CN109797209B - Specific biomarker of dendritic cells and/or chemotactic states and functions thereof - Google Patents

Abstract

The invention relates to the field of biotechnology, in particular to a specific biomarker of dendritic cells and/or chemotactic states and functions thereof, and provides application of long non-coding RNA (namely lnc-Dpf3) shown in SEQ ID NO. 1 or a complementary or homologous RNA sequence thereof as a biomarker for identifying the dendritic cells and/or the chemotactic states and functions thereof, application of a reagent for detecting the level of the RNA sequence in preparation of a kit for identifying the dendritic cells and/or the chemotactic states and functions thereof, and a corresponding kit and method. The invention provides a convenient and effective specific biomarker and a method for identifying dendritic cells and/or chemotactic states and functions thereof in clinic and scientific research, and has wide application prospect.

Description

Specific biomarker of dendritic cells and/or chemotactic states and functions thereof

Technical Field

The invention relates to the field of biotechnology and medicine, in particular to application and an application method of long-chain non-coding RNA-lnc-Dpf 3 as a novel specific biomarker for identifying dendritic cells and/or chemotactic states and functions of the dendritic cells and/or chemotactic cells.

Background

Mammalian genomes can transcribe a variety of long noncoding RNAs (incrnas), of which only a few are well defined for their sequence and function. In recent years, the role of lncRNA in the physiological process of life and disease process is receiving attention, but the research between lncRNA and immune system is not much, and especially the report of lncRNA in dendritic cells is almost blank.

Dendritic cells are a key bridge for connecting natural immunity and adaptive immunity, and play a key role in the processes of activating the immune response of organisms against pathogens and maintaining autoimmune tolerance. The functional regulation of dendritic cells determines the overall balance of the immune response. Dendritic cells are widely distributed in non-lymphoid tissues and lymphoid tissues, and the in vivo migration of dendritic cells is crucial for their maturation activation and functional regulation. However, more and more studies indicate that the disturbance of dendritic cell migration may lead to excessive accumulation and activation of dendritic cells at the site of inflammation, cause excessive inflammation of tissues and even cause the development of autoimmune diseases. Dendritic cell-associated chemokines and chemokine receptors have become potential diagnostic markers and therapeutic targets for autoimmune diseases.

DC migration is co-regulated by chemokines, cytokines and other inflammatory mediators. Immature DCs distributed in the periphery sense danger signals through their surface pattern recognition receptors, mature activation upon uptake of pathogens, up-regulate chemokine receptor CCR7 expression. CCL19/CCL21 secreted by lymph node stromal cells acts on CCR7 expressed by DCs, promotes DC migration to T cell regions of secondary lymphoid organs, and initiates and regulates T cell-mediated adaptive immune responses. CCL19/CCL21 has been shown to be closely related to the development of various autoimmune diseases such as Multiple Sclerosis (MS), Rheumatoid Arthritis (RA), and Inflammatory Bowel Disease (IBD). The incidence of experimental autoimmune encephalomyelitis and antigen-induced arthritis is obviously weakened in CCL19/CCL21 or a mouse with a gene deletion of a receptor CCR7 thereof, and the activation of DC-mediated Th1 and Th17 cells is obviously reduced. CCL19/CCL 21-dependent DC migration and functional activation therefore play a key role in maintaining the dynamic balance of immune responses and immune regulation.

Previous studies have demonstrated that the chemokines CCL19 and CCL21 induce migration of dendritic cells from the periphery to lymph nodes, and several markers are required to be examined in combination, for example, MHC is detected in combination, in order to determine the chemotactic state of dendritic cells or to identify chemotactic dendritic cells^hiCD11c^intCD40^hiCCR7+, however, there are no specific biomarkers to identify chemotactic dendritic cells.

For convenient clinical and scientific applications, there is an urgent need in the art to develop and study specific expression biomarkers directed to identifying dendritic cells and/or chemotactic dendritic cells and/or their chemotactic state and function.

Disclosure of Invention

The invention aims to provide a biomarker for identifying dendritic cells and/or chemotactic states and functions thereof: lnc-Dpf3 and hybrid or homologous sequences thereof. The invention also aims to provide application of the reagent for detecting lnc-Dpf3 and the hybrid or homologous sequence thereof in preparing a kit for identifying dendritic cells and/or chemotactic states and functions thereof. A third object of the present invention is to provide a method and kit for identifying dendritic cells and/or chemotactic dendritic cells and/or their chemotactic state and function.

The invention screens long non-coding RNA (lncRNA) molecule lnc-Dpf3(Noncode database ID: n274819, GenBank No: AK140952.1, SEQ ID NO:1) specifically expressed by dendritic cells from the first intron of the gene of the mouse Dpf 3. The molecule is highly expressed in the specificity of dendritic cells, and can better distinguish the dendritic cells from other immune cells, such as B cells, CD4+ T cells, natural killer cells and the like. Furthermore, lnc-Dpf3 was upregulated in dendritic cells after stimulation with the chemokines CCL19 and CCL21, in dendritic cells after migration from peripheral tissues to lymph nodes, and in chemotactic dendritic cells more highly than non-chemotactic dendritic cells. Thus, lnc-Dpf3 is able to identify chemotactic dendritic cells and the chemotactic state and function of dendritic cells. The method has wide application prospects in identification and judgment of dendritic cells and/or chemotactic states and functions of the dendritic cells and/or chemotactic dendritic cells and diagnosis of related diseases in clinical and scientific researches, and can be used for judging immune functions, selecting immune treatment schemes (for example, selecting treatment schemes for clinical infection, inflammation, autoimmune diseases, tumors and other immune related diseases) and/or performing prognosis evaluation (for example, performing prognosis evaluation on the immune functions) in a subject. On the basis of this, the present invention has been completed.

