CN109811071A - It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester - Google Patents
It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester Download PDFInfo
- Publication number
- CN109811071A CN109811071A CN201910135168.6A CN201910135168A CN109811071A CN 109811071 A CN109811071 A CN 109811071A CN 201910135168 A CN201910135168 A CN 201910135168A CN 109811071 A CN109811071 A CN 109811071A
- Authority
- CN
- China
- Prior art keywords
- sequence
- detection
- gene
- blood glucose
- glucose meter
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
That the present invention relates to a kind of based on blood glucose meter detection is label-free, exempts to separate portable gene tester, step 1, building detection carrier, including sensor sequence and sucrose enzyme sequence；Sensor sequence are as follows: TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAACAGAGGAGA TAAAGATGGACACAGGACACAACCTGGCGGCAGCGCAAAAGATGCGTAAA；Sucrose enzyme sequence is to be obtained by the amino acid sequence of high temperature resistant invertase through codon optimization；Sensor sequence is connected with sucrose enzyme sequence, common to import in pET-21a carrier；Step 2 detects testing gene with blood glucose meter with the detection carrier that step 1 constructs.Method of the invention does not need to carry out the purifying of early period and labeling process, operating process are simple；Furthermore invertase itself is not present in detection architecture, and it is relatively low to be compared with the traditional method background leakage.Compared with the gene expression detection mode that original foothold mediates, beta galactosidase, fluorescin, alcohol acetyltransferase, transpeptidase etc. are replaced with high temperature resistant invertase, it is detected using the blood glucose meter of commercialization, more portability, while being able to detect lower mrna concentration.
Description
Technical field
The present invention relates to a kind of gene testers, and in particular to it is a kind of based on blood glucose meter detection it is label-free, exempt to separate
Portable gene tester.
Background technique
With the development in nucleic acid molecules field, a variety of diseases are rapidly and accurately diagnosed using nucleic acid and have become possibility.However,
These detection methods usually require complicated instrument, are unfavorable for realizing portable medical diagnosis on disease.On the market it is only it is a small number of just
Formula diagnosis commodity are taken for establishing and carrying out new portable diagnostic method right and wrong often with having reference value, such as glucose detection
Instrument (blood glucose meter).Currently, blood glucose meter is used for the detection of gene by existing pertinent literature report
(Angew.Chem.Int.Ed.2018,57,1-6；Anal Chem,2015,87,7676-7682；Anal.Chem.,2014,
86,3869-3875；Nat Chem,2011,3,697-703).These methods carry out great expression firstly the need of by invertase, so
Afterwards by it is complicated isolate and purify process after, it is connected with nucleic acid molecules, the nucleic acid molecules with invertase again with it is another
Item has the nucleic acid strand of magnetic ball label.In the presence of object to be measured gene, by nucleic acid strand replacement reaction, by the band of script
There is the hybrid nucleic acid chain of invertase to replace, dissociates into solution.It will not hybridized mutually with marked by magnetic bead nucleic acid chains using magnet
Invertase labeling nucleic acid chain separation come, be eventually adding substrate sucrose carry out enzymic catalytic reaction, detected using blood glucose meter.
The defect of this method is: 1. invertases are present in always during the reaction in detection solution, therefore to be measured being not present
In the case where gene, the invertase with magnetic ball stable bond does not dissociate into solution easily, causes detection architecture back with higher
Scape leakage, that is, when there is no testing gene, blood glucose meter reading still with higher；2. invertase expression and purification early period and and DNA
Connection and DNA and magnetic ball connection procedure are complicated, not easy to operate；3. cannot achieve label-free and exempt from isolated detection.
With the development of synthetic biology, synthetic biology is gradually applied to the detection of gene by scholars.Synthesising biological
It learns detection method and is to may be implemented the label-free of " scene expression " reporter gene relative to existing gene analysis technique, exempt from point
From genetic test.Its detection architecture is mainly made of promoter and reporter gene, in the presence of target gene, can cause report
The expression of gene.Collins seminar, Harvard University once designed a kind of genetic test that initiation is mediated by foothold
Technology, wherein reporter gene is beta galactosidase, fluorescin, alcohol acetyltransferase, transpeptidase etc., can be anti-by colorimetric
It answers, the comparison of fluorescence reading, smell or generate the methods of hydrogel and characterized (Cell, 2014,159,940-954；Cell,
2014,159,925-939；Cell,2016,165,1-12；Sci Adv,2018,4,eaat 5105).
