatcttgcttgatagtGGTGAATTATCAGCTGAAGATGC
FHV-BIP:AAGTTGTATGTGAGGAACACCCCGagaccagagaggcgagag
FHV-LF:gggcggtgatataggca
FHV-LB:GTGACCCTAATCATAGATAG
FCV-F3:GATGAACTACCCGCCAATC
FCV-B3:cagtgtctcagcatagcagg
FCV-FIP:gataggtgacggcgaagagcACATGTGGTAACCGTTAACTC
FCV-BIP:CTGGGCAGTTTCAGGCCAattttgtcggggacagttagc
FCV-LF:caggccaaatcaaacac
FCV-LB:TCAGAGCCGCATATGATGT
ClaF-F3:TTTATCCTTGCGAAGGCG
ClaF-B3:cgcaatcttttttacctactgc
ClaF-FIP:acgaacactatacattttgccgtagGTCAATGCCAATCATCCG
ClaF-BIP:ATTGTAACGTTGAAATTAGCCAAGCaatttcaataggataaggagat cc
ClaF-LF:caagattcttgtctagtgtc
ClaF-LB:TGTACCTGAATATGCAACAG
The present invention also provides a kind of kits for detecting cat infection of the upper respiratory tract pathogen comprising described above three
A primer sets.
A kind of kit detecting cat infection of the upper respiratory tract pathogen of the present invention comprising feline herpetovirus I type,
Three kinds of detection reagents of feline calicivirus and chlamydia felis, every kind of reagent consist of two parts respectively, and first part is universal
The ingredient of the part RM, this three kinds of reagent in part is identical, is made of following component: Bst enzyme, and concentration is the hydroxyl naphthols of 37.5uM
Indigo plant, concentration are the MgSO4 of 100mM, and 10xBst buffer, deionized water, concentration is the dNTP of 10mM, and concentration is the beet of 5M
Alkali；Second part is the part PM of Idiotype, and the part PM of three kinds of reagents is respectively by previously described corresponding primer sets
Aqueous solution composition.
It is preferred that the kit of the detection cat infection of the upper respiratory tract pathogen, the volume of the part RM in every reagent is equal
It is 17 microlitres, composed of the following components:
1 microlitre of Bst enzyme
The hydroxynaphthol blue that 1 microlitre of concentration is 37.5 μM
The MgSO4 that 2 microlitres of concentration are 100mM
2.5 microlitres of 10xBst buffer
3 microlitres of deionized waters
3.5 microlitres of concentration is the dNTP of 10mM
4 microlitres of concentration is the glycine betaine of 5M；
The concentration of the aqueous solution of each primer is 20 μM in the part PM of Idiotype, the volume of the part PM of every reagent
It is 7 microlitres, specific as follows:
The part PM of the detection reagent of feline herpetovirus I type:
Concentration is 0.5 microlitre of FHV-F3 primer of 20 μM, and concentration is 0.5 microlitre of FHV-B3 primer of 20 μM, and concentration is 20 μ
The FHV-FIP primer 2 microlitre of M, the FHV-BIP primer 2 microlitre that concentration is 20 μM, concentration are 1 microlitre of FHV-LF primer of 20 μM,
Concentration is 1 microlitre of FHV-LB primer of 20 μM；
The part PM of the detection reagent of feline calicivirus:
Concentration is 0.5 microlitre of FCV-F3 primer of 20 μM, and concentration is 0.5 microlitre of FCV-B3 primer of 20 μM, and concentration is 20 μ
The FCV-FIP primer 2 microlitre of M, the FCV-BIP primer 2 microlitre that concentration is 20 μM, concentration are 1 microlitre of FCV-LF primer of 20 μM,
Concentration is 1 microlitre of FCV-LB primer of 20 μM；
The part PM of the detection reagent of chlamydia felis:
Concentration is 0.5 microlitre of ClaF-F3 primer of 20 μM, and concentration is 0.5 microlitre of ClaF-B3 primer of 20 μM, and concentration is
20 μM of ClaF-FIP primer 2 microlitre, the ClaF-BIP primer 2 microlitre that concentration is 20 μM, the ClaF-LF primer that concentration is 20 μM
1 microlitre, concentration is 1 microlitre of ClaF-LB primer of 20 μM.
The kit of detection cat infection of the upper respiratory tract pathogen of the present invention, further includes negative control and pretreatment
Liquid A and pretreatment fluid B；The volume of the negative control every is 25 microlitres, and be made of following component: 3.5 microlitres of concentration is
The dNTP of 10mM, 4 microlitres of concentration are the glycine betaine of 5M, the hydroxynaphthol blue that 1 microlitre of concentration is 37.5 μM, 2 microlitres dense
Degree is the MgSO4 of 100mM, 2.5 microlitres of 10xBst buffer, 12 microlitres of deionized waters；
The pretreatment fluid A are as follows: effective component be 1%Triton X-100 lysate, 200 microlitres of volume every；
The pretreatment fluid B is dilution, and ingredient is pure deionized water, and volume every is 200 microlitres.
It is preferred that the kit of the detection cat infection of the upper respiratory tract pathogen is made of following component:
Detection reagent 3, feline herpetovirus I type,
Feline calicivirus detection reagent 3,
Chlamydia felis detection reagent 3,
Negative control 3,
Pretreatment fluid A 3,
Pretreatment fluid B 3.
The present invention also provides application of the kit in detection cat infection of the upper respiratory tract pathogen, users
Method comprises the steps of:
(1) it takes an aseptic cotton carrier to dip and suffers from cat sample, method is first to take a nasal discharge, such as without desirable saliva；
(2) cat sample will be suffered to immerse in pretreatment fluid A, cracked, mixing 30 seconds is shaked gently；
(3) liquid after 5 microlitres of cracking mix is sucked out to be transferred in pretreatment fluid B, is diluted；
(4) sample after 1 microlitre of dilution is drawn respectively, is added in 3 kinds of detection reagents, after shaking gently mixing, is put into perseverance
In warm equipment, reacted under 65 degree of temperature.