In a first aspect of the invention, there is provided the use of an RNA sequence selected from the group consisting of:

(a) 1, long non-coding RNA shown in SEQ ID NO;

(b) a sequence that hybridizes under stringent conditions to the sequence defined in (a);

(c) an RNA sequence having 90% or more sequence identity to the sequence of (a) or (b); and

(d) a homologous sequence of the sequence of (a) or (b) in a non-mouse mammal.

In a second aspect of the invention, there is provided the use of an agent for detecting the level of an RNA sequence selected from the group consisting of:

(a) 1, long non-coding RNA shown in SEQ ID NO;

(b) a sequence that hybridizes under stringent conditions to the sequence defined in (a);

(c) an RNA sequence having 90% or more sequence identity to the sequence of (a) or (b); and

(d) a homologous sequence of the sequence of (a) or (b) in a non-mouse mammal.

In a preferred embodiment of the invention, the RNA sequence is the long non-coding RNA shown in SEQ ID NO. 1.

In some embodiments of the invention, the dendritic cells and/or chemotactic dendritic cells derived therefrom are derived from a mammal, preferably a mouse, human, rat, dog, monkey, chimpanzee, pig, horse, cow, or sheep, more preferably a mouse.

In some embodiments of the invention, the chemotactic state is selected from the group consisting of: expression of MHCII, CD11c, CD40, CCR7 on the cell surface; the function is selected from: dendritic cells migrate following stimulation with the chemokines CCL19 and CCL21 (in vitro), from peripheral tissues to secondary lymph nodes upon pathogen or inflammatory stimulation (in vivo). The expression level of lnc-Dpf3 is positively correlated with the chemotaxis state of dendritic cells. When the expression level of lnc-Dpf3 is increased, the dendritic cells are successfully chemotactic or become chemotactic dendritic cells.

In some embodiments of the invention, the level of the RNA sequence is used for immune function judgment, immunotherapy protocol selection, and/or prognostic assessment.

In some embodiments of the invention, if the level of the RNA sequence in the cell to be identified is higher than in a non-dendritic cell, then the cell is determined to be a dendritic cell; if the cell to be identified is a dendritic cell, the level of said RNA sequence in said cell being measured is increased compared to the level in the cell prior to treatment, indicating that said cell is chemotactic or transformed into a chemotactic dendritic cell; if the level of said RNA sequence in the cell being assayed is increased after treatment of the dendritic cell with the candidate agent or system as compared to that before treatment, then the candidate agent or system is capable of inducing chemotaxis of the dendritic cell or transformation of the dendritic cell towards chemotactic dendritic cell.

In some embodiments of the invention, the non-dendritic cells are one or more selected from the group consisting of: b cell, CD4⁺T cells, natural killer cells.

In some embodiments of the invention, the identifying is performed by one or two or more methods selected from the group consisting of: qRT-PCR, northern blotting, in situ hybridization, biochip technology, flow cytometry, second generation sequencing RNA-seq, preferably qRT-PCR.

In some embodiments of the invention, the agent is one or two or more selected from the group consisting of: probes or primers directed against the RNA sequence, or other detection methods indicated by this sequence.

In some embodiments of the invention, the primers are quantitative primers for qRT-PCR detection, preferably the primers shown in SEQ ID NO. 2 and SEQ ID NO. 3.

In some embodiments of the invention, the probe is a probe for RNA Flow Cytometry detection, preferably a combination of probes shown in SEQ ID NO. 6 to SEQ ID NO. 61.

In some embodiments of the invention, the kit further comprises: other reagents for identifying dendritic cells and/or chemotactic dendritic cells, such as MHCII, CD11c, CD40, CCR7 detection reagents.

In a third aspect of the invention, there is provided a kit for identifying dendritic cells and/or chemotactic states and functions thereof, comprising:

i) an agent for detecting the level of an RNA sequence selected from the group consisting of:

(a) 1, long non-coding RNA shown in SEQ ID NO;

(b) a sequence that hybridizes under stringent conditions to the sequence defined in (a);

(c) an RNA sequence having 90% or more sequence identity to the sequence of (a) or (b); and

(d) a homologous sequence of the sequence of (a) or (b) in a non-mouse mammal;

ii) a container containing i) the reagent.

In some embodiments of the invention, the identifying is performed by one or two or more methods selected from the group consisting of: qRT-PCR, northern blotting, in situ hybridization, biochip technology, flow cytometry, second generation sequencing RNA-seq, preferably qRT-PCR.

In some embodiments of the invention, the agent is one or two or more selected from the group consisting of: probes or primers directed against the RNA sequence, or other detection methods indicated by this sequence.

In some embodiments of the invention, the primers are quantitative primers for qRT-PCR detection, preferably the primers shown in SEQ ID NO. 2 and SEQ ID NO. 3.

In some embodiments of the invention, the probe is a probe for RNA Flow Cytometry detection, preferably a combination of probes shown in SEQ ID NO. 6 to SEQ ID NO. 61.