Label-free detection means based on synthesis application of biological method is in the case where no testing gene, invertase not table
It reaches；After testing gene only is added, the expression of reporter gene invertase can be caused, therefore can solve above-mentioned detection method
In high background leakage problem；And compared to the method expressed in advance and mark invertase, synthesis application of biological method is cooperated
Cell free expression system can make detection operation easier.It is reported at present to realize genetic test using synthetic biology
In method, the gene expression that foothold mediates is the simplest, most possibly realizes portable gene diagnosis.But current detection side
Method has two drawbacks in the application: (1) reporter gene used is beta galactosidase, fluorescin, the transfer of ethyl alcohol acetyl
Enzyme, transpeptidase etc.；Cause reporter gene expression by testing gene, so as to pass through chrominance response, fluorescence reading, smell pair
Than or generate the methods of hydrogel and characterized.Above-mentioned characterizing method detects limit when being added without isothermal amplification reactions and is only capable of reaching
30nM.(2) when being detected to new testing gene, since new testing gene sequence is different, in conjunction with foothold not
Together, it in order to make detection sensor that there is higher signal ratio, generally requires to redesign entire sensor sequence, design process ten
Divide complexity.
Summary of the invention
The invention solves in the prior art the technical issues of, provide it is a kind of with more universality and it is highly sensitive based on
Blood glucose meter detection it is label-free, exempt to separate portable gene tester.
In order to solve the above-mentioned technical problem, technical solution of the present invention is specific as follows:
It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester, comprising the following steps:
Step 1, the building for detecting carrier
The detection carrier includes sensor sequence and sucrose enzyme sequence；
The sensor sequence are as follows:
TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAAC AGAGGAGATAAAGATGGAC
ACAGGACACAACCTGGCGGCAGCGCAAAA GATGCGTAAA；
The sucrose enzyme sequence is to be obtained by the amino acid sequence of invertase through codon optimization；Wherein invertase is resistance to height
Warm invertase；
The sensor sequence is connected with sucrose enzyme sequence, it is common to import in pET-21a carrier, complete detection carrier
Building；
Step 2 detects testing gene
Testing gene is carried out amplification reaction, then testing gene amplified production is added to the inspection constructed containing step 1
It surveys in the cell-free detection architecture of carrier and is reacted, extract reaction solution after mix with sucrose that the reaction was continued after reaction, distinguish
It at differential responses time point, extracts reaction solution and is detected with blood glucose meter, can be detected the base to be measured down to unimolecule copy number
Cause completes the detection of testing gene.
In the above-mentioned technical solutions, can NASBA amplified production to testing gene and LAMP amplified production detect.
In the above-mentioned technical solutions, by adding inspection of the transfer probe realization to other testing genes in detection architecture
It surveys, specifically:
The testing gene of script is split into two parts sequence, this two parts sequence can respectively with two other phase not
Two other chain is spatially infinitely furthered, forms a kind of four-way compound by the Sequence Complementary hybridization of pass；What is formed answers
Closing two single stranded ends that object middle reaches separate out can be used as the gene expression that compound initiation chain causes downstream, exercise the list with script
The identical function of chain initiator sequence.
In the above-mentioned technical solutions, when testing gene is enteric bacteria Enterobacter sakazakii ompA gene, the transfer is visited
Needle sequence are as follows:
OmpA-BM-zikv sensor sequence: GACACAGGACATGAAACTGTTCGCCCAGC TGGCTTT；
OmpA-TH-zikv sensor sequence: GTAACCACCGAACGCGCCTGGAGAATAGA GCGAAA.