(5) after reaction, reagent color change is observed, is compared with negative control, determines yin and yang attribute.
Detection to cat infection of the upper respiratory tract pathogen of the invention is used for non-diagnostic purpose.
Beneficial effect
The present invention is based on LAMP technology, specific amplification pathogen gene segment, to the several of the cat infection of the upper respiratory tract
Common causative completes sampling-detection process in 45-60min, with the mode of operation most easily grasped, realizes efficiently, in high precision
Testing result, to achieve the purpose that precisely to detect, and can be detected in time in the stage in incubation period of pathogen infection, increase
Add diseased individuals cure rate.Compared with prior art, the present invention has been provided simultaneously with accuracy height, has operated convenient, at low cost, product
The features such as category is complete, high specific, high sensitivity and simple to operation, reproducible, result easily judge.Further, due to this hair
The primer sets of bright offer have high specificity, therefore, in LAMP amplification, directly carry out without extracting the DNA of sample
Amplification, further shortens detection time, and simplify operation.Backward colloid gold test paper can be replaced, become industry
New standard.
Detailed description of the invention
Fig. 1 is the foundation for detection method
Wherein reagent puts in order from left to right successively are as follows: FHV is negative, and FHV is positive, and FCV is negative, and FCV is positive, ClaF
Feminine gender, ClaF are positive.
Fig. 2 is the testing result of the method for the present invention of sample to be tested 8
Wherein reagent puts in order are as follows: a left side 1 is negative control, and left 2-4 respectively is detection FHV, FCV, ClaF's
Reagent.
Fig. 3 is the FHV testing result figure that different dilution ratio samples are detected using kit of the present invention
Array from left to right for test stoste, dilution 10 times of samples, dilution 100 times of samples, dilution 1000 times of samples,
Negative control.
Fig. 4 is the FCV testing result figure that different dilution ratio samples are detected using kit of the present invention
Sample puts in order same Fig. 3.
Fig. 5 is the ClaF testing result figure that different dilution ratio samples are detected using kit of the present invention
Sample puts in order same Fig. 3.
Fig. 6 is the FHV detection electrophoresis result figure that different dilution ratio samples are detected using PCR method
The left side first is classified as 100bp DNA marker (Quan Shijin), and other five swimming lanes are from left to right successively are as follows: 1-surveys
Try stoste, 2-10 times of samples of dilution, 3-100 times of samples of dilution, 4-1000 times of samples of dilution, 5-negative controls.
Fig. 7 is the FCV detection electrophoresis result figure that different dilution ratio samples are detected using PCR method
The swimming lane of sample puts in order same Fig. 6.
Fig. 8 is the ClaF detection electrophoresis result figure that different dilution ratio samples are detected using PCR method
The swimming lane of sample puts in order same Fig. 6.
Specific embodiment
Presently preferred embodiments of the present invention is introduced with reference to the accompanying drawings of the specification, and citing proves that the present invention can be implemented, passes through
To the those of skill in the art complete description present invention, keeps its technology contents more clear and be easy to understand.The present invention can be with
It is emerged from by many various forms of embodiments, protection scope is not limited only to the embodiment mentioned in text, herein
Attached drawing and explanation substantially illustrate rather than limitation the present invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
Raw material as used in the following examples, reagent etc. are commercially available unless otherwise specified or public
It opens.
1 material and method
1.1 pathogen
Pathogen sample of the invention is unless otherwise specified, other all from pet clinic's biopsy sample.
1.2 main agents
Deionized water is purchased from Tiangeng biochemical technology Co., Ltd；
Bst enzyme, 10xBst buffer, MgSO4, dNTP are purchased from NEB company；
Glycine betaine is purchased from Beijing day bounties Gene Tech. Company Limited；
Hydroxynaphthol blue is purchased from Chengdu bass spy's reagent Co., Ltd；
Primer is purchased from Suzhou Hong Xun Science and Technology Ltd.；
Centrifuge tube is purchased from Axygen company.
1.3 design of primers
Firstly, searching for the TK gene order of felid herpesvirus 1 type (FHV-1), feline calicivirus in Genbank database
(FCV) the omp2 gene order of ORF2 sequence and chlamydia felis (ClaF), and sequence alignment is carried out by ClustalX software；
Then, by LAMP primer design software (Primer Explorer software, version5.0), for above-mentioned specificity
Conserved sequence carries out LAMP primer design respectively, has carried out artificial selection and correction according to professional experiences, further according to more wheel experiments
Test filters out primer sets of the invention in the primer combination of synthesis.