In some embodiments of the invention, the kit further comprises: other reagents for identifying dendritic cells and/or chemotactic dendritic cells, such as MHC II, CD11c, CD40, CCR7 detection reagents.

In a fourth aspect of the invention, there is provided a method of identifying dendritic cells and/or chemotactic dendritic cells and/or their chemotactic state and function, or an agent or system capable of inducing the production of dendritic cells and/or chemotactic dendritic cells, said method comprising the step of detecting the level of an RNA sequence selected from the group consisting of:

(a) 1, long non-coding RNA shown in SEQ ID NO;

(b) a sequence that hybridizes under stringent conditions to the sequence defined in (a);

(c) an RNA sequence having 90% or more sequence identity to the sequence of (a) or (b); and

(d) a homologous sequence of the sequence of (a) or (b) in a non-mouse mammal.

In some embodiments of the invention, the method further comprises:

comparing the level of the RNA sequence in the cell to be identified with the level of the RNA sequence in a non-dendritic cell, or comparing the level of the RNA sequence in the cell to be identified prior to treatment with the level of the RNA sequence in the cell to be identified for a different time period or stage of treatment;

wherein if the level of said RNA sequence in the cell to be identified is higher than that in a non-dendritic cell, it is an indication that the cell being tested is a dendritic cell;

if the cell to be identified is a dendritic cell, the level of said RNA sequence in said cell being measured is increased compared to the level in the cell prior to treatment, indicating that said cell is chemotactic or transformed into a chemotactic dendritic cell;

if the level of said RNA sequence in the cell being assayed is increased after treatment of the dendritic cell with the candidate agent or system as compared to that before treatment, then the candidate agent or system is capable of inducing chemotaxis of the dendritic cell or transformation of the dendritic cell towards chemotactic dendritic cell.

The expression level of lnc-Dpf3 is positively correlated with the chemotaxis state of dendritic cells. When the expression level of lnc-Dpf3 is increased, the dendritic cells are successfully chemotactic or called chemotactic dendritic cells.

All numerical ranges provided herein are intended to expressly include all numbers between the end points of the ranges and numerical ranges there between. The features mentioned with reference to the invention or the features mentioned with reference to the embodiments can be combined. All the features disclosed in this specification may be combined in any combination, and each feature disclosed in this specification may be replaced by alternative features serving the same, equivalent or similar purpose. Thus, unless expressly stated otherwise, the features disclosed are merely generic examples of equivalent or similar features.

As used herein, "comprising," having, "or" including "includes" comprising, "" consisting essentially of … …, "" consisting essentially of … …, "and" consisting of … …; "consisting essentially of … …", "consisting essentially of … …", and "consisting of … …" are subordinate concepts of "comprising", "having", or "including".

As used herein, the term "expression" in the description of lnc-Dpf3 refers to its RNA level.

Lnc-Dpf3 and hybrid and homologous sequences thereof

As used herein, the term "lnc-Dpf 3" refers to (a) a long non-coding RNA molecule (lncRNA) specifically expressed by dendritic cells, the sequence of which is shown in SEQ ID NO: 1; (b) a sequence that hybridizes under stringent conditions to the sequence defined in (a); (c) an RNA sequence having 90% or more sequence identity to the sequence of (a) or (b); and (d) a sequence homologous to the sequence in (a) or (b) in a non-mouse mammal.

In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more.

The full-length RNA sequence of the present invention or a fragment thereof can be obtained by PCR amplification, recombination, or artificial synthesis. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods.

Reagent kit

Also provided in the present invention are kits for identifying dendritic cells and/or chemotactic states and functions thereof, comprising (i) one or more reagents for detecting the molecular marker lnc-Dpf3 of the invention; and (ii) a container containing the reagent.

The detection method used in the present invention may employ an RNA detection method commonly used in the art as long as the method can detect the level or change in the level of lnc-Dpf3, and these methods include, but are not limited to: qRT-PCR, RNA blotting, in situ hybridization, biochip technology, flow cytometry and other detection methods, and those skilled in the art can select the detection method according to the needs.

Reagents or reagent sets for detecting the level of lnc-Dpf3 can be provided in kits as needed according to a variety of detection principles and methods. In the present invention, the "reagent set" refers to a combination of reagents including a plurality of reagents required for detection.

In addition, the kit of the present invention may further include, as necessary: containers, controls (including positive or negative controls), instructions for use, buffers, and the like, which can be selected by one of skill in the art as the case may be.

The invention has the advantages that:

1. identifying a specific molecular marker lnc-Dpf3 capable of identifying dendritic cells and/or chemotactic states and functions thereof;

2. provides a simple and effective tool and method for the application and research of dendritic cells and/or chemotactic states and functions thereof in clinic and scientific research, and has wide application prospect.

Drawings

FIG. 1: and (3) qRT-PCR detection of the expression level of lnc-Dpf3 in various immune cells. The results shown in the figure are mean ± standard deviation (n ═ 3).

FIG. 2: and (3) carrying out qRT-PCR detection on the expression quantity of lnc-Dpf3 of dendritic cells at different time points of stimulation of chemokines CCL19 and CCL 21. The results shown in the figure are mean ± standard deviation (n ═ 3).