The beneficial effects of the present invention are:
It is provided by the invention based on blood glucose meter detection it is label-free, exempt to separate portable gene tester and tradition uses
Invertase is compared as label detection target gene, and this method does not need to carry out purifying and the labeling process of early period, operating process
Simply；Furthermore invertase itself is not present in detection architecture, and it is relatively low to be compared with the traditional method background leakage.It is based oneself upon with original
The gene expression detection mode that point mediates is compared, and replaces beta galactosidase, fluorescin, ethyl alcohol acetyl with high temperature resistant invertase
Transferase, transpeptidase etc. are detected, more portability using the blood glucose meter of commercialization, while being able to detect lower gene
Concentration.
With it is provided by the invention based on blood glucose meter detection it is label-free, exempt to separate portable gene tester and detect other
When testing gene, by the omnipotent transfer probe of addition, the sensor sequence of difficult design is had no need to change, it can be straight by transfer
It connects for detecting other testing genes.
Detailed description of the invention
Invention is further described in detail with reference to the accompanying drawings and detailed description.
Fig. 1 is the schematic diagram label-free, that exempt to separate portable gene tester of the invention based on blood glucose meter detection.
Fig. 2 is the building schematic diagram that carrier is detected used in gene tester of the invention.
Fig. 3 is to carry out cell-free detection with the simulation RNA fragment sequence of gene tester of the invention to zika virus
Sucrose Dynamics of Enzyme Catalysis curve graph.
Fig. 4 is the reverse transcription single-stranded DNA sequence that the zika virus of various concentration is detected with gene tester of the invention
Testing result figure.
Fig. 5 is to add other testing genes of transfer probe in detecting in detection architecture with gene tester of the invention
Schematic diagram.
Fig. 6 is after adding transfer probe in detection architecture of the invention with gene tester of the invention for difference
The kinetic curve and end point determination figure of the ompA mimic detection of concentration.
Fig. 7 is to be examined with the constant temperature NASBA amplified production of gene tester of the invention to the zika virus of trace
The kinetic curve and end point determination figure of survey.
Fig. 8 is rugged by the slope for adding transfer probe in detecting trace in detection architecture with gene tester of the invention
The kinetic curve and end point determination figure of the constant temperature LAMP amplified production of the ompA gene of enterobacteria.
Specific embodiment
Invention thought of the invention are as follows: the plasmid of gene tester of the invention firstly the need of building for detection carries
Body is made of Sensor section and invertase part, and no initiator initiation codon of invertase because in the presence of is closed, no
Expression；When be added initiator because after, the initiation codon that is closed of script, sugarcane are opened by the strand replacement reaction that foothold mediates
Carbohydrase expresses (see Fig. 1).
Sensor sequence used in the present invention:
TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAAC AGAGGAGATAAAGATGGAC
ACAGGACACAACCTGGCGGCAGCGCAAAA GATGCGTAAA。
The nucleic acid sequence of saccharase gene used in the present invention can be consulted through codon optimization, original amino acid
Ncbi database (GenBank#AAD36485.1).Sensor sequence is connected with sucrose enzyme sequence, imports pET-21a jointly
In carrier, complete detection plasmid pET-21a-sensor-invertase building (see Fig. 2).
The invertase is high temperature resistant invertase, which can be found in (A Sweet Spo t for
Molecular Diagnostics:Coupling Isothermal Amplification and Strand Exch ange
Circuits to Glucometers,08June 2015,scientific reports,doi:10.1038/
srep11039)。
Gene tester of the invention then detects testing gene with the detection carrier of above-mentioned building, specific to walk
It is rapid as follows:
Testing gene is expanded, testing gene amplified production is then added to the detection constructed with step 1 and is carried
It is reacted in the cell-free detection architecture of body, extracts reaction solution after mixing with sucrose that the reaction was continued after reaction, respectively not
With reaction time point, extract reaction solution and detected with blood glucose meter, can be detected the testing gene of unimolecule copy number, complete to
The detection of cls gene.
The above method can NASBA amplified production to testing gene and LAMP amplified production detect.