The preparation of the primer of embodiment 1, detection cat infection of the upper respiratory tract pathogen
The primer of a kind of detection cat infection of the upper respiratory tract pathogen of the present embodiment comprising FHV primer sets, FCV primer
Group and three primer sets of CLaF primer sets, every group all by F3 primer, B3 primer, FIP primer, BIP primer, LF primer, LB primer 6
Primer composition, sequence are different because of targeted pathogen；Wherein FHV primer sets include outer primer to FHV-F3 and FHV-B3,
Inner primer is to FHV-FIP and FHV-BIP and loop primer pair FHV-LF and FHV-LB；FCV primer sets include outer primer to FCV-
F3 and FCV-B3, inner primer is to FCV-FIP and FCV-BIP and loop primer pair FCV-LF and FCV-LB；CLaF primer sets include
Outer primer to CLaF-F3 and CLaF-B3, inner primer to CLaF-FIP and CLaF-BIP and loop primer pair CLaF-LF and
CLaF-LB；Detailed sequence is as follows:
FHV-F3:TCCAGGACCGGAAACGAC
FHV-B3:acaaaatatcttgcgagtggga
FHV-FIP:gtgcggcaaatcttgcttgatagtGGTGAATTATCAGCTGAAGATGC
FHV-BIP:AAGTTGTATGTGAGGAACACCCCGagaccagagaggcgagag
FHV-LF:gggcggtgatataggca
FHV-LB:GTGACCCTAATCATAGATAG
FCV-F3:GATGAACTACCCGCCAATC
FCV-B3:cagtgtctcagcatagcagg
FCV-FIP:gataggtgacggcgaagagcACATGTGGTAACCGTTAACTC
FCV-BIP:CTGGGCAGTTTCAGGCCAattttgtcggggacagttagc
FCV-LF:caggccaaatcaaacac
FCV-LB:TCAGAGCCGCATATGATGT
ClaF-F3:TTTATCCTTGCGAAGGCG
ClaF-B3:cgcaatcttttttacctactgc
ClaF-FIP:acgaacactatacattttgccgtagGTCAATGCCAATCATCCG
ClaF-BIP:ATTGTAACGTTGAAATTAGCCAAGCaatttcaataggataaggagat cc
ClaF-LF:caagattcttgtctagtgtc
ClaF-LB:TGTACCTGAATATGCAACAG
Embodiment 2 detects sample to be tested using the kit of detection cat infection of the upper respiratory tract pathogen
One, the preparation of detection kit
Cat infection of the upper respiratory tract pathogen detection kit described in the present embodiment comprising feline herpesvirus disease I type, cat cup-shaped
Virus and three kinds of detection reagents of chlamydia felis, every kind of reagent consist of two parts respectively, and first part is the general part RM, this
The ingredient of the three kinds of reagents in part is identical, is made of following raw material:
1 microlitre of Bst enzyme
1 microlitre of hydroxynaphthol blue (37.5 μM)
2 microlitres of MgSO4 (100mM)
2.5 microlitres of 10xBst buffer
3 microlitres of deionized waters
3.5 microlitres of dNTP (10mM)
4 microlitres of glycine betaines (5M)；It is 17 microlitres total.
Second part is the part PM of Idiotype, is the aqueous solution of each primer, the concentration of aqueous solution is 20 μM, every
The volume of the part PM is 7 microlitres in reagent, and concrete content is as follows:
The part PM of the detection reagent of feline herpetovirus I type:
0.5 microlitre of FHV-F3 primer (20 μM), 0.5 microlitre of FHV-B3 primer (20 μM),
2 microlitres of FHV-FIP primers (20 μM), 2 microlitres of FHV-BIP primers (20 μM),
1 microlitre of FHV-LF primer (20 μM), 1 microlitre of FHV-LB primer (20 μM)；
The part PM of the detection reagent of feline calicivirus:
0.5 microlitre of FCV-F3 primer (20 μM), 0.5 microlitre of FCV-B3 primer (20 μM),
2 microlitres of FCV-FIP primers (20 μM), 2 microlitres of FCV-BIP primers (20 μM),
1 microlitre of FCV-LF primer (20 μM), 1 microlitre of FCV-LB primer (20 μM)；
The part PM of the detection reagent of chlamydia felis:
0.5 microlitre of ClaF-F3 primer (20 μM), 0.5 microlitre of ClaF-B3 primer (20 μM),
2 microlitres of ClaF-FIP primers (20 μM), 2 microlitres of ClaF-BIP primers (20 μM),
1 microlitre of ClaF-LF primer (20 μM), 1 microlitre of ClaF-LB primer (20 μM).
Kit described in the present embodiment further includes negative control and pretreatment fluid A and pretreatment fluid B.The negative control
Every volume is 25 microlitres, is made of following component: 3.5 microlitres of dNTP (10mM), 4 microlitres of glycine betaines (5M), 1 microlitre of hydroxyl
Naphthol blue (37.5 μM), 2 microlitres of MgSO4 (100mM), 2.5 microlitres of 10xBst buffer, 12 microlitres of deionized waters；
Pretreatment fluid A described in the present embodiment are as follows: effective component is 1%Triton X-100 lysate, for cracking tissue
Cell discharges pathogen；200 microlitres of volume every；
The pretreatment fluid B is dilution, and ingredient is pure deionized water, and volume is 200 microlitres every.
Kit described in the present embodiment includes following component:
Detection reagent 3, feline herpetovirus I type,
Feline calicivirus detection reagent 3,
Chlamydia felis detection reagent 3,
Negative control 3,
Pretreatment fluid A 3,
Pretreatment fluid B 3,
The preparation method of kit described in the present embodiment, it includes the following contents:
The preparation of (one) three kind of detection reagent:
(1) the general part RM is first prepared, the preparation method and raw material of three kinds of this part reagent are all the same, and preparation step is such as
Under:
0.5ml centrifuge tube is taken, sequentially adds following reagent with micropipettor:
2.5 microlitres of 10xBst buffer
3 microlitres of deionized waters
4 microlitres of glycine betaines
3.5 microlitres of dNTP (10mM)
2 microlitres of MgSO4 (100mM)
1 microlitre of hydroxynaphthol blue (37.5 μM)
1 microlitre of Bst enzyme
It totally 17 microlitres, mixes gently up to the part RM.