FIG. 3: lnc-Dpf3 was detected by flow cytometry on chemotactic and non-chemotactic dendritic cells in lymph nodes. The results shown in the figure are mean ± standard deviation (n ═ 3).

FIG. 4: lnc-Dpf3 was detected by flow cytometry during migration of dendritic cells from peripheral lymph nodes. The results shown in the figure are mean ± standard deviation (n ═ 3).

Detailed Description

The following examples are provided to illustrate specific embodiments of the present invention.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make appropriate modifications and alterations to the present invention, which fall within the scope of the invention.

The experimental procedures for the conditions not specified in the examples below can be carried out by methods conventional in the art, for example, by referring to the molecular cloning, A Laboratory Manual, New York, Cold Spring Harbor Laboratory Press, 1989 or according to the conditions recommended by the supplier. Methods for sequencing DNA are conventional in the art and tests are also available from commercial companies.

Unless otherwise indicated, percentages and parts are by weight. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Example 1 dendritic cell culture Process

Mouse bone marrow cells were cultured in a cell culture medium [ RPMI-1640(PAA) containing 10% (v/v) FCS (PAA), 100ng/mL mouse GM-CSF, 10ng/mL mouse IL-4 cytokine (R & D Systems, Minneapolis, MN) ] at 37 ℃ for six days, and after 24 hours of stimulation with LPS (100ng/mL, sigma), mature dendritic cells were induced, and then sorted with anti-CD 11c magnetic beads (Miltenyi Biotech) to obtain purified dendritic cells.

Example 2: lnc-Dpf3 quantitative real-time PCR (qRT-PCR) detection

According to literature, CCL19 and CCL21 act on the surface CCR7 of dendritic cells, inducing chemotactic migration (Ohl, l., Mohaupt, m., Czeloth, n., Hintzen, g., Kiafard, z., Zwirner, j., Blankenstein, t., Henning, g., and)

R.(2004).CCR7governs skin dendritic cell migration under inflammatory and steady-state conditions.Immunity 21,279-288.)。

Dendritic cells obtained by sorting with CD11c magnetic beads in example 1 or dendritic cells that received CCL19(50ng/ml) and CCL21(50ng/ml) (R & D) stimulation at each time point were sampled for RNA samples by TRIzol (Invitrogen). The qRT-PCR was performed using SYBR RT-PCR kit (Takara, SYBR Green Realtime PCR Master Mix Code: QPK-201) on a LightCycler (Roche, Inc.) real-time quantitative PCR instrument.

The quantitative primers for the qnT-PCR detection of lnc-Dpf3 are as follows:

5'-GTGCCACCTACTGTACACCT-3' (upstream, SEQ ID NO: 2);

5'-TGGGCACTCAGGTGCAGTAT-3' (downstream, SEQ ID NO: 3).

Reverse transcription reaction parameters: 20 minutes at 42 ℃ and 5 minutes at 99 ℃.

qRT-PCR reaction parameters: 15 seconds at 95 ℃, 10 seconds at 57 ℃, 2 seconds at 68 ℃, 30 seconds at 72 ℃ and 40 cycles.

Relative quantification of RNA was calculated using the 2- Δ Δ Ct method (with U6 as internal reference).

The quantitative primers for U6qRT-PCR detection are as follows:

5'-CTCGCTTCGGCAGCACA-3' (upstream, SEQ ID NO: 4);

5'-AACGCTTCACGAATTTGCGT-3' (downstream, SEQ ID NO: 5).

The test results are shown in fig. 1 and 2.

The data in fig. 1 show: lnc-Dpf3 is only highly expressed in dendritic cells and is not expressed or is expressed in very low amounts in other immune cells.

B cells were isolated from mouse spleen cells using anti-CD 19 magnetic beads (Miltenyi Biotech); CD4⁺T cells were isolated from mouse spleen cells using anti-CD 4 magnetic beads (Miltenyi Biotech); natural killer cells were isolated from mouse spleen cells using anti-DX 5 magnetic beads (Miltenyi Biotech).

The data in fig. 2 show: the expression level of lnc-Dpf3 is continuously up-regulated in dendritic cells stimulated by CCL19 and CCL21 for 12-72 hours, and reaches the highest peak at 96 hours after stimulation, which is three times of the expression level in unstimulated dendritic cells.

Example 3: flow cytometric detection of lnc-Dpf3 expression levels in chemotactic dendritic cells in draining lymph nodes following FITC skin stimulation

100 microliters of 5mg/ml FITC (Invitrogen, 50:50(v/v) acetone-dibutyl phthalate (Sigma Aldrich)) was applied to the dehaired right dorsal skin of mice, and right inguinal lymph nodes were harvested at different time points, FITC + cells were chemotactic dendritic cells, and FITC-cells were non-chemotactic dendritic cells. The expression level of lnc-Dpf3 in chemotactic dendritic cells at different time points after FITC smearing was examined by flow cytometry.

The labeling of the cell flow antibodies used was performed according to its standard protocol. The flow cytometry was performed using FACS LSRII flow cytometer, software facsdiva (bd biosciences). Specific procedures can be found in a paper previously published in this laboratory (Liu, J. et al, Rhbdd3controls automation by applying the production of IL-6by digital cells via K27-linked authentication of the regulator NEMO. Nature immunology 2014; 15: 612. 622.). RNA Flow Cytometry labeling and detection of lnc-Dpf3, labeling with lnc-Dpf3 specific probe (LE probe is label extender probe for signal amplification, BL probe is blocker probe for preventing non-specific signal amplification), adopting

RNA Assay Kit (Thermo Fisher Corp.) was performed according to its standard protocol.

The probe for RNA Flow Cytometry detection of lnc-Dpf3 was:

LE probe tcatagatggtctctctatcacttcct (5'-3') (SEQ ID NO:6)

LE probe aataggttcctgttgagtgaccag (5'-3') (SEQ ID NO:7)

LE probe ttaactgtaactcagtcaaacgtactaag (5'-3') (SEQ ID NO:8)

LE probe ggtcacagatggctatagagatgc (5'-3') (SEQ ID NO:9)

LE probe gccagagaagcttgtctttgtgat (5'-3') (SEQ ID NO:10)

LE probe gcgctgctgtccctgttg (5'-3') (SEQ ID NO:11)

LE probe ccgttgatgcccataggtga (5'-3') (SEQ ID NO:12)

LE probe cccatcagatcaccctctaactaa (5'-3') (SEQ ID NO:13)

LE probe gctgttttggctaaactgatgtg (5'-3') (SEQ ID NO:14)

LE probe ggtggagtggaaaagctacttct (5'-3') (SEQ ID NO:15)

BL probe aggctggggaggtcatgg (5'-3') (SEQ ID NO:16)

BL probe acaaatcaagccaaaagcctg (5'-3') (SEQ ID NO:17)

LE probe aggacaaaattcatgtctgggtc (5'-3') (SEQ ID NO:18)

LE probe cgcctgattatatttgatacctaatttac (5'-3') (SEQ ID NO:19)

BL probe gggggttgaacaactgtttcc (5'-3') (SEQ ID NO:20)

LE probe gcatcagtgacaagcctgttatg (5'-3') (SEQ ID NO:21)

LE probe caagcctgacgagtcaatggt (5'-3') (SEQ ID NO:22)

LE probe ctgtgtgtaataatactgcctggc (5'-3') (SEQ ID NO:23)

LE probe ggaggagtcatactcagctatggtct (5'-3') (SEQ ID NO:24)

LE probe cctaggggagaattcccaaga (5'-3') (SEQ ID NO:25)

LE probe cctcggaggtatgcaaggct (5'-3') (SEQ ID NO:26)

BL probe aagcttccttcttactggctagc (5'-3') (SEQ ID NO:27)

LE probe caggctagacctgggctgg (5'-3') (SEQ ID NO:28)

LE probe ccttgattacaggacatgaagaatt (5'-3') (SEQ ID NO:29)

BL probe atcaccaaagacaccaatggg (5'-3') (SEQ ID NO:30)

BL probe gtagcactagactttattacctaattacct (5'-3') (SEQ ID NO:31)

LE probe tgctattagctctgcaccagaacta (5'-3') (SEQ ID NO:32)

LE probe ccagaacactacaggaagttgtcac (5'-3') (SEQ ID NO:33)

BL probe ggaggtccctgaggccc (5'-3') (SEQ ID NO:34)

LE probe actgcctcaccacttggtcag (5'-3') (SEQ ID NO:35)

LE probe ccgtaccaggggtgggat (5'-3') (SEQ ID NO:36)

LE probe agagccataggttattaaagaaatagtc (5'-3') (SEQ ID NO:37)

LE probe atgaggtagataaagatgctccca (5'-3') (SEQ ID NO:38)

BL probe ttgcttttcatttttatgtgtttca (5'-3') (SEQ ID NO:39)

BL probe aggatattatcagaaaaaaaaaaaagtag (5'-3') (SEQ ID NO:40)

LE probe aaataaactaagtgaaaatgtataaccct (5'-3') (SEQ ID NO:41)

LE probe gcaacttttgggtggagaaaag (5'-3') (SEQ ID NO:42)

BL probe agcccaggacacttggaaaa (5'-3') (SEQ ID NO:43)

BL probe ccctttataataaaactaaaatataaaagatat (5'-3') (SEQ ID NO:44)

LE probe ttcggtaaaaatggctttatatca (5'-3') (SEQ ID NO:45)

LE probe cagtagcctcaaagtataatgtgtgc (5'-3') (SEQ ID NO:46)

BL probe aggccgtatgggggtgg (5'-3') (SEQ ID NO:47)

LE probe ttatgggagggagagaaagagag (5'-3') (SEQ ID NO:48)

LE probe tcaaataaaaagaaaacaaagtgca (5'-3') (SEQ ID NO:49)

BL probe ggattgggctgtgggtatattg (5'-3') (SEQ ID NO:50)

BL probe ccccctggtactgtgaataaaaag (5'-3') (SEQ ID NO:51)

LE probe atattcaaagccttggattcga (5'-3') (SEQ ID NO:52)

LE probe ctcatacagctcttatctacccagc (5'-3') (SEQ ID NO:53)

LE probe aagtaggattacaggttgggattatag (5'-3') (SEQ ID NO:54)

LE probe catatccacacttgaaataccttattta (5'-3') (SEQ ID NO:55)

BL probe tatcaagagaggtgaaattaaataaatta (5'-3') (SEQ ID NO:56)

BL probe ggtaagaattgaaaatcatctaaattcc (5'-3') (SEQ ID NO:57)

LE probe gcatattcgatttttcccattga (5'-3') (SEQ ID NO:58)

LE probe gcacacgtgacttatggggaaa (5'-3') (SEQ ID NO:59)

LE probe cctgatgactatacatgctaaaaatgg (5'-3') (SEQ ID NO:60)

LE probe catacaaacttcagaaataactgagaagt (5'-3') (SEQ ID NO:61)

The test results are shown in fig. 3 and 4.

The data in fig. 3 shows: after FITC smearing, the expression level of lnc-Dpf3 of chemotactic dendritic cells is obviously increased compared with that of non-chemotactic dendritic cells.

The data in fig. 4 shows: after FITC smearing, the expression level of lnc-Dpf3 in chemotactic dendritic cells is continuously increased within 48-72 hours.

The above results show that:

lnc-Dpf3 can be used as a specific biomarker for identifying dendritic cells and chemotactic states thereof, and the expression level of the biomarker can be used for distinguishing chemotactic dendritic cells from non-chemotactic dendritic cells and identifying the chemotactic states and functions of the dendritic cells.

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full range of equivalents.

Sequence listing

<110> second military medical university of China people liberation army

<120> a specific biomarker for dendritic cells and/or chemotactic dendritic cells and/or their chemotactic state and function

<130> /

<160> 61

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4076

<212> DNA

<213> mouse (Mus musculus)

<400> 1

ggggagggag gaagcaagag aggattctta atcctgggag caggaatgag tgcagaaaat 60

gccctgggaa cttaagattc ccccggttca tgtcagcgca cagcagccca tatataaccc 120

tgggcaagct taatcctcgc ttccccggct tatctcagcc tcacattcgt gggctcacca 180

gcccggagtc tctttggatg ttggccaggc ctgctgggaa tggtaagagc tgagacaggg 240

acagaaactc acgtccttgc atgttggaat gaggcctcct tcctctccca ctttcctggc 300

ctttagattt tcctcctggc attggcacgt aggcttcctg gcctcacatc tctaatcttt 360

tgaagaaggg agactctgat ctcaggtttg caggaggctg tgtcagcgat gcagatgatt 420

cgaggtgagc agaggcagaa tggtagtagt tgtactttct cttttggttg tttggtgacg 480

gggtttcaca atccctaact caggctggcc ttgaactctt tatgtagctt gggctgggtc 540

tgagcttggc aaccctcctg ctgccgcttt tggactcggt tccaaatcct gacatttcag 600

gcttatgcca acaaggctgg cttaggtgtc actttgaaat cccggctgca gtcttgtgag 660

tttaaaacct tccccgagtt tctcttttcc tagctaactt ggatttttat gaggaatggg 720

aaggtctcat gagagcaaac gattctggga agctgacaga ggccatgttg gggatcttgg 780

gcttgtactg gatgtgtggg caggcaggtg gcgcctctat ccttctcctc tctcgccttt 840

tctctgggtt gggtttacag ctatgacccg ccctcccctg acccctaggt ttccccttta 900

gaacagctgt aaaggtcaca gcttgctttt gaagatacgt ggtatttcta gaatggcttc 960

cattctttgg acaagaagct gagttgtacc taaccttaac tcccttcctc ttcctctcac 1020

attctttctg ccccttcctc tgccatgttc cctgaccgtg gaggaagtga tagagagacc 1080

atctatgact ggtcactcaa caggaaccta ttcttagtac gtttgactga gttacagtta 1140

agcatctcta tagccatctg tgaccatcac aaagacaagc ttctctggcc aacagggaca 1200

gcagcgctca cctatgggca tcaacggtta gttagagggt gatctgatgg gcacatcagt 1260

ttagccaaaa cagcagaagt agcttttcca ctccacccca tgacctcccc agcctcaggc 1320

ttttggcttg atttgtgacc cagacatgaa ttttgtcctg taaattaggt atcaaatata 1380

atcaggcggg aaacagttgt tcaacccccc ataacaggct tgtcactgat gcaccattga 1440

ctcgtcaggc ttggccaggc agtattatta cacacagaga ccatagctga gtatgactcc 1500

tcctcttggg aattctcccc taggagcctt gcatacctcc gagggctagc cagtaagaag 1560

gaagcttcca gcccaggtct agcctgaatt cttcatgtcc tgtaatcaag gcccattggt 1620

gtctttggtg ataggtaatt aggtaataaa gtctagtgct actagttctg gtgcagagct 1680

aatagcagtg acaacttcct gtagtgttct gggggcctca gggacctccc tgaccaagtg 1740

gtgaggcagt atcccacccc tggtacggga ctatttcttt aataacctat ggctcttggg 1800

agcatcttta tctacctcat tgaaacacat aaaaatgaaa agcaacacaa cacacttttt 1860

tattagtatt tcaaatatca gattccttta tggcaccccc cctccccacc agcttccccc 1920

ttcctcttgt ctccttgtcc agagttgtgt gacttctttt ctactttttt tttttttctg 1980

ataatatcct agggttatac attttcactt agtttatttc ttttctccac ccaaaagttg 2040

cttttccaag tgtcctgggc tatatctttt atattttagt tttattataa agggtgatat 2100

aaagccattt ttaccgaagc acacattata ctttgaggct actgccaccc ccatacggcc 2160

tctctctttc tctccctccc ataatgcact ttgttttctt tttatttgac aatataccca 2220

cagcccaatc cctttttatt cacagtacca gggggtcgaa tccaaggctt tgaatatgct 2280

gggtagataa gagctgtatg agctataatc ccaacctgta atcctacttt aaataaggta 2340

tttcaagtgt ggatatgtaa tttatttaat ttcacctctc ttgataggaa tttagatgat 2400

tttcaattct tacctcaatg ggaaaaatcg aatatgcttt ccccataagt cacgtgtgcc 2460

catttttagc atgtatagtc atcaggactt ctcagttatt tctgaagttt gtatgtaata 2520

tgaagtgagt gaattgaaag atatctgtta tgttcttacc ttggacaaat atggatctct 2580

gactgttttc ctgatggttt gttttagatc attttttttt ctttctttct ttctttcttt 2640

ctttctttct ttcttttttt tttttttttt ttttttggtt tttcgagaca gggtttctct 2700

ttatagctct gtctgtcctg gagctcactt tgtagaccag gctggcctcg aactcagaaa 2760

tgcctctgcc tcccaagtgc tgggattaaa ggcgtgcgcc actatgcccg gcagatcatt 2820

tattttttta attgaaaaat aaaaataaaa tttaagtgta taagtatttt gtcttcatgt 2880

atgtctgtat accacatggg tgcctggtga ccatgaggcc caaagagtgg catctgatcc 2940

tctgggacag aaggttgtga gcctctatgt tggtgctggg aattgaacct gtgtcctctc 3000

aaagagcagc cagaactctt aaatgcttag ccatctttcc agccctctaa atgatttctt 3060

gttggtataa atgagtcagt aacaaaagtt gtatgtacat ttctgctaca tgtctctgca 3120

catagaggcc agaaggcaac attaggtgtc ttcttcagtc tttctctact ttgagaaaga 3180

gtctctcact aaactggagc tggctgattt ggctagagta gctgaccagt gagccccagg 3240

gatctacctg cttatctcct cttctccagc tctgggattg caagtgttcc cgatcatatc 3300

tggcttttgc aggggtgctg gagaaaggaa cacaggtctt catgcttgga caggaaatat 3360

tcactgacca ggacattctg ctggtcccta aatatcctct ttggactggc tcgtttttta 3420

aatcattcct tagcacagtt tcctaaaatt ggcttaacta ttctgaaaat tgctgtatta 3480

ttaatttcct gttaatggga taaagtactg tgacgaagat aacttgtaga agagagagtt 3540

tgcatttggg cttatggttc cagagtggtg agcccatcac cacagggagg cacggcagca 3600

agcctccctc atggccacag aagcaggaag ctgagggatc gatcacagct caactgcaag 3660

cataaagcag agagagctgc aaatcacgtg aggctaacga ttgtgaagct cagttccagt 3720

gccacttcct tcagcaaggt cacacttccc aagccttccc aaacagtgcc acctactgta 3780

cacctggtgt tcatgtatct gagcctgtga gggacatgtc tcatttaaat caccacagtc 3840

tttaaggctc tggaccttta ttgctgattc atagtcagaa tataaaattt ccattcttat 3900

actgcacctg agtgcccatc tgtccgcatg ctgctaacat ttttaccaag acagaaacaa 3960

agaggtgctg agatggtatg tgaaacagtg acttattgta ctaattcttt tagttagcta 4020

ttatacttgt ttctttacct cgtgaatttc acatcaccca ttccaaaaaa aaaaaa 4076

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 2

gtgccaccta ctgtacacct 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

tgggcactca ggtgcagtat 20

<210> 4

<211> 17

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

ctcgcttcgg cagcaca 17

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

aacgcttcac gaatttgcgt 20

<210> 6

<211> 27

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

tcatagatgg tctctctatc acttcct 27

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

aataggttcc tgttgagtga ccag 24

<210> 8

<211> 29

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

ttaactgtaa ctcagtcaaa cgtactaag 29

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 9

ggtcacagat ggctatagag atgc 24

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

gccagagaag cttgtctttg tgat 24

<210> 11

<211> 18

<212> DNA

<213> Artificial sequence (Artificial)

<400> 11

gcgctgctgt ccctgttg 18

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 12

ccgttgatgc ccataggtga 20

<210> 13

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 13

cccatcagat caccctctaa ctaa 24

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 14

gctgttttgg ctaaactgat gtg 23

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 15

ggtggagtgg aaaagctact tct 23

<210> 16

<211> 18

<212> DNA

<213> Artificial sequence (Artificial)

<400> 16

aggctgggga ggtcatgg 18

<210> 17

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 17

acaaatcaag ccaaaagcct g 21

<210> 18

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 18

aggacaaaat tcatgtctgg gtc 23

<210> 19

<211> 29

<212> DNA

<213> Artificial sequence (Artificial)

<400> 19

cgcctgatta tatttgatac ctaatttac 29

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 20

gggggttgaa caactgtttc c 21

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 21

gcatcagtga caagcctgtt atg 23

<210> 22

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 22

caagcctgac gagtcaatgg t 21

<210> 23

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 23

ctgtgtgtaa taatactgcc tggc 24

<210> 24

<211> 26

<212> DNA

<213> Artificial sequence (Artificial)

<400> 24

ggaggagtca tactcagcta tggtct 26

<210> 25

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 25

cctaggggag aattcccaag a 21

<210> 26

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 26

cctcggaggt atgcaaggct 20

<210> 27

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 27

aagcttcctt cttactggct agc 23

<210> 28

<211> 19

<212> DNA

<213> Artificial sequence (Artificial)

<400> 28

caggctagac ctgggctgg 19

<210> 29

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 29

ccttgattac aggacatgaa gaatt 25

<210> 30

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 30

atcaccaaag acaccaatgg g 21

<210> 31

<211> 30

<212> DNA

<213> Artificial sequence (Artificial)

<400> 31

gtagcactag actttattac ctaattacct 30

<210> 32

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 32

tgctattagc tctgcaccag aacta 25

<210> 33

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 33

ccagaacact acaggaagtt gtcac 25

<210> 34

<211> 17

<212> DNA

<213> Artificial sequence (Artificial)

<400> 34

ggaggtccct gaggccc 17

<210> 35

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 35

actgcctcac cacttggtca g 21

<210> 36

<211> 18

<212> DNA

<213> Artificial sequence (Artificial)

<400> 36

ccgtaccagg ggtgggat 18

<210> 37

<211> 28

<212> DNA

<213> Artificial sequence (Artificial)

<400> 37

agagccatag gttattaaag aaatagtc 28

<210> 38

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 38

atgaggtaga taaagatgct ccca 24

<210> 39

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 39

ttgcttttca tttttatgtg tttca 25

<210> 40

<211> 29

<212> DNA

<213> Artificial sequence (Artificial)

<400> 40

aggatattat cagaaaaaaa aaaaagtag 29

<210> 41

<211> 29

<212> DNA

<213> Artificial sequence (Artificial)

<400> 41

aaataaacta agtgaaaatg tataaccct 29

<210> 42

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 42

gcaacttttg ggtggagaaa ag 22

<210> 43

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 43

agcccaggac acttggaaaa 20

<210> 44

<211> 33

<212> DNA

<213> Artificial sequence (Artificial)

<400> 44

ccctttataa taaaactaaa atataaaaga tat 33

<210> 45

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 45

ttcggtaaaa atggctttat atca 24

<210> 46

<211> 26

<212> DNA

<213> Artificial sequence (Artificial)

<400> 46

cagtagcctc aaagtataat gtgtgc 26

<210> 47

<211> 17

<212> DNA

<213> Artificial sequence (Artificial)

<400> 47

aggccgtatg ggggtgg 17

<210> 48

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 48

ttatgggagg gagagaaaga gag 23

<210> 49

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 49

tcaaataaaa agaaaacaaa gtgca 25

<210> 50

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 50

ggattgggct gtgggtatat tg 22

<210> 51

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 51

ccccctggta ctgtgaataa aaag 24

<210> 52

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 52

atattcaaag ccttggattc ga 22

<210> 53

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 53

ctcatacagc tcttatctac ccagc 25

<210> 54

<211> 27

<212> DNA

<213> Artificial sequence (Artificial)

<400> 54

aagtaggatt acaggttggg attatag 27

<210> 55

<211> 28

<212> DNA

<213> Artificial sequence (Artificial)

<400> 55

catatccaca cttgaaatac cttattta 28

<210> 56

<211> 29

<212> DNA

<213> Artificial sequence (Artificial)

<400> 56

tatcaagaga ggtgaaatta aataaatta 29

<210> 57

<211> 28

<212> DNA

<213> Artificial sequence (Artificial)

<400> 57

ggtaagaatt gaaaatcatc taaattcc 28

<210> 58

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 58

gcatattcga tttttcccat tga 23

<210> 59

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 59

gcacacgtga cttatgggga aa 22

<210> 60

<211> 27

<212> DNA

<213> Artificial sequence (Artificial)

<400> 60

cctgatgact atacatgcta aaaatgg 27

<210> 61

<211> 29

<212> DNA

<213> Artificial sequence (Artificial)

<400> 61

catacaaact tcagaaataa ctgagaagt 29

Claims (5)

1. The application of the reagent for detecting the level of the long non-coding RNA shown in SEQ ID NO. 1 in the preparation of a kit for identifying dendritic cells and/or chemotactic states thereof; the chemotactic state is selected from the group consisting of: expression of MHCII, CD11c, CD40, CCR7 on the cell surface.

2. The use according to claim 1, wherein said dendritic cells are derived from a mammal.

3. The use according to claim 1, wherein a cell to be identified is a dendritic cell if the level of said RNA sequence in the cell is higher than in a non-dendritic cell; if the level of the RNA sequence in the cell to be identified is higher than that of a non-chemotactic dendritic cell, indicating that the cell to be identified is a chemotactic dendritic cell;

if the cell to be identified is a dendritic cell and the level of said RNA sequence is increased after treatment, then it is an indication that the dendritic cell is being transformed into a chemotactic dendritic cell, and that the treatment induces chemotaxis of the dendritic cell or transformation into a chemotactic dendritic cell.

4. The use according to claim 1, wherein the agent is one or two selected from the group consisting of: probes or primers directed against the long non-coding RNA sequence.

5. A kit for identifying dendritic cells and/or their chemotactic state comprising:

i) a reagent for detecting the level of long non-coding RNA shown as SEQ ID NO. 1;

ii) a container containing i) the reagent.

Images