In order to verify the feasibility of the detection method, first with the simulation RNA fragment sequence of detection plasmid pair zika virus
Cell-free detection is carried out, it is as follows that zika virus simulates RNA fragment sequence:
GGGCCAGCACAGUGGGAUGAUCGUUAAUGACACAGGACAUGAAACUGAUGAGAAUAGAGCGAAAGUUG
AGAUAACGCCCAAUUCACCAAGAGCCGAAGCCACCCUGGGGGGGUUUGGAAGCCUAGGACUUGAUUGUGAACCGAG
GACAGG。
Reaction system is as follows: Solution A 40%, Solution B 30%, RNase inhibitor 0.5%,
Detection plasmid 24%, RNA trigger 24%；Concentration of component is as follows in end reaction: [detection
Plamed]=2nM, [RNA trigger]=0/500nM.By above-mentioned reaction solution in 37 DEG C of reaction 2h, after the reaction was completed on ice
It stands to terminate reaction.Extract reaction solution and be mixed in 55 DEG C with 500mM sucrose with 1:1 volume ratio and react, respectively 0min, 5min,
10min, 20min time point take 1.5 μ L with the detection of Bayer Contour next blood glucose meter.
The initiation of 500nM RNA determinand is being added it can be seen from the sucrose Dynamics of Enzyme Catalysis curve graph shown in Fig. 3
After sucrose expression of enzymes, only need 5min that can observe the incubation of expression product and sucrose poor with the apparent glucose degree of negative control
It is different, and dextrose equivalent caused by the sucrose substrate for enzymatic activity given expression to is significantly linearly closed as the increase of incubation time is presented
System.But the negative control in experimental result increases phenomenon as the time increases the degree also presented by a small margin, this may be
In cell-free expression system plasmid concentration it is excessively high caused by background leakage phenomenon, need to be optimized expression plasmid
Concentration.
This method can also be used to detect DNA sequence dna, and with the reverse transcription single stranded DNA of zika virus, sequence is as follows: TCGTTAA
TGACACAGGACATGAAACTGATGAGAATAGAGCGAAAGTTGA GATAACGCCCAATTCACCAAGAGCCGAAGCCAC
CCTGG。
The reaction system for detecting DNA sequence dna is identical as RNA, and the plasmid after background optimizes in cell-free expression system is dense
Degree is reduced to 0.5nM, and the testing result for various concentration DNA sequence dna is as shown in figure 4, substrate sucrose concentration is optimized for 1M, instead
Answering the volume ratio of liquid and substrate sucrose is 2:1.The invertase expression quantity that the DNA of 500nM sequence to be measured causes with substrate sucrose
Obtained glucose readings are after reaction 30min significantly to have exceeded the maximum detection threshold value (Fig. 4 A) of blood glucose meter, therefore we
Have detected the invertase expression quantity that the DNA of 500nM various concentration below is caused.According to end point determination as a result, it has been found that, entirely
Reaction system detects limit after optimization can be down to 500pM (Fig. 4 B).
In order to make detection have no need to change the sensing of difficult design by adding omnipotent transfer probe with more universality
Device sequence can be directly used in by transfer and detect other testing genes (Fig. 5).The testing gene of script is split in schematic diagram
At two parts sequence, this two parts sequence can be respectively with the Sequence Complementary hybridization of two other wide of the mark, will in addition
Two chains spatially infinitely further, and form a kind of four-way compound；Two single stranded ends that the compound middle reaches of formation separate out
It can be used as the gene expression that compound initiation chain causes downstream, exercise function identical with the single-stranded initiator sequence of script.
By taking the detection of enteric bacteria Enterobacter sakazakii ompA gene as an example, transfer probe sequence is as follows:
OmpA-BM-zikv sensor sequence: GACACAGGACATGAAACTGTTCGCCCAGCTGGCTTT；
OmpA-TH-zikv sensor sequence: GTAACCACCGAACGCGCCTGGAGAATAGAGCGAAA；
Firstly, using the simulated series of method detection ompA gene, to prove the feasibility of transfer probe,
OmpA gene simulated series are as follows: ompA-mimic:AAGCCAGCTGGGCGCAGGCGCGTTCGGTGGTTAC.