(2) part PM of three kinds of detection reagents is prepared again:
The part PM of the detection reagent of feline herpetovirus I type:
0.5 microlitre of FHV-F3 primer (20 μM), 0.5 microlitre of FHV-B3 primer (20 μM),
2 microlitres of FHV-FIP primers (20 μM), 2 microlitres of FHV-BIP primers (20 μM),
1 microlitre of FHV-LF primer (20 μM), 1 microlitre of FHV-LB primer (20 μM)；
The part PM of the detection reagent of feline calicivirus:
0.5 microlitre of FCV-F3 primer (20 μM), 0.5 microlitre of FCV-B3 primer (20 μM),
2 microlitres of FCV-FIP primers (20 μM), 2 microlitres of FCV-BIP primers (20 μM),
1 microlitre of FCV-LF primer (20 μM), 1 microlitre of FCV-LB primer (20 μM)；
The part PM of the detection reagent of chlamydia felis:
0.5 microlitre of ClaF-F3 primer (20 μM), 0.5 microlitre of ClaF-B3 primer (20 μM),
2 microlitres of ClaF-FIP primers (20 μM), 2 microlitres of ClaF-BIP primers (20 μM),
1 microlitre of ClaF-LF primer (20 μM), 1 microlitre of ClaF-LB primer (20 μM).
(3) part PM of three kinds of reagents is added separately to the part RM made from step (1), then mixed.That is: will
The part general RM that the part PM of the detection reagent of feline herpetovirus I type is added to 17 microlitres obtains the inspection of feline herpetovirus I type
Test agent；The part general RM that the part PM of the detection reagent of feline calicivirus is added 17 microlitres is obtained into the inspection of feline calicivirus
Test agent；The part general RM that the part PM of the detection reagent of chlamydia felis is added 17 microlitres is obtained into the detection of feline calicivirus
Reagent.
(2) preparation of negative controls:
By 3.5 microlitres of dNTP (10mM), 4 microlitres of glycine betaines (5M), 1 microlitre of hydroxynaphthol blue (37.5 μM), 2 microlitres
MgSO4 (100mM), 2.5 microlitres of 10xBst buffer, 12 microlitres of deionized waters mix after sequentially adding to obtain the final product.
The kit of the present embodiment is used to detect the pathogen of the cat infection of the upper respiratory tract, detection method to include following step
It is rapid:
(1) aseptic cotton carrier is taken, dips and suffers from cat sample, method is first to take the eye for suffering from cat, nasal discharge, such as without desirable saliva
Liquid；
(2) cat sample will be suffered to immerse in pretreatment fluid A, cracked, mixing 30 seconds is shaked gently；
(3) liquid after 5 microlitres of cracking mix is sucked out to be transferred in pretreatment fluid B, is diluted；
(4) sample after 1 microlitre of dilution is drawn respectively, is added in 3 kinds of detection reagents, is covered tightly the pipe of the centrifuge tube of installed reagents
Lid, after shaking gently mixing, puts it in thermostatic equipment, is reacted under 65 degree of temperature, reaction time 45-60 minute.
(5) after reaction, three kinds of detection reagent color changes are observed respectively, are compared with negative control, determine yin and yang attribute.
It is the positive if blue is presented, if similar with negative control, it is feminine gender that purple, which is presented,.
For three kinds of different pathogens, the final display the result is shown in Figure 1 of the detection method of the present embodiment.
Embodiment 3, accuracy experiment
The infection of the upper respiratory tract suffers from cat and can carry I type feline herpetovirus, feline calicivirus and three kinds of chlamydia felis simultaneously,
It is also possible to carry any two kinds therein or a kind of.It takes a Healthy Cats as sample to be tested 1, then has according to suffering from cat
Sample to be tested 2-8 is arranged in the different situations of determining pathogen, and see Table 1 for details:
Table 1
Note: "-" represents "None", and "+" represents " having ".
The detection method that embodiment 2 is respectively adopted in every group of sample to be tested is detected, observation detection knot after the completion of detection
Fruit, as Fig. 2 be sample to be tested 8 testing result show that reagent puts in order in Fig. 2 are as follows: a left side 1 be negative control, left 2-4 according to
Secondary is respectively detection FHV, the reagent of FCV, ClaF.As seen from Figure 2, the negative control on a left side 1 shows purple, the left left side 2- 4
FHV is detected, the reagent of FCV, ClaF are blue, so the present embodiment FHV of sample to be tested 8, FCV, the detection of ClaF three
Result is the positive, provides result to information with table 1 and compares, and testing result is correct.
The testing result of each sample to be tested is summarized, as a result see the table below 2:
Table 2
| Negative control | FHV detection reagent | FCV detection reagent | ClaF detection reagent | |
| Sample to be tested 1 | Purple | Purple | Purple | Purple |
| Sample to be tested 2 | Purple | Blue | Purple | Purple |
| Sample to be tested 3 | Purple | Purple | Blue | Purple |
| Sample to be tested 4 | Purple | Purple | Purple | Blue |
| Sample to be tested 5 | Purple | Blue | Blue | Purple |
| Sample to be tested 6 | Purple | Blue | Purple | Blue |
| Sample to be tested 7 | Purple | Purple | Blue | Blue |
| Sample to be tested 8 | Purple | Blue | Blue | Blue |
By the testing result of table 2 compared with the corresponding content of table 1 it is known that with kit detection of the invention respectively to
The testing result of sample is all correct.It is corresponding to illustrate that primer and kit provided by the invention can accurately differentiate its
Virus, testing result accuracy is good.It carries out 10 repetitions respectively for sample for every group to detect, every group of each secondary testing result
All the same, accuracy and repeatability are all fine.
Detection application:
The test that 48 cat infection of the upper respiratory tract pathogen suffer from cat is completed in the pet clinic of cooperation, wherein 20 FHV+,
FCV-, ClaF-；17 FHV-, FCV+, ClaF-；5 FHV+, FCV+, ClaF-；3 FHV+, FCV+, ClaF-；2 FHV-,
FCV-, ClaF-；1 FHV-, FCV-, ClaF+, verified, testing result is correct.
Embodiment 4, specific test
Referring to the detection method of the embodiment of the present invention 2, sample to be tested is changed to the domestic seven weak poison in the Changchun Far East respectively
Freeze dried vaccine and cat coronavirus sample (for hospital's biopsy sample), feline panleukopenia virus sample (for hospital's biopsy sample) are examined
It surveys, every group sets 3 repetitions, and testing result is shown: showing purple, has no any positive reaction.Illustrate detection primer of the present invention
There is good specificity with detection method.