In order to be finally applied to the detection of LAMP amplified reaction, LAMP reaction buffer system, transfer probe are simulated in reaction
And simulated series, with the configuration of 1 × isothermal duplication buffer, reaction process is as follows: firstly, preparing ompA-TH-BM mixed liquor:
OmpA-TH-zikv sensor, ompA-BM-zikv sensor, various concentration ompA-mimic mixed liquor are annealed in 95 DEG C
After 5min, room temperature is down to 0.1 DEG C/s.[ompA-TH-zikv sensor]=208nM, [ompA-BM- in three's mixed liquor
Zikv sensor]=251nM.Then three's mixed liquor is added in cell-free expression response system, Solution A 40%,
Solution B 30%, RNase inhibitor 0.5%, detection plasmid 24%, ompA-TH-BM mixed liquor
24%.It is as follows to react final each component concentration: [ompA-TH-zikv sensor]=50nM, [ompA-BM-zikv sensor]
=40nM, [ompA-mimic]=0/2/5/10/20/50nM.By above-mentioned reaction solution in 37 DEG C of reaction 2h, after the reaction was completed in ice
Upper standing is to terminate reaction.Extract reaction solution and be mixed in 55 DEG C with 1M sucrose with 2:1 volume ratio and react, respectively 0min, 20min,
40min, 60min time point take 1.5 μ L with the detection of Bayer Contour next blood glucose meter.Fig. 6 A is right after transfer probe is added
In the dynamic curve diagram that the ompA mimic of various concentration is detected, it can be seen that background of the addition of transfer probe for reaction
Signal has no apparent influence, and linear growth trend is presented with the increase of incubation time in concentration of glucose；Fig. 6 B is the end of reaction
Point detection, wherein detection limit can be slightly poor compared with than single-stranded, reachable since the efficiency of sequence formation four-way structure in reaction is different
2nM。
Embodiment
The building of detection carrier of the invention:
The sensor sequence are as follows:
TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAACAGAGGAGATAAAGATGGACA
CAGGACACAACCTGGCGGCAGCGCAAAAGATGCGTAAA；
The sucrose enzyme sequence is to be obtained by the amino acid sequence of high temperature resistant invertase through codon optimization, the base after optimization
Cause are as follows:
ATGTTCAAACCGAACTACCACTTCTTCCCGATCACCGGTTGGATGAACGACCCGAACGGTCTGATCTT
CTGGAAAGGTAAATACCACATGTTCTACCAGTACAACCCGCGTAAACCGGAATGGGGTAACATCTGCTGGGGTCAC
GCTGTTTCTGACGACCTGGTTCACTGGCGTCACCTGCCGGTTGCTCTGTACCCGGACGACGAAACCCACGGTGTTT
TCTCTGGTTCTGCTGTTGAAAAAGACGGTAAAATGTTCCTGGTTTACACCTACTACCGTGACCCGACCCACAACAA
AGGTGAAAAAGAAACCCAGTGCGTTGCTATGTCTGAAAACGGTCTGGACTTCGTTAAATACGACGGTAACCCGGTT
ATCTCTAAAGCGCCGGAAGAAGGTACCCACGCTTTCCGTGACCCGAAAGTTAACCGTTCTAACGGTGAATGGCGTA
TGGTTCTGGGTTCTGGTAAAGACGAAAAAATCGGTCGTGTTCTGCTGTACACCTCTGACGACCTGTTCCACTGGAA
ATACGAAGGTGTTATCTTCGAAGACGAAACCACCAAAGAAATCGAATGCCCGGACCTGGTTCGTATCGGTGAAAAA
GACATCCTGATCTACTCTATCACCTCTACCAACTCTGTTCTGTTCTCTATGGGTGAACTGAAAGAAGGTAAACTGA
ACGTTGAAAAACGTGGTCTGCTGGACCACGGTACCGACTTCTACGCTGCTCAGACCTTCTTCGGTACCGACCGTGT
TGTTGTTATCGGTTGGCTGCAGTCTTGGCTGCGTACCGGTCTGTACCCGACCAAACGTGAAGGTTGGAACGGTGTT
ATGTCTCTGCCGCGTGAACTGTACGTTGAAAACAACGAACTGAAAGTTAAACCGGTTGACGAACTGCTGGCTCTGC
GTAAACGTAAAGTTTTCGAAACCGCTAAATCTGGTACCTTCCTGCTGGACGTTAAAGAAAACTCTTACGAAATCGT
TTGCGAATTCTCTGGTGAAATCGAACTGCGTATGGGTAACGAATCTGAAGAAGTTGTTATCACCAAATCTCGTGAC
GAACTGATCGTTGACACCACCCGTTCTGGTGTTTCTGGTGGTGAAGTTCGTAAATCTACCGTTGAAGACGAAGCTA
CCAACCGTATCCGTGCTTTCCTGGACTCTTGCTCTGTTGAATTCTTCTTCAACGACTCTATCGCTTTCTCTTTCCG
TATCCACCCGGAAAACGTTTACAACATCCTGTCTGTTAAATCTAACCAGGTTAAACTGGAAGTTTTCGAACTGGAA
AACATCTGGCTGCTCGAG；
The sensor sequence is connected with sucrose enzyme sequence, common to import in pET-21a carrier, completes the structure of carrier
It builds.
The zika virus of trace is detected using the detection carrier of above-mentioned building.First with NASBA amplified reaction
Artificial synthesized zika viral RNA genes are expanded, amplified production is directly caused to cell-free expression response.
Used amplimer is as follows:
Zika-forward primer:
AATTCTAATACGACTCACTATAGGGAGAAGGGCACAGTGGGATGATCGTTA
Zika-reverse primer:
CCTGTCCTCGGTTCACAATCAA
Reaction system is as follows: Reaction Buffer 33.5%, Nucleotide Mix16.5%, RNase
Inhibitor 0.5%, NASBA primer 12.5 μM of 2%, nuclease free water 2.5%, RNA
Amplicon 20%；In NASBA amplification, the concentration of RNA amplicon is respectively 0/20/200/2,000/20,000 copy
Number.By above-mentioned reaction mixture in 41 DEG C of incubation 10min after 65 DEG C of denaturation 2min, Enzyme Mix25% is then added in 41
DEG C reaction 2h.After reaction, NASBA product is added in cell-free detection (NEB E6800) system, detection architecture is as follows:
Solution A 40%, Solution B 30%, RNase inhibitor 0.5%, detection plasmid 24%,
NASBA product 24%.By above-mentioned reaction solution in 37 DEG C of reaction 2h, after the reaction was completed in stand on ice with terminate reaction.It takes
Reaction solution is mixed in 55 DEG C with 1M sucrose with 2:1 volume ratio and reacts, and respectively at 0min, 20min, 40min, 60min time point, takes
1.5 μ L are with the detection of Bayer Contour next blood glucose meter.
Fig. 7 A is the kinetic curve that NASBA product causes the sucrose enzymatic sucrose substrate generated after cell-free expression
Figure, wherein negative control is that template concentrations are 0 molecule copy number in NASBA reaction, and positive control is that template concentrations are 20,
000 molecule copy number.Fig. 7 B is that cell-free expression caused by different templates molecule copy number generates invertase in NASBA reaction
It is catalyzed glucose end point determination value caused by sucrose.The method combination NASBA constant-temperature amplification it can be seen from the two result figures
Reaction can effectively detect the RNA determinand of trace, minimum to copy to 20 molecules.
In order to prove the universality of this method, transfer probe is introduced in detection carrier of the invention, detects the slope of trace
The ompA gene of rugged enterobacteria.OmpA gene is expanded first with the method for LAMP isothermal duplication, it will be in amplified production
It is applied to cell-free expression system after turning.Entire reaction system simulates genetic test with ompA, by ompA simulation gene finally with
LAMP product replaces (Fig. 8).
Enterobacter sakazakii ompA amplification probe sequence is as follows:
The sequence of ompA_F3 are as follows: TGGTCCCAGTTCCACGATAC
The sequence of ompA_B3 are as follows: GTAACCCAGTTTAGCGGTCA
The sequence of ompA_FIP are as follows: CCAACGTACGGGTTAACCTGGTGACGGTCCGACTCACGAA；
The sequence of ompA_BIP are as follows: TCGAAATGGGCTACGACTGGCTTGTACGCCCTGAGCTTTGA
Fig. 8 A is the dynamic curve diagram of the sucrose enzymatic sucrose substrate generated after the cell-free expression of LAMP product transfer,
Wherein negative control is that template concentrations are 0 molecule copy number in LAMP, and positive control is that template concentrations are 20,000 molecule
Copy number.Fig. 7 B generates sucrose enzymatic sucrose institute for cell-free expression caused by different templates molecule copy number in LAMP reaction
The glucose end point determination value of generation, while the LAMP amplified production that Escherichia coli malB is added is compareed, and finds the method energy
The detection ompA target gene of enough specificity will not generate mistaken diagnosis under the LAMP product interference in other a large amount of genes and show
As can effectively exclude the false positive results in LAMP product.The method can be examined effectively it can be seen from the two result figures
The DNA determinand of trace is surveyed, it is minimum to be copied to 20 molecules.