Embodiment 5, sensitivity test
Cat sample is suffered from acquisition one, is FHV+, and FCV+, ClaF+ tri- are positive, are added respectively using method of the invention with PCR
Electrophoresis runs glue detection comparison.Experimentation is as follows:
One, produces test stoste
(1) it takes this to suffer from 200 microlitres of cat sample, is tried using Beijing Quan Shi King Company EasyPure Viral DNA/RNA Kit
Agent box is operated according to its specification, extracts the nucleic acid extractive (including DNA and RNA) for obtaining sample.(http://
www.transgen.com.cn/attached/down/ER201-01_2017050515.pdf)；
(2) 10 microlitres of sample nucleic acid extracts are taken, sample nucleic acid reverse transcription product is obtained after carrying out reverse transcription, as tests
Stoste.Reverse transcription uses the Reverse Transcriptase kit of Thermo Fisher Scientific company, and operating procedure is said by its operation
Bright book carries out.With reference to network address are as follows: (https: //www.thermofisher.com/cn/zh/home/life-science/
pcr/reverse-t ranscription/rt-pcr.html)。
Test stoste is distinguished into gradient dilution 10, carries out dependence test after 100,1000 times.
Examination of the invention is respectively adopted in each liquid after test stoste and gradient dilution that above-mentioned steps one prepare by two,
Agent box is detected, and when each sample test the step of is: 3 kinds each sample to be tested is directly added separately in kit
In detection reagent, the amount that each sample to be tested is added to every kind of reagent is 1 microlitre, covers tightly the pipe lid of the centrifuge tube of installed reagents, gently
After light shaking mixes, puts it in thermostatic equipment, reacted under 65 degree of temperature, the reaction time 50 minutes.Reaction terminates
Afterwards, three kinds of detection reagent color changes are observed respectively, are compared with negative control, determine yin and yang attribute.The testing result of each sample is converged
It always see the table below 3:
Table 3
| Sample stoste | 10 times of dilution | 100 times of dilution | 1000 times of dilution | Negative control | |
| FHV detection reagent | Blue | Blue | Blue | Purple | Purple |
| FCV detection reagent | Blue | Blue | Blue | Purple | Purple |
| ClaF detection reagent | Blue | Blue | Blue | Purple | Purple |
As can be seen from Table 3, in detection method of the invention, the minimal detectable concentration of three kinds of reagents is all 100 times of dilution.
Fig. 3 is the FHV testing result figure that different dilution ratio samples are detected using the method for the present invention.It successively arranges from left to right
It is classified as test stoste, 10 times of samples of dilution, 100 times of samples of dilution, dilution 1000 times of samples, negative controls.FCV and ClaF detection
As a result see Fig. 4 and Fig. 5.
Each liquid after testing stoste and gradient dilution is carried out PCR detection by three, respectively, uses Tiangeng biochemical corp
Taq-PCR kit is operated by its operational manual, is specifically shown in lower network address: (http://www.tiangen.com/
asset/imsupload/up0718751001543655183.pdf；) every time test when sample to be tested additional amount be 1 micro-
It rises, when the method detects these three pathogen, every kind of pathogen detection difference is each to use two primers, and primer is standard common
Upstream and downstream primer, the concentration of each primer is 10 μM, and dosage is 1 microlitre.
(1) when wherein detecting FHV, the primer that uses are as follows:
| FHV-F | TGCCGCACCATACCTTCT |
| FHV-B | tcgtggaagtgttgccatt |
The PCR product length that PCR reacts is 200bp or so, after the reaction was completed, by PCR product with 2% agarose
(addition gel red, is detailed in http://www.bosunlife.com/product/sp_prod/GelRed_ for gel electrophoresis
GelGreen.asp), 100v electrophoresis 20 minutes, take pictures under ultraviolet light.
Liquid after test stoste and different dilution ratios is detected respectively, as a result sees Fig. 6.
(2) detection of the FCV and ClaF pathogen of each sample to be tested, the PCR inspection of both pathogen are in addition carried out respectively
Survey method and steps from FHV in addition to the primer is different, it is other all the same.When wherein detecting FCV, the primer that uses are as follows:
| FCV-F | ATGGTGAATTCTGTTGCTTTCG |
| FCV-B | tgagtttcagtggaggttgtg |
(3) when detecting ClaF, the primer that uses are as follows:
| ClaF-F | ACAGATCAAATTTTGCCTACG |
| ClaF-B | gctctacaatgccttgagaa |
After the completion of detection, the electrophoresis result of FCV detection is shown in Fig. 7, and the electrophoresis result of ClaF detection is shown in Fig. 8.
The minimal detectable concentration of this three kinds of reagent of PCR method is 10 times of dilution it can be seen from Fig. 6 to Fig. 8, and by upper
Text learns that the minimal detectable concentration of three kinds of reagents of the method for the present invention is 100 times of dilution, it can be seen that: detection method
Minimal detectable concentration be the 1/10 of PCR.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, without departing from the technical principles of the invention, several improvements and modifications, these improvements and modifications can also be made
Also it should be regarded as protection scope of the present invention.