Obviously, the above embodiments are merely examples for clarifying the description, and does not limit the embodiments.It is right
For those of ordinary skill in the art, can also make on the basis of the above description it is other it is various forms of variation or
It changes.There is no necessity and possibility to exhaust all the enbodiments.And it is extended from this it is obvious variation or
It changes still within the protection scope of the invention.
Claims (4)
1. it is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester, which is characterized in that including following
Step:
Step 1, the building for detecting carrier
The detection carrier includes sensor sequence and sucrose enzyme sequence；
The sensor sequence are as follows:
TTTCGCTCTATTCTCATCAGTTTCATGTCCTGTGTCGGACTTTAGAACAGAGGAGATAAAGATGGACACAGG
ACACAACCTGGCGGCAGCGCAAAAGATGCGTAAA；
The sucrose enzyme sequence is to be obtained by the amino acid sequence of invertase through codon optimization；Wherein invertase is high temperature resistant sugarcane
Carbohydrase；
The sensor sequence is connected with sucrose enzyme sequence, it is common to import in pET-21a carrier, complete the structure of detection carrier
It builds；
Step 2 detects testing gene
Testing gene is carried out amplification reaction, testing gene amplified production is then added to the detection constructed containing step 1 and is carried
It is reacted in the cell-free detection architecture of body, extracts reaction solution after mixing with sucrose that the reaction was continued after reaction, respectively not
It with reaction time point, extracts reaction solution and is detected with blood glucose meter, can be detected the testing gene down to unimolecule copy number, it is complete
At the detection of testing gene.
2. it is according to claim 1 based on blood glucose meter detection it is label-free, exempt to separate portable gene tester, it is special
Sign is, can NASBA amplified production to testing gene and LAMP amplified production detect.
3. it is according to claim 1 or 2 based on blood glucose meter detection it is label-free, exempt to separate portable gene tester,
It is characterized in that, by adding detection of the transfer probe realization to other testing genes in detection architecture, specifically:
The testing gene of script is split into two parts sequence, this two parts sequence can respectively with two other wide of the mark
Two other chain is spatially infinitely furthered, forms a kind of four-way compound by Sequence Complementary hybridization；The compound of formation
Two single stranded ends that middle reaches separate out can be used as the gene expression that compound initiation chain causes downstream, exercise the single stranded primer with script
Send out the identical function of agent sequence.
4. it is according to claim 3 based on blood glucose meter detection it is label-free, exempt to separate portable gene tester, it is special
Sign is, when testing gene is enteric bacteria Enterobacter sakazakii ompA gene, the transfer probe sequence are as follows:
OmpA-BM-zikv sensor sequence: GACACAGGACATGAAACTGTTCGCCCAGCTGGCTTT；
OmpA-TH-zikv sensor sequence: GTAACCACCGAACGCGCCTGGAGAATAGAGCGAAA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910135168.6A CN109811071A (en) | 2019-02-22 | 2019-02-22 | It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910135168.6A CN109811071A (en) | 2019-02-22 | 2019-02-22 | It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109811071A true CN109811071A (en) | 2019-05-28 |
Family
ID=66607307
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910135168.6A Pending CN109811071A (en) | 2019-02-22 | 2019-02-22 | It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109811071A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017205668A1 (en) * | 2016-05-25 | 2017-11-30 | Arizona Board Of Regents On Behalf Of Arizona State University | Portable, low-cost pathogen detection and strain identification platform |
| WO2018026762A1 (en) * | 2016-08-01 | 2018-02-08 | Arizona Board Of Regents On Behalf Of Arizona State University | Ultraspecific riboregulators having robust single-nucleotide specificity and in vitro and in vivo uses thereof |