Sequence table
<110>Guangzhou Ba Ka Biotechnology Co., Ltd
<120>a kind of primer, kit and application for detecting cat infection of the upper respiratory tract pathogen
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
tccaggaccg gaaacgac 18
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acaaaatatc ttgcgagtgg ga 22
<210> 3
<211> 47
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gtgcggcaaa tcttgcttga tagtggtgaa ttatcagctg aagatgc 47
<210> 4
<211> 42
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aagttgtatg tgaggaacac cccgagacca gagaggcgag ag 42
<210> 5
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gggcggtgat ataggca 17
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gtgaccctaa tcatagatag 20
<210> 7
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gatgaactac ccgccaatc 19
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cagtgtctca gcatagcagg 20
<210> 9
<211> 41
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gataggtgac ggcgaagagc acatgtggta accgttaact c 41
<210> 10
<211> 39
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
ctgggcagtt tcaggccaat tttgtcgggg acagttagc 39
<210> 11
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
caggccaaat caaacac 17
<210> 12
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
tcagagccgc atatgatgt 19
<210> 13
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
tttatccttg cgaaggcg 18
<210> 14
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
cgcaatcttt tttacctact gc 22
<210> 15
<211> 43
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
acgaacacta tacattttgc cgtaggtcaa tgccaatcat ccg 43
<210> 16
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
attgtaacgt tgaaattagc caagcaattt caataggata aggagatcc 49
<210> 17
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
caagattctt gtctagtgtc 20
<210> 18
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
tgtacctgaa tatgcaacag 20
<210> 19
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
tgccgcacca taccttct 18
<210> 20
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
tcgtggaagt gttgccatt 19
<210> 21
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
atggtgaatt ctgttgcttt cg 22
<210> 22
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
tgagtttcag tggaggttgt g 21
<210> 23
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
acagatcaaa ttttgcctac g 21
<210> 25
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
gctctacaat gccttgagaa 20
Claims (7)
1. a kind of primer for detecting cat infection of the upper respiratory tract pathogen, it is characterised in that it includes FHV primer sets, FCV primer sets
With three primer sets of CLaF primer sets, every group by F3 primer, B3 primer, FIP primer, BIP primer, LF primer, LB primer 6
Primer composition, sequence are different because of targeted pathogen；Wherein FHV primer sets include outer primer to FHV-F3 and FHV-B3, interior
Primer pair FHV-FIP and FHV-BIP and loop primer pair FHV-LF and FHV-LB；FCV primer sets include outer primer to FCV-F3
And FCV-B3, inner primer is to FCV-FIP and FCV-BIP and loop primer pair FCV-LF and FCV-LB；CLaF primer sets include outer
Primer pair CLaF-F3 and CLaF-B3, inner primer is to CLaF-FIP and CLaF-BIP and loop primer pair CLaF-LF and CLaF-
LB；Detailed sequence is as follows:
FHV-F3:TCCAGGACCGGAAACGAC
FHV-B3:acaaaatatcttgcgagtggga
FHV-FIP:gtgcggcaaatcttgcttgatagtGGTGAATTATCAGCTGAAGATGC
FHV-BIP:AAGTTGTATGTGAGGAACACCCCGagaccagagaggcgagag
FHV-LF:gggcggtgatataggca
FHV-LB:GTGACCCTAATCATAGATAG
FCV-F3:GATGAACTACCCGCCAATC
FCV-B3:cagtgtctcagcatagcagg
FCV-FIP:gataggtgacggcgaagagcACATGTGGTAACCGTTAACTC
FCV-BIP:CTGGGCAGTTTCAGGCCAattttgtcggggacagttagc
FCV-LF:caggccaaatcaaacac
FCV-LB:TCAGAGCCGCATATGATGT
ClaF-F3:TTTATCCTTGCGAAGGCG
ClaF-B3:cgcaatcttttttacctactgc
ClaF-FIP:acgaacactatacattttgccgtagGTCAATGCCAATCATCCG
ClaF-BIP:ATTGTAACGTTGAAATTAGCCAAGCaatttcaataggataaggagat cc
ClaF-LF:caagattcttgtctagtgtc
ClaF-LB:TGTACCTGAATATGCAACAG.
2. a kind of kit for detecting cat infection of the upper respiratory tract pathogen, it is characterised in that it includes described in claim 1 three
A primer sets.
3. a kind of kit for detecting cat infection of the upper respiratory tract pathogen as claimed in claim 2, it is characterised in that it includes
Three kinds of feline herpetovirus I type, feline calicivirus and chlamydia felis detection reagents, every kind of reagent consist of two parts respectively, and first
Part is the universal part RM, and the ingredient of this three kinds of reagent in part is identical, and be made of following component: Bst enzyme, concentration are
The hydroxynaphthol blue of 37.5uM, concentration are the MgSO4 of 100mM, and 10xBstbuffer, deionized water, concentration is the dNTP of 10mM,
Concentration is the glycine betaine of 5M；Second part is the part PM of Idiotype, and the part PM of three kinds of reagents is respectively as described in claim 1
Corresponding primer sets aqueous solution composition.
4. the kit of detection cat infection of the upper respiratory tract pathogen as claimed in claim 3, it is characterised in that in every reagent
The volume of the part RM be 17 microlitres, it is composed of the following components:
1 microlitre of Bst enzyme
The hydroxynaphthol blue that 1 microlitre of concentration is 37.5 μM
The MgSO4 that 2 microlitres of concentration are 100mM
2.5 microlitres of 10xBstbuffer
3 microlitres of deionized waters
3.5 microlitres of concentration is the dNTP of 10mM
4 microlitres of concentration is the glycine betaine of 5M；
The concentration of the aqueous solution of each primer is 20 μM in the part PM of Idiotype, and the volume of the part PM of every reagent is
It is 7 microlitres, specific as follows:
The part PM of the detection reagent of feline herpetovirus I type:
Concentration is 0.5 microlitre of FHV-F3 primer of 20 μM, and concentration is 0.5 microlitre of FHV-B3 primer of 20 μM, and concentration is 20 μM
FHV-FIP primer 2 microlitre, the FHV-BIP primer 2 microlitre that concentration is 20 μM, concentration is 1 microlitre of FHV-LF primer of 20 μM, dense
Degree is 1 microlitre of FHV-LB primer of 20 μM；
The part PM of the detection reagent of feline calicivirus:
Concentration is 0.5 microlitre of FCV-F3 primer of 20 μM, and concentration is 0.5 microlitre of FCV-B3 primer of 20 μM, and concentration is 20 μM
FCV-FIP primer 2 microlitre, the FCV-BIP primer 2 microlitre that concentration is 20 μM, concentration is 1 microlitre of FCV-LF primer of 20 μM, dense
Degree is 1 microlitre of FCV-LB primer of 20 μM；
The part PM of the detection reagent of chlamydia felis:
Concentration is 0.5 microlitre of ClaF-F3 primer of 20 μM, and concentration is 0.5 microlitre of ClaF-B3 primer of 20 μM, and concentration is 20 μM
ClaF-FIP primer 2 microlitre, concentration is 20 μM of ClaF-BIP primer 2 microlitre, and concentration is that 20 μM of ClaF-LF primer 1 is micro-
It rises, concentration is 1 microlitre of ClaF-LB primer of 20 μM.