| CN108004238A (en) * | 2012-11-06 | 2018-05-08 | 哈佛学院院长等 | Ribonucleic acid regulator composition and application method |
| WO2018093898A1 (en) * | 2016-11-15 | 2018-05-24 | Arizona Board Of Regents On Behalf Of Arizona State University | Ultraspecific nucleic acid sensors for low-cost liquid biopsies |
-
2019
- 2019-02-22 CN CN201910135168.6A patent/CN109811071A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108004238A (en) * | 2012-11-06 | 2018-05-08 | 哈佛学院院长等 | Ribonucleic acid regulator composition and application method |
| WO2017205668A1 (en) * | 2016-05-25 | 2017-11-30 | Arizona Board Of Regents On Behalf Of Arizona State University | Portable, low-cost pathogen detection and strain identification platform |
| WO2018026762A1 (en) * | 2016-08-01 | 2018-02-08 | Arizona Board Of Regents On Behalf Of Arizona State University | Ultraspecific riboregulators having robust single-nucleotide specificity and in vitro and in vivo uses thereof |
| WO2018093898A1 (en) * | 2016-11-15 | 2018-05-24 | Arizona Board Of Regents On Behalf Of Arizona State University | Ultraspecific nucleic acid sensors for low-cost liquid biopsies |
Non-Patent Citations (1)
| Title |
|---|
| ANDREW CHING-YUET ET AL: "A comprehensive web tool for toehold switch design", 《BIOINFORMATICS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | Multiplex reverse transcription loop-mediated isothermal amplification combined with nanoparticle-based lateral flow biosensor for the diagnosis of COVID-19 | |
| CN107630109A (en) | A kind of fluorescence quantification PCR primer and kit for detecting Novel pig acute diarrhea syndrome coronavirus | |
| DK0862656T3 (en) | Unimolecular segment amplification and detection | |
| CN112176103A (en) | African swine fever virus fluorescence ERA constant temperature rapid detection kit | |
| CN110904250B (en) | Multiplex fluorescent quantitative PCR primer, kit and detection method for detecting multiple bacteria | |
| CN110358866A (en) | Novel goose astrovirus SYBR Green dye method fluorescent quantificationally PCR detecting kit | |
| Deng et al. | Target-triggered cascade signal amplification for sensitive electrochemical detection of SARS-CoV-2 with clinical application | |
| CN103911463A (en) | Kit for detecting mosquito borne pathogens and detection method thereof | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN103436602A (en) | Kit and method for simultaneous detection of Staphylococcus aureus gene and Escherichia coli gene by using dual molecular beacon-LAMP process | |
| CN111197110A (en) | RPA-FLD method for detecting feline panleukopenia virus | |
| CN103911462B (en) | Identification and detection method for yellow fever, Japanese encephalitis, chikungunya fever and west Nile fever, primers and probes | |
| CN109825519A (en) | A kind of detection carrier based on blood glucose meter detection | |
| Guan et al. | Dual targets-induced specific hemin/G-quadruplex assemblies for label-free electrochemical detection capable of distinguishing Salmonella and its common serotype in food samples | |
| CN112391483A (en) | Nucleic acid sequence, kit and method for detecting plague bacillus by isothermal amplification and application | |
| CN109811071A (en) | It is a kind of based on blood glucose meter detection it is label-free, exempt to separate portable gene tester | |
| CN117368171A (en) | Kit for detecting staphylococcus aureus and application thereof | |
| CN105349696B (en) | Detect kit and the application of Japanese B encephalitis virus nucleic acid | |
| CN105044338B (en) | Method for detecting thrombin based on barometer | |
| CN111172301A (en) | PCR fluorescence detection kit for clostridium difficile toxin B and application thereof | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN110029171A (en) | A kind of kit using stem ring primer detection PIK3CA gene mutation site | |
| CN112553379B (en) | Method and kit for detecting respiratory infectious disease virus based on liquid chip | |
| CN112608983B (en) | Paper-based detection method for exosome | |
| CN105176990B (en) | It is a kind of for the probe of Telomerase activity, method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190528 |
|
| WD01 | Invention patent application deemed withdrawn after publication |