5. a kind of kit for detecting cat infection of the upper respiratory tract pathogen as claimed in claim 4, it is characterized in that the reagent
Box further includes negative control and pretreatment fluid A and pretreatment fluid B；The volume of the negative control every is 25 microlitres, by following
Group is grouped as: 3.5 microlitres of concentration is the dNTP of 10mM, and 4 microlitres of concentration is the glycine betaine of 5M, and 1 microlitre of concentration is 37.5 μ
The hydroxynaphthol blue of M, 2 microlitres of concentration are the MgSO4 of 100mM, 2.5 microlitres of 10xBst buffer, 12 microlitres of deionized waters；
The pretreatment fluid A are as follows: effective component be 1%Triton X-100 lysate, 200 microlitres of volume every；
The pretreatment fluid B is dilution, and ingredient is pure deionized water, and volume is 200 microlitres every.
6. a kind of kit for detecting cat infection of the upper respiratory tract pathogen as claimed in claim 5, it is characterized in that the reagent
Box is made of following component:
Detection reagent 3, feline herpetovirus I type,
Feline calicivirus detection reagent 3,
Chlamydia felis detection reagent 3,
Negative control 3,
Pretreatment fluid A 3,
Pretreatment fluid B 3.
7. application of the kit as described in claim 2-6 is one of any in detection cat infection of the upper respiratory tract pathogen,
It is characterized in that application method comprises the steps of:
(1) it takes an aseptic cotton carrier to dip and suffers from cat sample, method is first to take a nasal discharge, such as without desirable saliva；
(2) cat sample will be suffered to immerse in pretreatment fluid A, cracked, mixing 30 seconds is shaked gently；
(3) liquid after 5 microlitres of cracking mix is sucked out to be transferred in pretreatment fluid B, is diluted；
(4) sample after 1 microlitre of dilution is drawn respectively, is added in 3 kinds of detection reagents, after shaking gently mixing, is put into constant temperature and sets
In standby, reacted under 65 degree of temperature；
(5) after reaction, reagent color change is observed, is compared with negative control, determines yin and yang attribute.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811568475.5A CN109811088B (en) | 2018-12-21 | 2018-12-21 | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811568475.5A CN109811088B (en) | 2018-12-21 | 2018-12-21 | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109811088A true CN109811088A (en) | 2019-05-28 |
| CN109811088B CN109811088B (en) | 2022-10-04 |
Family
ID=66601809
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811568475.5A Active CN109811088B (en) | 2018-12-21 | 2018-12-21 | Primer and kit for detecting upper respiratory tract infection pathogens of cats and application of primer and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109811088B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564895A (en) * | 2019-09-11 | 2019-12-13 | 南宁众册生物科技有限公司 | RAA constant-temperature fluorescence detection primer probe set, kit and method for feline herpesvirus FHV-1 |
| CN110643744A (en) * | 2019-11-19 | 2020-01-03 | 南京农业大学 | Quantitative detection method for simultaneously detecting three cat susceptible viruses and primer probe combination thereof |
| CN113388700A (en) * | 2021-06-29 | 2021-09-14 | 苏州艾可瑞动物检测技术服务有限公司 | Kit for detecting FCV (FCV), FPV (FPV) and FHV-1 viruses by using nucleic acid hand-free triple fluorescence RT-LAMP (reverse transcription loop-mediated isothermal amplification) |
| RU2802065C1 (en) * | 2022-10-14 | 2023-08-22 | Сергей Александрович Исаев | Set of specific oligodeoxyribonucleotide primers and a fluorescently labeled probe for the orf1 (non-structural protein 1) gene fragment of feline calicivirus (fcv) rna (cdna) for the detection of feline calicivirus (fcv). |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0535740A1 (en) * | 1991-09-30 | 1993-04-07 | Akzo Nobel N.V. | Respiratory disease vaccine for cats |
| CN103517991A (en) * | 2010-10-27 | 2014-01-15 | 昆特拜克股份公司 | Capture of target DNA and RNA by probes comprising intercalator molecules |
| WO2017109045A1 (en) * | 2015-12-23 | 2017-06-29 | Intervet International B.V. | Feline calicivirus vaccine |
| CN107022644A (en) * | 2017-06-14 | 2017-08-08 | 山东省农业科学院农业质量标准与检测技术研究所 | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables |
| CN107099619A (en) * | 2017-05-03 | 2017-08-29 | 上海速创诊断产品有限公司 | A kind of LAMP primer composition thing and its kit for detecting respiratory pathogen |
-
2018
- 2018-12-21 CN CN201811568475.5A patent/CN109811088B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0535740A1 (en) * | 1991-09-30 | 1993-04-07 | Akzo Nobel N.V. | Respiratory disease vaccine for cats |
| CN103517991A (en) * | 2010-10-27 | 2014-01-15 | 昆特拜克股份公司 | Capture of target DNA and RNA by probes comprising intercalator molecules |
| WO2017109045A1 (en) * | 2015-12-23 | 2017-06-29 | Intervet International B.V. | Feline calicivirus vaccine |
| CN107099619A (en) * | 2017-05-03 | 2017-08-29 | 上海速创诊断产品有限公司 | A kind of LAMP primer composition thing and its kit for detecting respiratory pathogen |
| CN107022644A (en) * | 2017-06-14 | 2017-08-08 | 山东省农业科学院农业质量标准与检测技术研究所 | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables |
Non-Patent Citations (3)
| Title |
|---|
| A. LITSTER等: "Detection of feline upper respiratory tract disease pathogens using a commercially available real-time PCR test", 《THE VETERINARY JOURNAL》 * |
| BYEONG-TECK KANG等: "Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter", 《JOURNAL OF VETERINARY SCIENCE》 * |
| 姜侃等: "三重LAMP法检测食品中沙门氏菌、单增李斯特菌和金黄色葡萄球菌", 《食品科学》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110564895A (en) * | 2019-09-11 | 2019-12-13 | 南宁众册生物科技有限公司 | RAA constant-temperature fluorescence detection primer probe set, kit and method for feline herpesvirus FHV-1 |
| CN110643744A (en) * | 2019-11-19 | 2020-01-03 | 南京农业大学 | Quantitative detection method for simultaneously detecting three cat susceptible viruses and primer probe combination thereof |
| CN110643744B (en) * | 2019-11-19 | 2022-10-21 | 南京农业大学 | Quantitative detection method for simultaneously detecting three cat susceptible viruses and primer probe combination thereof |
| CN113388700A (en) * | 2021-06-29 | 2021-09-14 | 苏州艾可瑞动物检测技术服务有限公司 | Kit for detecting FCV (FCV), FPV (FPV) and FHV-1 viruses by using nucleic acid hand-free triple fluorescence RT-LAMP (reverse transcription loop-mediated isothermal amplification) |
| CN113388700B (en) * | 2021-06-29 | 2023-11-10 | 苏州艾可瑞动物检测技术服务有限公司 | Kit for detecting FCV, FPV and FHV-1 virus by using nucleic acid to take triple fluorescence RT-LAMP in hands-free mode |
| RU2802065C1 (en) * | 2022-10-14 | 2023-08-22 | Сергей Александрович Исаев | Set of specific oligodeoxyribonucleotide primers and a fluorescently labeled probe for the orf1 (non-structural protein 1) gene fragment of feline calicivirus (fcv) rna (cdna) for the detection of feline calicivirus (fcv). |
| RU2808641C1 (en) * | 2023-06-19 | 2023-11-30 | Федеральное государственное бюджетное учреждение "Федеральный центр охраны здоровья животных" (ФГБУ "ВНИИЗЖ") | Method of indirect determination of titer of infectious activity of causative agent of infectious feline rhinotracheitis fhv in non-inactivated raw materials for vaccines using polymerase chain reaction and quantitative hybridization-fluorescence detection in real time |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109811088B (en) | 2022-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109811088A (en) | A kind of primer, kit and application detecting cat infection of the upper respiratory tract pathogen | |
| CN103038331B (en) | Reagent fluid dispensing device, and method of dispensing a reagent fluid | |
| JP5080395B2 (en) | Sample container | |
| CN111239400A (en) | Colloidal gold immunochromatographic device for detecting COVID-19 and use method thereof | |
| CN110819736A (en) | Primer and kit for detecting infection of three common pathogens of dog and application of primer and kit | |
| CN101210922A (en) | Method for detecting SPA FC fragment bound mammalian blood serum total IgG by dolloidal gold marker protein A | |
| CN113777299B (en) | Kit containing immunochromatography detection reagent strip and application thereof | |
| CN109946278A (en) | Fluorescent dye DAPI carries out cell DNA to dye quantitative screening for cancer and diagnostic method | |
| Zheng et al. | Microfluidic system for high-throughput immunoglobulin-E analysis from clinical serum samples | |
| CN107365684A (en) | A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method | |
| Assis et al. | Distinct SARS-CoV-2 Antibody Responses Elicited by Natural Infection and mRNA Vaccination | |
| CN110819737A (en) | Primer and kit for detecting cat intestinal infection pathogens and application of primer and kit | |
| CN104730233B (en) | A kind of serum dilution in ELISA detection | |
| CN108165668A (en) | A kind of bird flu and Newcastle Disease virus detection method and its kit | |
| CN104004067A (en) | Antigen for detecting anti-HPV antibody and related immunodetection kit | |
| Eichhorn et al. | Fluorometric method for quantitatively estimating urinary dihydroxyphenylethylamine (dopamine), dihydroxyphenylalanine (dopa), and dihydroxyphenylacetic acid (dopac) | |
| CN108384895A (en) | Porcine rotavirus digital pcr absolute quantitation detection kit | |
| CN108627565A (en) | Bismuth, copper the admixture plates the film strip and the preparation method and application thereof | |
| Derewicz et al. | The role of glomerular morphometric features in pediatric podocytopathies—a single center study | |
| US20220390422A1 (en) | Detection of testing errors in lateral flow assays | |
| CN114113633B (en) | Molecular index and kit for diagnosing risk and evaluating curative effect of prostate cancer | |
| CN106645746B (en) | A kind of screening of syndrome of deficiency of kidney yang animal model biomarker and determine method | |
| Whittfield et al. | Evaluation of the performance of the albumin bromocresol purple reagent. | |
| Watanabe et al. | Method comparison between tube and microcolumn techniques for the indirect antiglobulin test. | |
| Wilson et al. | Verification of the Pathogen 200 v3. 1 protocol on the Roche MagNA Pure 24 Diagnostics for the extraction of DNA from faecal samples with comparison to the Pathogen 200 hp protocol. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |