CN109762831B - Gene drug constructs for the treatment of mucopolysaccharidosis type 3A - Google Patents

Gene drug constructs for the treatment of mucopolysaccharidosis type 3A Download PDF

Info

Publication number
CN109762831B
CN109762831B CN201910069883.4A CN201910069883A CN109762831B CN 109762831 B CN109762831 B CN 109762831B CN 201910069883 A CN201910069883 A CN 201910069883A CN 109762831 B CN109762831 B CN 109762831B
Authority
CN
China
Prior art keywords
sgsh
gene
protein
cmr
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910069883.4A
Other languages
Chinese (zh)
Other versions
CN109762831A (en
Inventor
马文豪
武志杰
董哲岳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Ruixi Rare Disease Gene Treatment Technology Institute
Original Assignee
Beijing Ruixi Rare Disease Gene Treatment Technology Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Ruixi Rare Disease Gene Treatment Technology Institute filed Critical Beijing Ruixi Rare Disease Gene Treatment Technology Institute
Priority to CN201910069883.4A priority Critical patent/CN109762831B/en
Publication of CN109762831A publication Critical patent/CN109762831A/en
Application granted granted Critical
Publication of CN109762831B publication Critical patent/CN109762831B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Abstract

The invention provides a novel gene therapy drug construct for 3A type mucopolysaccharide storage disease, which can effectively express recombinant human heparan-N-sulfatase (SGSH) and is used for preparing an adeno-associated virus vector-mediated gene therapy drug product.

Description

Gene drug constructs for the treatment of mucopolysaccharidosis type 3A
Technical Field
The invention relates to the field of biotechnology, in particular to two recombinant adeno-associated virus vectors carrying SGSH gene expression cassettes and application thereof in treating IIIA type mucopolysaccharidosis.
Background
Mucopolysaccharidosis (MPS) is a kind of unigenetic inherited metabolic disease in which acid mucopolysaccharides (also called glycosaminoglycans (GAGs)) cannot be degraded or are not completely degraded due to lack of or reduced activity of acid hydrolase associated with lysosomes in vivo, resulting in severe disability and death caused by accumulation of GAGs and their intermediate metabolites in vivo[1]. GAGs are a class of proteoglycans, and the main types and distribution of their metabolites in the body are as follows: (1) dermatan Sulfate (DS), which is distributed mainly in skin, ligament, artery and heart valve tissue; (2) chondroitin Sulfate (CS) (including 4-CS and 6-CS) is mainly present in tissues such as bone, cartilage, cornea, tendon, blood vessel, etc.; (3) heparan Sulfate (HS), mainly present on the surface of large arteries, liver, lungs and various cell membranes; (4) keratan Sulfate (KS), a matrix component of cornea and cartilage; (5) hyaluronan (HA), widely found in joint fluid, cartilage, connective tissue matrix, skin, umbilical cord and vitreous humor[2]. Excessive accumulation of these metabolic incompletes can affect normal cell function, resulting in damage to multiple organs and tissues of the patient.
Depending on the lysosomal lytic enzyme deficiency and the type of mucopolysaccharide stored, MPS can now be classified into 7 large 17 subtypes, including: MPS I type (containing three subtypes I H, I S and I H/S), MPS II type (containing two subtypes II A and II B), MPS III type (containing four subtypes III A, III B, III C and III D), MPS IV type (containing two subtypes IV A and IV B), MPS VI type (containing two subtypes VI A and VI B), MPS VII type, MPS IX type (containing three subtypes HYAL1, HYAL2 and HYAL 3)[3]. The MPS type V proved to be actually the MPS type I S, and the MPS type VIII proved not to be a new type becauseThe original numbering is preserved for the proposal by the international MPS naming authority. MPS I, II, IV and VI four types are common in China. Except that MPS type II is X chromosome-linked recessive inheritance (XR), the rest are autosomal recessive inheritance (AR).
MPS type iii (also known as Sanffilippo syndrome) divides the disease into A, B, C, D subtypes according to the difference of the deficient enzymes and the result of mixed culture of fibroblasts. Type A is deficient in heparan-N-sulfatase (SGSH), type B is deficient in alpha-N-acetylglucosaminidase, type C is deficient in N-acetyltransferase, and type D is deficient in glucosamine-6-sulfatase. The lack of the above enzymes can cause the Heparin Sulfate (HS) not to be normally degraded in vivo and then to accumulate[4]。
Mucopolysaccharidosis type III A (MPS 3A, also known as Sanffilippo syndrome type A) is an autosomal recessive genetic disease caused by genetic defect, with incidence rates of about 1/100000 to 1/500000 depending on the population[5]. The deficiency of Heparan-N-sulfatase (SGSH) in lysosomes of patients with the disease prevents the Heparan Sulfate (HS) from being degraded from the lysosomes and continuously accumulated, and influences the normal physiological activities of cells[6]. The disease can cause progressive mental retardation, and progressive neurological symptoms such as excessive convulsion and exercise, spastic quadriplegia, general weakness, aggressive behavior, etc. appear, which are the most prominent symptoms of the disease[7]. The majority of patients showed normal facial appearance, and a few showed large head, ugly face, swollen abdomen, progressive deafness, stiff joints and paw-shaped hand flexion[8]. The skeletal changes were only multiple osteogenesis imperfecta and dense, thickened posterior parietal bone. These changes have a degree of specificity in diagnosing the disease[9]. The hepatosplenomegaly is mild to moderate, without corneal opacity and without heart involvement. The bone abnormality of this type is slight, and there may be bad gasification of skull cap, temporal back and occipital thickening mastoid; the upper and lower edges of the vertebral body are slightly raised or elliptical; the inner side end of the clavicle is widened, and part of front ribs of the patient are widened like a paddle; the ilium wings are spread outward, and the ilium bodies are short and narrow. AcetabulumThe upper edge is relatively straight; the tubular bone is thick and short, and the metaphysis is slightly widened, which can be accompanied with the plastic obstacle of the bone. Narrow and irregular bone marrow cavity[10]. He ron et al reported that the major clinical manifestations of 15 MPS IIIA diagnoses were linguistic delay (93%), gross features (92%), aberrant behavior (75%), hepatomegaly (51%), autism spectrum disorders (29%), and epilepsy (17%). Delgadillo et al reported similar symptoms in 34 MPS IIIA patients, with delayed speech, gross facial features and hyperactivity being the most frequent 3, with hyperactivity occurring at a median age of 3.8 years, speech loss of 5.8 years, epileptic seizure of 7.0 years (range, 2.5-16.0 years), and disability of 10.4 years. The median age at which Valstar et al found that developmental delay and/or first signs of behavioral problems typically appeared was 2.5 years. 53 of 80 patients were diagnosed with epilepsy, with a median age of 11.0 years[11]。
Currently, MPS 3A has no effective treatment and can only improve the quality of life of patients by adjuvant therapy[12]. The key to treating MPS 3A is to get sufficient SGSH to degrade HS to the patient's lysosomes, and means include bone marrow and stem cell transplantation, enzyme replacement therapy, and gene therapy. Unfortunately, clinical studies have found that bone marrow transplantation does not alleviate intellectual deterioration[13](ii) a The difficulty of enzyme replacement therapy, namely recombinant SGSH protein input into a patient, is that the input protein is difficult to play a role through a blood brain barrier[14]Patients need to take medication for life, the procedure is painful and expensive. Gene therapy is considered to be a fundamental cure for this disease[15]. Both Lysogene (france) and Abeona (usa) currently move gene therapy drugs into the first and second clinical stages internationally. Lysogene is administrated by intracranial injection, an operation is needed, and the administration process is complex, so that pain is brought to a patient. The drug designed by Abeona company adopts a U1a promoter, and the expression level of the U1a promoter is weaker[16-17]. No gene therapy project report related to MPS 3A is found in China. To completely cure MPS 3A disease, patients are made available and new drugs need to be developed.
Reviewing the pathogenesis of MPS 3A, the SGSH gene at 17q25.3 is mutated to prevent the organism from synthesizingThe correct SGSH protein contributes to this progressive disease[18]More than 100 SGSH gene mutations have been found to be associated with rapid or chronic disease progression[19]. MPS 3A is an autosomal recessive genetic disorder, and when parents are carriers of a defective gene, 25% of the born children are likely to be sick children, and 50% are likely to be carriers. The enzymatic activity of SGSH protein in the carrier is reduced to about 50% of that in normal individuals, and the enzymatic activity in MPS 3A patients is generally 10% or less of that in normal levels[20]. HS is widely present in animal tissues and has diverse structures, mainly on the surfaces of aorta, liver, lung and various cell membranes, and also has various biological activities and functions corresponding thereto, including adhesion of cells, regulation of cell growth and proliferation, developmental processes and blood coagulation, cell surface binding of lipoprotein lipase and other proteins, angiogenesis, virus invasion and tumor metastasis, etc. In addition, HS participates in protecting protein from degradation, regulates protein transfer through basement membrane, mediates protein built-in and the like[21]. The defect of SGSH protein causes that HS cannot be metabolized normally and is accumulated in cells and tissues, thereby affecting the normal physiological functions of tissues and organs and forming a series of diseases.
Adeno-associated virus (AAV) has been named for its discovery in adenovirus preparations[22-23]. AAV is a member of the family parvoviridae (Parvoviruses), and comprises multiple serotypes, the genome of which is a single-stranded DNA[24]Wherein the genome size of AAV2 is 4682 nucleotides. AAV is a dependent virus, requiring other viruses such as adenovirus, herpes simplex virus and human papilloma virus[25]Or the auxiliary factor provides an auxiliary function to copy. In the absence of helper virus, AAV infects cells and its genome becomes latent after integration into the cell chromosome[26]Without producing progeny virus.
The earliest AAV virus isolated was serotype 2 AAV (AAV2)[27]. AAV2 genome is about 4.7kb long, and has Inverted Terminal Repeat (ITR) with length of 145bp at two ends and presents palindromic-hairpin structure[28]. Two in the genomeThe large Open Reading Frames (ORFs), which encode the rep and cap genes, respectively. The full-length genome of AAV2 has been cloned into an E.coli plasmid[29-30]。
ITRs are cis-acting elements of the AAV vector genome, playing an important role in integration, rescue, replication, and genomic packaging of AAV viruses[31]. The ITR sequences include Rep protein binding sites (RBS) and terminal melting sites (trs) capable of being recognized by Rep protein binding and nicking at trs[32]. The ITR sequences can also form a unique 'T' letter type secondary structure and play an important role in the life cycle of AAV viruses[33]。
The remainder of the AAV2 genome can be divided into 2 functional regions, a rep gene region and a cap gene region[34]. The Rep gene region encodes four Rep proteins, Rep78, Rep68, Rep52 and Rep 40. Rep proteins play an important role in replication, integration, rescue and packaging of AAV viruses. Wherein Rep78 and Rep68 specifically bind to terminal melting sites trs (terminal resolution site) and GAGY repeat motif in ITRs[35]The replication process of AAV genome from single strand to double strand is initiated. The trs and GAGC repeat motifs in the ITRs are central to replication of the AAV genome, and therefore although the ITR sequences are not identical in all serotypes of AAV virus, both hairpin structures are formed and Rep binding sites are present. The AAV2 genome map has p19 promoter at position 19, and expresses Rep52 and Rep40, respectively. Rep52 and Rep40 have no function of binding to DNA, but have ATP-dependent DNA helicase activity. The cap gene encodes the capsid proteins VP1, VP2, and VP3 of AAV virus. Of these, VP3 has the lowest molecular weight but the highest number, and the ratio of VP1, VP2, and VP3 in mature AAV particles is approximately 1:1: 10. VP1 is essential for the formation of infectious AAV; VP2 assists VP3 in entering the nucleus; VP3 is the major protein that makes up AAV particles.
With the understanding of the life cycle of AAV and its related molecular biological mechanism, AAV is transformed into one efficient foreign gene transferring tool, AAV vector. The modified AAV vector genome only contains the ITR sequence of AAV virus and the exogenous gene expression cassette carrying transport, and the virus packageThe required Rep and Cap proteins are supplied in trans by foreign plasmids, and the possible harm caused by packaging Rep and Cap genes into AAV vectors is reduced. Moreover, the AAV virus itself is not pathogenic, making the AAV vector one of the most recognized safe viral vectors. Deletion of D sequence and trs (tertiary resolution site) sequence in ITR sequence at one side of AAV can also make packaged recombinant AAV (rAAV) viral vector carrying genome self-complementary to form double chain, thereby remarkably improving in vivo and in vitro transduction efficiency of AAV vector[36-37]. The resulting packaged virus becomes a scAAV (self-complementary AAV) virus, a so-called double-stranded AAV virus. Unlike ssAAV (single-stranded AAV), a classical AAV virus, in which neither ITR is mutated at both sides. The packaging capacity of scAAV virus is smaller, only half of the packaging capacity of ssAAV, about 2.2kb-2.5kb, but transduction efficiency is higher after infecting cells. AAV viruses have a large number of serotypes, and different serotypes have different tissue infection tropism, so that the application of AAV vectors can transport foreign genes to specific organs and tissues[38]. Some serotype AAV vectors can also cross blood brain barrier, lead exogenous genes into cerebral neurons, and provide possibility for gene transduction targeting brain[39]. In addition, the AAV vector has stable physical and chemical properties, and shows strong tolerance to acid, alkali and high temperature[40]And the biological product with higher stability is easy to develop.
AAV vectors also have relatively mature packaging systems, facilitating large-scale production. At present, the AAV vector packaging system commonly used at home and abroad mainly comprises a three-plasmid cotransfection system, a packaging system taking adenovirus as a helper virus, a packaging system taking Herpes simplex virus type 1 (HSV 1) as a helper virus and a packaging system based on baculovirus. Among them, the three plasmid transfection packaging system is the most widely used AAV vector packaging system because of no need of auxiliary virus and high safety, and is also the mainstream production system in the world at present. The lack of efficient large-scale transfection methods has somewhat limited the use of three-plasmid transfection systems for large-scale production of AAV vectors. Yuan et al established AAV large-scale packaging system with adenovirus as helper virus[41]The system has high production efficiency, butThe trace amount of adenovirus in the final AAV finished product in the packaging system influences the safety of the AAV finished product. HSV1 is another type of AAV vector packaging system that has been used more widely as a packaging system for helper viruses. Almost simultaneously, Wushijian and Conway and the like internationally put forward an AAV2 vector packaging strategy taking HSV1 as a helper virus[42-43]. Subsequently, Wustner et al proposed the packaging strategy of AAV5 vector with HSV1 as helper virus[44]. On the basis, Booth et al utilize two HSV1 to respectively carry the rep/cap gene of AAV and Inverted terminal sequence (ITR)/exogenous gene expression cassette of AAV, then two recombinant HSV1 viruses are co-infected with production cell, and packaged to produce AAV virus[45]. Thomas et al further established a suspension cell system for AAV production of bis-HSV 1 virus[46]Enabling larger scale production of AAV. In addition, Urabe and the like construct a baculovirus packaging system of AAV vectors by using three baculoviruses to respectively carry AAV structural, non-structural and ITR/exogenous gene expression cassettes. Taking into account the instability of the baculovirus carrying the foreign gene, the number of baculoviruses required in the production system is subsequently reduced, gradually from the first requiring three baculoviruses to the second or one[47-48]And a baculovirus plus one induced cell strain strategy[49-50]. Each packaging system has various characteristics, and can be selected as required.
Due to the above characteristics, AAV vectors are becoming an exogenous gene transfer tool widely used in gene therapy, particularly in gene therapy of genetic diseases. By 04 months in 2017, 2463 gene therapy clinical protocols have been passed globally, and the diseases to be treated mainly include various diseases which have serious threat to human health and do not meet clinical requirements, specifically genetic diseases, tumors, cardiovascular diseases, infectious diseases, autoimmune diseases, central nervous system diseases, blood diseases, metabolic diseases, other various refractory diseases and the like. AAV vector is increasingly the first choice for gene therapy due to its advantages of safety and long-lasting expression[51]. In the clinical protocol that has passed, AAV vectors have been used as delivery systems for genes in about 7.4%. Detailed description of the inventionThe information may refer to the website http:// abedia. com/wireless/indices. More importantly, the AAV vector-based lipoprotein lipase gene therapy drug Glybera is approved by European drug administration to be on the market in 2012 and becomes the first AAV vector gene therapy drug approved in the western world[52](ii) a Hemophilia B[53]And congenital amaurosis (RPE65Caused by gene mutation)[54]All the AAV vector gene therapy medicines have good clinical test effects, are expected to be sold in the near future, and benefit a large number of patients.
In the invention, AAV vectors are selected to carry SGSH gene expression cassettes, and the following characteristics of the AAV vectors are mainly based on. First, the AAV vector retains only the two ITR sequences required for packaging in the wild-type virus, and does not contain the protein-encoding gene in the genome of the wild-type virus[55]And low immunogenicity. Secondly, AAV usually achieves sustained stable expression of a gene-carrying reading frame in the form of non-integrated extrachromosomal genetic material[56]And the safety problem caused by the random integration of the introduced gene is avoided. Third, AAV vectors have high transduction efficiency by intravenous injection[57-61]And ensures that the SGSH gene expression frame can be efficiently expressed in vivo.
According to the design thought, the single-chain rAAV-CA-SGSH and the double-chain rAAV-CMR-SGSH viruses are prepared, and the rAAV-CA-EGFP, the rAAV-CMR-EGFP and other control viruses expressing the green fluorescent protein are designed and prepared. These viruses were injected at equal doses into SGSH gene-deficient model mice, and rAAV-CA-SGSH design was evaluated，Effectiveness of rAAV-CMR-SGSH. The result shows that the rAAV-CA-SGSH and the rAAV-CMR-SGSH can continuously and stably express the SGSH protein in a model mouse for a long time, the SGSH content in the model mouse is obviously improved, excessive heparan sulfate in a lysosome of cells is hydrolyzed, the content of the heparan sulfate in the cells is greatly reduced, and the normal level is achieved and maintained. Shows a great potential for curing MPS IIIA disease.
Disclosure of Invention
In view of this, the present invention provides two novel MPS IIIA disease gene therapy drugs based on AAV vectors. The drug carries SGSH gene expression frame by AAV carrier. The SGSH gene is a wild-type human SGSH gene. In the gene expression frame, the CA promoter and the artificially designed CMR promoter regulate the high-efficiency expression of SGSH gene. Based on the design, the medicine is expected to be capable of efficiently expressing SGSH protein in vivo after intravenous injection, remarkably improve the content of SGSH protein in cells, participate in hydrolyzing excessive heparan sulfate in lysosomes, greatly reduce the content of the heparan sulfate in the cells, and achieve and maintain a normal level, thereby achieving the purpose of treating MPS IIIA.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides two gene therapy medicines for treating MPS IIIA diseases, which are characterized in that the medicines are based on recombinant AAV vectors, and the AAV vectors are utilized to efficiently introduce a drug effect element into a body through intravenous injection, so that the drug effect element expresses the high-efficiency expression of a therapeutic effect product protein SGSH. In order to realize the high-efficiency expression of SGSH protein, AAV9 is mainly selected for intravenous injection to break through the limitation of blood brain barrier according to the transduction characteristics of different serotype AAV.
The gene therapy medicine for treating MPS IIIA diseases is also characterized in that the high-efficiency expression of SGSH protein can be realized based on the designed SGSH gene expression frame. A Kozak sequence 5 '-GCCACC-3' is added before a translation initiation codon of a wild human SGSH gene sequence, so that the accurate initiation efficiency during protein translation is improved. The CA promoter and a manually designed CMR promoter are respectively adopted to regulate and control the transcription of the SGSH gene, and the CA promoter consists of an enhancer sequence of human CMV virus and a basic promoter of chicken beta-actin protein, so that the SGSH gene can be efficiently transcribed in various cells. The CMR promoter is formed by optimizing the structure of an enhancer sequence of human CMV virus, avoids the characteristic of the traditional CMV promoter in liver silencing, can be widely expressed in the whole body, and has better specificity in the liver.
The MPS IIIA disease gene therapy medicine provided by the invention is characterized in that after the medicine is injected into an SGSH gene defect model mouse body through intravenous injection, SGSH protein can be efficiently, continuously and stably expressed in the mouse body, the SGSH protein generated by expression participates in hydrolysis of heparan sulfate in cells, the accumulation of the SGSH protein in the cells is reduced, and the SGSH protein is maintained at a normal level. Thereby eliminating various disease symptoms caused by excessive accumulation of heparan sulfate in cells and achieving the aim of treatment.
The MPS IIIA disease gene therapeutic medicine provided by the invention is also characterized in that once administration can enable cells to efficiently express SGSH protein for a long time and continuously, participate in hydrolyzing excessive heparan sulfate and enable the heparan sulfate in the cells to be maintained at a normal level. Thereby achieving the long-time treatment effect.
The important original experimental materials used in the present invention are as follows:
pHelper plasmid, derived from AAV Helper Free System (Agilent Technologies, USA), was purchased from Agilent Technologies, Inc. and stored by the institute. The plasmid contains three plasmids to co-transfect HEK293 cells to prepare adenovirus-derived helper function genes E2A, E4, VA RNA and the like required by recombinant AAV.
The pAAV-R2C9 plasmid was constructed and stored in the institute. The pAAV-RC plasmid in AAV Helper Free System (Agilent Technologies, USA) is used as basic skeleton, and the sequences 2013 to 4220 in pAAV-RC plasmid are replaced by AAV9 coat protein coding sequence (GenBank ID: AY530579), so that pAAV-R2C9 plasmid is obtained. The brief construction process is that the sequence information of pAAV-R2C9 plasmid is obtained according to the above-mentioned thought, and the pAAV-R2C9 plasmid is artificially synthesizedHindIII toPmeI, replacing pAAV-RC plasmid with the synthetic sequence by adopting a standard molecular cloning method to obtain pAAV-R2C9 plasmid. The pAAV-R2C9 plasmid contains the cap gene of AAV9 and the Rep gene of AAV2 in a complete form, and 4 Rep proteins (Rep78, Rep68, Rep52 and Rep40) and AAV9 coat proteins which are necessary for packaging are provided in the preparation of recombinant AAV1 virus by three-plasmid co-transfection packaging.
The pAAV-R2C5 plasmid was constructed and stored in the institute. The plasmid sequence pAAV-R2C5 is obtained by using pAAV-RC plasmid in AAV Helper Free systems (Agilent Technologies, USA) as basic skeleton and replacing sequences 2013 to 4220 in pAAV-RC plasmid with coat protein coding sequence Cap5 (sequences 2207 to 4381 in genome) in AAV genome (GenBank ID: NC-006152.1). The simple construction process is that pAAV-R2C5 plasmid sequence information is obtained according to the above thought, sequences between HindIII and PmeI restriction sites in the pAAV-R2C5 plasmid are artificially synthesized, and the sequences between HindIII and PmeI of the pAAV-RC plasmid are replaced by the synthetic sequences by adopting a standard molecular cloning method to obtain the pAAV-R2C5 plasmid. The pAAV-R2C5 plasmid contains the cap gene of AAV5 and the Rep gene of AAV2 completely, and 4 Rep proteins (Rep78, Rep68, Rep52 and Rep40) and AAV5 coat proteins which are necessary for virus packaging are provided in the preparation of recombinant AAV5 virus by three-plasmid co-transfection and packaging.
The pAAV-R2C10 plasmid was constructed and stored in the institute. The sequence from 2013 to 4220 in pAAV-RC plasmid was replaced by the coding sequence of AAVrh10 coat protein (GenBank ID: AY 243015.1) using pAAV-RC plasmid in AAV Helper Free System (Agilent Technologies, USA) as basic skeleton, and pAAV-R2C10 plasmid was obtained. The simple construction process is that pAAV-R2C10 plasmid sequence information is obtained according to the thought, a sequence between HindIII and PmeI restriction sites in the pAAV-R2C10 plasmid is artificially synthesized, and a standard molecular cloning method is adopted to replace the sequence between the HindIII and PmeI restriction sites of the pAAV-RC plasmid by the synthetic sequence to obtain the pAAV-R2C10 plasmid. The pAAV-R2C10 plasmid contains the cap gene of AAVrh10 and the Rep gene of AAV2 completely, and provides 4 Rep proteins (Rep78, Rep68, Rep52 and Rep40) and AAVrh10 coat protein which are necessary for packaging in the preparation of recombinant AAVrh10 virus through three-plasmid co-transfection and packaging.
The Packaging System for Packaging the recombinant AAVDJ adopts AAV-DJ/8 Helper Free Packaging System (Cat. No.: VPK-400-DJ-8, Cell Biolabs), and the operation process is described in the specification.
Model mice deficient in SGSH gene: available from the jackson laboratory (jax), U.S. Pat. No. 003780. The generation of the strain is breeding by Beijing Edmo Biotechnology Limited. 6-10 weeks old SGSH gene-deficient homozygous mice were used for the experiments. Control mice, C57BL/6J mice, purchased from Edmol Biotechnology, Beijing, were used as wild-type controls for animal experiments.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1: pRDAV-CMV vector structural diagram. Based on AAV vector pAAV2neo[62]Is constructed. ITR, inverted terminal repeat, length 145 bp. CMV promoter, human cytomegalovirus early promoter. bGH polyA, polynucleotide tailing signal of bovine growth hormone. Amp, reading frame for ampicillin resistance gene. Neo, neomycin resistance gene reading frame. The vector contains multiple restriction sites.
FIG. 2: schematic structure of pRDAV-CA vector. ITR, inverted terminal repeat, length 145 bp. CA promoter, human cytomegalovirus early gene enhancer sequence, chicken beta-actin promoter sequence. bGH polyA, polynucleotide tailing signal of bovine growth hormone. Amp, reading frame for ampicillin resistance gene. Neo, neomycin resistance gene reading frame. The vector contains multiple restriction sites.
FIG. 3: schematic structure of pRDAV-CA-SGSH vector. ITR, inverted terminal repeat, length 145 bp. CA promoter, human cytomegalovirus early gene enhancer sequence, chicken beta-actin promoter sequence. SGSH: the coding sequence (CDS) of human heparan-N-sulfatase. bGH polyA, polynucleotide tailing signal of bovine growth hormone. Neo, neomycin resistance gene reading frame.
FIG. 4: schematic structure of the pscAAV-CMV vector. ITR, inverted terminal repeat, flanking inverted terminal repeats. Δ ITR, deletion of the inverted terminal repeat of the D sequence. CMV promoter, the sequence of the human cytomegalovirus early promoter. bGH polyA, polynucleotide tailing signal of bovine growth hormone. Amp, reading frame for ampicillin resistance gene. Neo, neomycin resistance gene reading frame. The vector contains multiple restriction sites.
FIG. 5: schematic diagram of the structure of the pscAAV-CMR-SGSH carrier. ITR, inverted terminal repeat, flanking inverted terminal repeats. Δ ITR, deletion of the inverted terminal repeat of the D sequence. CMR promoter, an artificially designed promoter. SGSH: CDS of human heparan-N-sulfatase. SV40 polyA, polynucleotide tailing signal of simian vacuolating virus. Amp, reading frame for ampicillin resistance gene. Neo, neomycin resistance gene reading frame.
FIG. 6: and (3) detecting the protein expression of the plasmid pRDAV-CA-SGSH and pscAAV-CMR-SGSH after transfecting Huh-7 cells. pRDAV-CA-SGSH and pscAAV-CMR-SGSH transfected Huh-7 cells. After 48h, the cells are digested and collected, total protein of the Huh-7 cells is extracted, and 30 mu g of the total protein is taken to measure SGSH expression by Western blotting. The results showed that after transfection of pRDAV-CA-SGSH and pscAAV-CMR-SGSH, SGSH protein bands were evident in the cells, whereas no SGSH protein band was detected in the total protein of the blank cells. Lane 1, SGSH protein and internal reference protein GAPDH of naive Huh-7 cells; lane 2, SGSH protein and internal reference protein GAPDH of pRDAV-CA-SGSH-transfected Huh-7 cells, lane 3, SGSH protein and internal reference protein GAPDH of psCAAV-CMR-SGSH-transfected Huh-7 cells.
FIG. 7: SGSH enzyme activity detection results after in vitro transfection of Huh-7 cells by pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids. pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids transfect Huh-7 cells. After 48h, the cells are digested and collected to extract the total protein of the Huh-7 cells, the protein concentration is detected by a BCA method, and 30 mu g of the protein is taken to measure the SGSH enzyme activity. The results showed that after transfection of pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids, the SGSH enzyme activity of the cells was significantly increased compared to that of the empty cells.
FIG. 8: and (3) detecting the SGSH enzyme activity after rAAVDJ-CA-SGSH and rAAVDJ-CMR-SGSH infect Huh-7 cells. rAAVDJ-SGSH and rAAVDJ-CMR-SGSH infect Huh-7 cells with MOIs of 2000 and 10,000 vector Genes (GC)/cell, respectively. After 48h, total cellular protein was extracted and 30. mu.g was taken for SGSH enzyme activity. The results show that after rAAVDJ-SGSH infection, SGSH enzyme activity of Huh-7 cells is obviously increased relative to that of blank Huh-7 cells, and when MOI is 10,000 GC/cell, SGSH activity is obviously higher than that of MOI 2000 GC/cell.
FIG. 9: results of SGSH enzyme activity detection of pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids by hydrodynamic injection of C57BL/6J wild-type mice. pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids C57BL/6J wild-type mice were hydrodynamically injected via tail vein, and non-injected wild-type C57BL/6J mice were added as controls. After 18h, the mice are killed, the liver is taken, and 30 mu g of the liver is taken after total protein is extracted to determine the SGSH enzyme activity. Results show that the activity of liver SGSH enzyme of mice injected with pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids is obviously improved.
FIG. 10: and (3) the results of the SGSH enzyme activity detection of the wild type mice C57BL/6J injected by rAAV9-CA-SGSH and scAAV 9-CMR-SGSH. rAAV9-CA-SGSH and scAAV9-CMR-SGSH are injected into C57BL/6J wild-type mice through tail vein, and the dosage is 1 × 1013GC/kg and 5X 1013GC/kg. Wild type C57BL/6J mice injected with PBS were also added as controls. After 1 month, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. After extracting total protein, 30 μ g of the total protein was taken to determine SGSH enzyme activity. The result shows that the SGSH enzyme activity of mice injected with rAAV9-CA-SGSH and scAAV9-CMR-SGSH in each tissue is improved, and the liver and spleen tissues are improved most obviously. The dosage is 5X 1013SGSH enzyme activity of each tissue is higher than that of each tissue at the dosage of 1 × 10 at GC/kg13GC/kg. Compared with rAAV9-CA-SGSH, the activity of the scAAV9-CMR-SGSH is improved more in multiple tissues.
FIG. 11: and (3) detecting the SGSH enzyme activity of the model mouse with SGSH gene defect injected by rAAV9-CA-SGSH and scAAV 9-CMR-SGSH. rAAV9-CA-SGSH and scAAV9-CMR-SGSH are injected into SGSH gene-deficient model mice through tail vein, and the dosage is 5 multiplied by 1013GC/kg. Model mice injected with PBS and wild-type C57BL/6J mice were added simultaneously as controls. After 3 months, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. After extracting total protein, 30 μ g of the total protein was taken to determine SGSH enzyme activity. The results show that the SGSH enzyme activity in each tissue and organ of the model mouse without virus injection is very low and can not be detected almost, and the SGSH enzyme activity in each tissue and organ of the model mouse with virus injection is obviously increased and is only slightly lower than that of a wild type mouse. SGSH enzyme activity in heart and liver even exceeded that of wild type mice that were not injected with virus.
TABLE 1 rAAV9-SGSH injection of SGSH Gene deficient model miceAnd (5) detecting the virus load. rAAV9-CA-SGSH and scAAV9-CMR-SGSH are injected into SGSH gene-deficient model mice through tail vein, and the dosage is 5 multiplied by 1012vg/kg. Model mice without injected virus and wild type C57BL/6J mice were added simultaneously as controls. After 3 months, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. After extraction of total protein, the viral load was determined. The results showed that the virus load was hardly detected in each tissue and organ of the model mouse without virus injection and the wild type mouse. However, the virus load of each tissue and organ of the model mouse injected with the virus is obviously increased, wherein the virus load is the highest in the liver.
FIG. 12: and the result of detecting the urine GAG content after the model mouse with SGSH gene defect is injected by rAAV9-CA-SGSH and scAAV 9-CMR-SGSH. rAAV9-CA-SGSH and scAAV9-CMR-SGSH are injected into SGSH gene-deficient model mice through tail vein, and the dosage is 5 multiplied by 1013GC/kg. Model mice injected with PBS and wild-type C57BL/6J mice were added simultaneously as controls. After 3 months, 200. mu.L of urine of all mice of the experimental group and the control group were taken, and the GAG content in the urine of the mice was measured by the DMMB color method. The results show that the urine GAG content of the model mouse injected with the virus is obviously reduced.
FIG. 13: and the detection result of the GAG content of tissues after the model mice with SGSH gene defects are injected with rAAV9-CA-SGSH and scAAV 9-CMR-SGSH. rAAV9-CA-SGSH and scAAV9-CMR-SGSH are injected into SGSH gene-deficient model mice through tail vein, and the dosage is 5 multiplied by 1013GC/kg. Model mice injected with PBS and wild-type C57BL/6J mice were added simultaneously as controls. After 3 months, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. GAG of the tissue is extracted, and the content of GAG of the liver and spleen of the mouse is measured by adopting a DMMB color development method. The results show that the GAG content in each tissue of the model mouse injected with the virus is obviously reduced.
FIG. 14: and (3) rAAV9-CA-SGSH and scAAV9-CMR-SGSH injection SGSH gene-deficient model mice post-rope grabbing experiment detection results. rAAV9-CA-SGSH and scAAV9-CMR-SGSH are injected into SGSH gene-deficient model mice through tail vein, and the dosage is 5 multiplied by 1013GC/kg. Model mice injected with PBS and wild-type C57BL/6J mice were added simultaneously as controls. After 3 months, the four limbs strength and the balance ability of all mice were tested by using a rope grasping experiment. The result shows that compared with the control group model mouse, the rope grabbing time of the treatment group model mouse is obviously prolonged, and basically has no difference with the normal mouse. The injection of the scaAV9-CMR-SGSH takes longer than the rope grabbing time of a model mouse injected with the rAAV 9-CA-SGSH.
FIG. 15: rAAV9-CA-SGSH, scAAV9-CMR-SGSH and scAAV9.U1a. hSGSH are compared with SGSH enzyme activity after being injected into model mice with SGSH gene defects. rAAV9-CA-SGSH, scAAV9-CMR-SGSH and scAAV9.U1a. hSGSH are injected into SGSH gene-deficient model mice through tail vein, and the dosage is 5 x 1013 GC/kg. After 3 months, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. After extracting total protein, 30 μ g of the total protein was taken to determine SGSH enzyme activity. The results show that the SGSH enzyme activity in each tissue and organ of a model mouse without virus injection is extremely low, the SGSH enzyme activity in each tissue and organ of the model mouse with virus injection is obviously increased, and the model mouse with enzyme activity injection of the scaAV9-CMR-SGSH is higher than that of the model mouse with rAAV9-CA-SGSH injection than that of the model mouse with scaaV9.U1a. hSGSH injection.
FIG. 16: the SGSH enzyme activity of AAV vectors is compared after different serotypes are injected into model mice with SGSH gene defects. rAAV5-CA-SGSH, rAAV9-CA-SGSH, rAAVrh10-CA-SGSH, rscAAV5-CMR-SGSH, rscAAV9-CMR-SGSH, rscAAVrh10-CMR-SGSH, and SGSH gene-deficient model mice injected via tail vein at a dose of 5 × 1013GC/kg. After 3 months, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. After extracting total protein, 30 μ g of the total protein was taken to determine SGSH enzyme activity. The results show that the SGSH enzyme activity in each tissue and organ of the model mouse without virus injection is extremely low, and the SGSH enzyme activity in each tissue and organ of the model mouse with virus injection is obviously increased. Compared with the activity of each tissue enzyme, the serotype of the vector is AAV5 which is lower than the serotype of AAVrh10 which is lower than AAV9.
Detailed Description
The invention discloses two IIIA type mucopolysaccharide storage disease gene treatment drugs, which comprise drug design, mini-preparation and functional verification. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention. In which, unless otherwise specified, the various reagents mentioned in the examples are commercially available.
The invention is further illustrated by the following examples:
EXAMPLE 1 construction of plasmid vector
In order to construct pRDAV-CA-SGSH plasmid required for obtaining packaging recombinant AAV, we first replaced the CMV promoter in pRDAV vector with an autonomously designed CA promoter (SEQ ID No.1) based on pRDAV-CMV (FIG. 1) stored in the company, to obtain pRDAV-CA vector. Next, the artificially synthesized human SGSH (SEQ ID No.2) sequence was cloned into pRDAV-CA vectorKpnI andEcoRand (I) obtaining pRDAV-CA-SGSH and a carrier between enzyme cutting sites.
(1) pRDAV-CA vector construction
Splicing the human cytomegalovirus early gene enhancer sequence and the chicken beta-actin promoter sequence to obtain a CA promoter sequence, wherein the sequence information is shown in SEQ ID No. 1. Adding at both ends of the CA promoter sequenceXhoI andKpni enzyme cutting site. The sequence was synthesized by Kinsley Biotechnology, Inc. after addition of the cleavage site, and the synthesized sequence was cloned into pUC57 simple vector (Kinsley Biotechnology, Nanjing) to obtain pUC 57-CA. By usingXhoI andKpni double digestion of pUC57-CA vector and pRDAV-CMV vector, recovery of CA fragment and pRDAV-CMV vector fragment (about 6.3kb) from which CMV promoter was excised, ligation of the two fragments, and transformationE.coliJM109 competent cells (Boehringer Mannheim, Dalian, Ltd.) were screened and identified to obtain AAV plasmid vector pRDAV-CA containing CA promoter (FIG. 2).
(2) pRDAV-CA-SGSH vector construction
Human SGSH gene cDNA sequence (GenBank: BC047318.1) is synthesized by Kinsley Biotechnology Limited, the sequence information is shown in SEQ ID No.2, KpnI and EcoRI enzyme cutting sites are respectively added at the upstream and downstream of the SGSH gene cDNA sequence of the synthesized sequence, and the synthesized sequence is cloned into pUC57 simple vector (Kinsley Biotechnology, Nanjing) to obtain pUC57-SGSH vector. KpnI and EcoRI are used for double digestion of pUC57-SGSH vector and pRDAV-CA vector respectively, SGSH fragment and linearized pRDAV-CA vector fragment are recovered, and the two fragments are connected and transformedE.coliJM109 competent cells (Boehringer Mannheim, Dalian) were screened and identified to obtain pRDAV-CA-SGSH vector (FIG. 3).
(3) Construction of the pscAAV-CMV vector
Based on the 3' end ITR sequence in AAV2 genome (GenBank number AF 043303), trs sequence and D sequence in ITR sequence are deleted according to literature report[36]Obtaining a delta ITR sequence SEQ ID No. 3. For convenient cloning, the sequence between BamHI and ApaI of pRDAV-CMV vector was synthesized, and the original ITR sequence was replaced with Δ ITR, and cloned into pMD18T vector. The vector was digested with BamHI and ApaI, and 402bp of the Δ ITR-containing fragment was recovered. The pRDAV-CMV vector was digested with BamHI and ApaI, and a 6505bp backbone fragment was recovered. The two fragments were ligated to give the pscAAV-CMV vector. (FIG. 4)
(4) Construction of pscAAV-CMR-SGSH vector
The promoter sequence named CMR is obtained by introducing a CM promoter obtained by structurally optimizing an enhancer sequence of human CMV virus and an intron sequence from 62804 th position to 62890 th position in a gene (GenBank: NG _012771.2) related to human TATA box binding protein at the 3' end of the promoter sequence, and the sequence information is shown in SEQ ID No 4. The CMR promoter is synthesized, and XhoI and KpnI sites are respectively introduced at the upstream and downstream. And digesting the pscAAV-CMV vector by using XhoI and KpnI through double enzyme digestion to recover 6129bp framework fragment, and connecting to obtain the pscAAV-CMR.
The pRDAV-CA-SGSH vector was digested with KpnI and BglII to recover a 1509bp SGSH fragment. The polynucleotide tailing signal SV40 polyASEQ ID No5 of simian vacuolating virus was synthesized, and BglII and BamHI sites were added upstream and downstream, respectively.
The pscAAV-CMR vector was digested with KpnI and BamHI to recover a 6214bp backbone fragment, which was ligated with the SGSH fragment and SV40 polyA to obtain a pscAAV-CMR-SGSH vector (FIG. 5).
Example 2 in vitro expression validation of pRDAV-CA-SGSH vector
(1) Expression assay for SGSH proteins
Well-grown Huh-7 cells were plated evenly in 9 wells of a six-well cell culture plate, and 3 wells of pRDAV-CA-SGSH and pscAAV-CMR-SGSH were transfected separately using Lipofectamine2000 (Invitrogen, USA) when the cell density per well reached 80% (see description for details). After transfection for 48h, cells were collected after digestion, and total cell protein was extracted by repeated freeze-thawing and centrifugation. Total Protein concentrations of transfected pRDAV-CA-SGSH, pscAAV-CMR-SGSH and blank cells were determined using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA), with detailed procedures in reference to Kit instructions.
After extraction of the total protein of Huh-7 cells, expression of SGSH protein in the cells was detected by Western Blotting, as described in molecular cloning (third edition). The results show that the expression level of the internal reference protein is similar when the total protein loading amount of several cells is 30 mu g, and the SGSH protein band of blank Huh-7 cells is not visible. Huh-7 cell detection of the transfected pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids revealed a significant and high SGSH protein band (FIG. 6).
(2) Activity assay of SGSH proteins
Well-grown Huh-7 cells were plated evenly in 9 wells of a six-well cell culture plate, and 3 wells of pRDAV-CA-SGSH and pscAAV-CMR-SGSH were transfected separately using Lipofectamine2000 (Invitrogen, USA) when the cell density per well reached 80% (see description for details). After transfection for 48h, cells were collected after digestion, and total cell protein was extracted by repeated freeze-thawing and centrifugation. Total Protein concentrations of transfected pRDAV-CA-SGSH, pscAAV-CMR-SGSH and blank cells were determined using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA), with detailed procedures in reference to Kit instructions.
After extracting the total cell protein, respectively taking 3 of the extracted protein0 μ g of the enzyme is used for measuring SGSH protease activity, and the method is detailed in[63]. The results showed that the SGSH enzyme activity of the blank Huh-7 cells was very low at 0.76. + -. 0.16 nmol/17 h/mg protein in Huh-7 cells. While the SGSH enzyme activity of the Huh-7 cells transfected with the pRDAV-CA-SGSH plasmid was 13.86. + -. 0.34 nmol/17 h/mg protein, which is 18.2 times that of the empty cells, and the SGSH enzyme activity of the Huh-7 cells transfected with the pscAAV-CMR-SGSH plasmid was 14.02. + -. 0.69 nmol/17 h/mg protein, which is 18.5 times that of the empty cells (FIG. 7).
The results show that the constructed pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids can effectively express SGSH protein in cells, and the expressed protein has high activity.
Example 3 preparation and assay of rAAV-SGSH
(1) Packaging of different serotype recombinant AAV viruses
Reference [64] uses a three plasmid packaging system to package and purify recombinant AAV viruses. Briefly, AAV vector plasmids (pRDAV-CA-SGSH or pscAAV-CMR-SGSH), helper plasmids (pHelper) and AAV Rep and Cap protein expression plasmids (pAAV-R2C5, pAAV-R2C9 or pAAV-R2C10) were mixed at a molar ratio of 1:1:1, HEK293 cells were transfected using a calcium phosphate method, after 48h of transfection, the cells and culture supernatants were harvested, and recombinant AAV viruses were isolated and purified using cesium chloride density gradient centrifugation. Packaging and purifying to obtain rAAV5-CA-SGSH, rAAV9-CA-SGSH, rAAVrh10-CA-SGSH, rscAAV5-CMR-SGSH, rscAAV9-CMR-SGSH and rscAAVrh 10-CMR-SGSH.
(2) rAAVDJ-SGSH packaging
AAV-DJ/8 Helper Free Packaging System (cargo number: VPK-400-DJ-8, Cell Biolabs) of Cell Biolabs company is adopted, rAAVDJ-CA-SGSH and rAAVDJ-CMR-SGSH are packaged, and the operation process is shown in the specification.
(3) Titer detection of recombinant AAV viruses
The titer of the rAAV genome is determined and prepared by adopting a quantitative PCR method. The specific process is as follows:
two primers, CA-Q-F and CA-Q-R, were designed in the CA promoter:
CA-Q-F：5’-CCCATAAGGTCATGTACTGGGCAT-3’ (SEQ ID No.6)
CA-Q-R：5’-GTTCCCATAGTAACGCCAATAGGG-3’ (SEQ ID No.7)
two primers, CMR-Q-F and CMR-Q-R, were designed in the CMR promoter:
CMR-Q-F：5’-ttatatagacctcccaccgt-3’ (SEQ ID No.8)
CMR-Q-R：5’-taaatggcccgcctggctga-3’ (SEQ ID No.9)
CA-Q-F and CA-Q-R are used as primers to specifically amplify a 175bp fragment of the CA promoter, and the primers are synthesized by Thermofeisher Scientific. Using 1. mu.g/. mu.L pRDAV-CA-SGSH plasmid and 10-fold gradient diluted sample as standard, SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent (Takara, Dalian, China) was used to detect viral genome titer using a fluorescent quantitative PCR instrument (model: ABI 7500 fast, ABI) by SYBR Green dye binding method. See SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent instructions for procedures. Virus processing method[65]。
CMR-Q-F and CMR-Q-R are used as primers to specifically amplify a fragment 188bp long of the CMR promoter, and the primers are synthesized by Thermofisher Scientific. Using SYBR Green dye binding method, using 1. mu.g/. mu.L of pscAAV-CMR-SGSH plasmid and 10-fold gradient diluted sample as standard, SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent (Takara, Dalian, China) was used to detect virus genome titer using fluorescent quantitative PCR instrument (model: ABI 7500 fast, ABI). See SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent instructions for procedures. A method for treating viruses.
Example 4 validation of in vitro expression of rAAVDJ-SGSH
Before performing in vivo expression studies of viruses, the in vitro expression levels of the viruses need to be verified. Because rAAVDJ-SGSH expression in vitro was very poor, rAAVDJ-SGSH was used in this study for the in vitro expression of the virus.
Well-grown Huh-7 cells were spread evenly in 16 wells of a six-well cell culture plate, and when the cell density per well reached 80%, 1 well was selected for cell counting, and 3 wells of Huh-7 cells were infected by adding rAAVDJ-CA-SGSH and rAAVDJ-CMR-SGSH by calculation at doses of MOI of 2,000 and 10,000 GC/cell, respectively, and three wells of Huh-7 cells were not infected with virus, as a control. And after the virus is infected for 48 hours, collecting cells, and extracting total cell protein by adopting a repeated freeze thawing mode. Total Protein concentrations were determined for 3 groups of cells using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA), with detailed procedures in reference to Kit instructions.
And respectively taking 30 mu g of the extracted protein to be used for measuring the SGSH protease activity. The results showed that the SGSH enzyme activity of the blank Huh-7 cells was very low, 0.65. + -. 0.05 nmol/17 h/mg protein. The SGSH enzyme activity of Huh-7 cells infected with rAAVDJ-CA-SGSH is obviously increased. Wherein the SGSH enzyme activity of Huh-7 cells is 15.48. + -. 1.11 nmol/17 h/mg protein at an MOI of 10,000 GC/cell, and 10.62. + -. 0.59 nmol/17 h/mg protein at an MOI of 2,000 GC/cell. The SGSH enzyme activity of Huh-7 cells infected with rAAVDJ-CMR-SGSH is obviously increased. Wherein the SGSH enzyme activity of Huh-7 cells was 18.53. + -. 0.50 nmol/17 h/mg protein at an MOI of 10,000 GC/cell, and 11.54. + -. 0.75 nmol/17 h/mg protein at an MOI of 2,000 GC/cell (FIG. 8). The cellular SGSH enzyme activity was significantly higher at an MOI of 10,000 than at an MOI of 2,000.
The results show that the rAAVDJ-SGSH can effectively express SGSH protein after infecting cells, and the expressed SGSH protease has high activity.
Example 5 MPS 3A therapeutic Agents in Normal mice effectiveness evaluation experiments
(1) C57BL/6J mouse tail vein hydrodynamic injection pRDAV-CA-SGSH, pscAAV-CMR-SGSH plasmid
A total of 9C 57BL/6J mice at 6 weeks of age were randomly assigned to 3 groups. Group 1 mice were injected with 10 μ g of pRDAV-CA-SGSH plasmid dissolved in 2 mL PBS per tail vein for 10 s. Group 2 mice were injected with 10 μ g of the pscAAV-CMR-SGSH plasmid dissolved in 2 mL PBS per tail vein for 10 s. Group 3 mice were injected with 2 mL PBS 10s into each tail vein. All mice were sacrificed 18h after injection, livers were dissected and total tissue protein was extracted. Total Protein concentrations were determined for each of the 3 groups using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA), with detailed procedures in reference to Kit instructions. And respectively taking 30 mu g of the extracted protein to be used for measuring the SGSH protease activity. As shown in FIG. 9, the SGSH enzyme activity of the liver of a normal mouse is 1.58. + -. 0.28 nmol/17 h/mg protein, and the SGSH enzyme activity of the liver of the mouse after pRDAV-CA-SGSH plasmid injection is 2.61. + -. 0.57 nmol/17 h/mg protein. The SGSH enzyme activity of the liver of a mouse injected with the pscAAV-CMR-SGSH plasmid is 2.94 +/-0.53 nmol/17 h/mg protein. Results show that the activity of mouse liver SGSH enzyme injected with pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmids is obviously improved.
(2) C57BL/6J mouse tail vein injection rAAV9-CA-SGSH and rscAAV9-CMR-SGSH
6 weeks old C57BL/6J wild mice total 15, randomly divided into 5 groups. Group 1 mice were injected intravenously with rAAV9-CA-SGSH at a dose of 1X 10 per tail13GC/kg. Group 2 mice were injected with rAAV9-CA-SGSH into each tail vein at a dose of 5X 1013GC/kg. Group 3 mice were injected intravenously with scAAV9-CMR-SGSH at a dose of 1X 10 per tail13GC/kg. Group 4 mice were injected intravenously with scAAV9-CMR-SGSH at a dose of 5X 10 per tail13GC/kg. Group 5 mice were treated with 200 μ L PBS per tail vein injection as a control. All mice were sacrificed 1 month after injection, brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were dissected and separated, and different tissues of equal mass were taken to extract total tissue protein. Total Protein concentrations were determined separately for each group using the Pierce BCA Protein Aaasy Kit (ThermoFisher, USA), with detailed procedures in reference to Kit instructions. 30 μ g of total protein was taken from different tissues of all mice for the determination of SGSH enzyme activity. The results are shown in fig. 10, and the activity of SGSH protein in each tissue of C57BL/6J wild-type mice after virus injection is significantly or very significantly higher than that of wild-type mice without virus injection. SGSH enzyme activity of mice injected with scAAV9-CMR-SGSH is higher than that of mice injected with rAAV9-CA-SGSH in a high-dose group and a low-dose group.
The results show that the MPS 3A therapeutic drug designed by the inventor can effectively express and generate the SGSH protein with activity after being injected into a mouse body through tail vein.
Example 6 MPS 3A therapeutic Agents in vivo efficacy evaluation experiments in model mice
After purchasing SGSH gene mutant MPS IIIA model mouse from US jax, breeding with Beijing Edwardo biotechnology Limited to obtain SGSH gene homozygous mutant model45 mice (4-6 weeks old) were randomized and evenly divided into 3 groups. Wherein 1 group served as a negative control group, each was injected with 200. mu.L of PBS only; the other two groups were injected with rAAV9-CA-SGSH and rscAAV9-CMR-SGSH at a dose of 5X 10 per one group as experimental groups13GC/kg. An additional 1 group of 15C 57BL/6J wild mice (4-6 weeks old) was added as controls.
(1) Intravenous injection of rAAV9-SGSH to greatly improve SGSH protein activity of different tissues and organs of a model mouse
After 3 months of virus injection, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. Equal masses of different tissues were taken and total cellular Protein was extracted using a Protein extraction Kit (Applygen Technologies inc., P1250), followed by separate determination of the amount of total Protein using the Pierce BCA Protein aasy Kit (ThermoFisher, usa). 30 μ g of total protein was taken from different tissues of all mice for the determination of SGSH enzyme activity. As a result, as shown in FIG. 11, the SGSH activity in each tissue and organ of a model mouse to which no virus was injected was very low and was hardly detected. The SGSH enzyme activity of heart, liver, spleen, lung, kidney, small intestine, muscle and brain tissues of the model mouse injected with the virus is obviously improved. Significantly or very significantly higher in each tissue than model mice without injected virus. SGSH enzyme activity in multiple tissues was equal or slightly lower than that of wild-type mice, and SGSH enzyme activity in heart and liver was even higher than that of wild-type mice that were not injected with virus. The activity of SGSH enzyme in multiple tissues is higher in a model mouse injected with the scAAV9-CMR-SGSH than in a model mouse injected with the rAAV 9-CA-SGSH.
This shows that the virus designed by us can infect cells widely and effectively in multiple tissues and express and produce SGSH protein with activity after being injected into a model mouse through tail vein.
(2) Determination of organ viral loads of different tissues of model mice injected with rAAV9-SGSH intravenously
On the other hand, 3 months after the injection of the virus, all mice were sacrificed, and brain tissue, heart, liver, spleen, lung, kidney, intestine, muscle tissue, and the like of each mouse were isolated. Different tissues with equal mass are taken, and a blood/cell/tissue genome DNA extraction kit (Tiangen Beijing, DP304) is adopted to extract the total DNA of the cells.
The titer of the rAAV genome is determined and prepared by adopting a quantitative PCR method. The specific process is as follows:
housekeeping genes in model mice and wild type micebeta-ActinTwo primers, beta-Actin-F and beta-Actin-R, are designed; in thathTwo primers hSGSH-F and hSGSH-R are designed in the SGSH gene;
beta-Actin-F：5’- GTCATCACTATTGGCAACGA-3’ (SEQ ID No.10)
beta-Actin-R：5’- CCTAAGAGAAGAGTGACAGA-3’ (SEQ ID No.11)
hSGSH-F：5’- aagtcagcgaggcctacgt -3’ (SEQ ID No.12)
hSGSH-R：5’-GATGGTCTTCGAGCCAAAGAT-3’ (SEQ ID No.13)
specific amplification with beta-Actin-F and beta-Actin-R as primersbeta-ActinThe hSGSH-F and hSGSH-R are primers for specifically amplifying the hSGSH fragment. Adopting SYBR Green dye combination method, 10.815 ng/mu L mouse genome DNA and 10 times of sample diluted in gradient are used as samplesbeta-ActinA standard substance; 1X 107Samples of copies/μ L pRDAV-CA-SGSH plasmid DNA and 10-fold gradient dilution thereof were hSGSH standards. Using SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent, a fluorescent quantitative PCR instrument (model: ABI 7500 fast, ABI) was used according to the literature[66]As described, the viral load was determined in 1 genome copy in each sample. See SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent instructions for procedures.
The results showed that the virus load was hardly detected in each tissue and organ of the model mouse without virus injection and the wild type mouse. The virus load of each tissue and organ of the model mouse injected with the virus is obviously increased, wherein the virus load in the liver is the highest, and the load in multiple tissues of the model mouse injected with the scAAV9-CMR-SGSH is slightly increased compared with the load in multiple tissues of the model mouse injected with the rAAV9-CA-SGSH (table 1).
(3) Intravenous rAAV9-SGSH model mouse urine GAG content determination
After 3 months of virus injection, all mice were urinated at 200. mu.L and the content of GAG in the urine was determined by DMMB spectrophotometry[67]. The results are shown in FIG. 12. The GAG content in urine of the model mouse injected with the virus is obviously lower than that of the model mouse not injected with the virus and slightly higher than that of a normal mouse. Compared with the rat model injected with rAAV9-CA-SGSH, the rat injected with scaAV9-CMR-SGSH has slightly lower urine GAG content.
The results show that after virus injection, SGSH protein produced in the model mouse can effectively decompose GAG stored in the body, thereby obviously reducing the content of GAG in urine.
(4) Determination of tissue GAG content of model mouse injected with rAAV9-SGSH intravenously
After 3 months of virus injection, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, intestine, muscle tissue, etc. of each mouse were isolated. Taking different tissues with equal mass, extracting GAG of the tissues[68]. Tissue GAG content was detected using DMMB spectrophotometry. The results are shown in FIG. 13. The GAG content in multiple tissues of the model mouse injected with the virus is significantly lower than that of the model mouse not injected with the virus, and is slightly higher than that of a normal mouse. Compared with the mouse model injected with the rAAV9-CA-SGSH, the mouse injected with the scAAV9-CMR-SGSH has no obvious difference in multi-tissue GAG content.
The results show that after the injection of the virus, the SGSH protein generated in the model mouse can effectively decompose GAG stored in the tissues, thereby reducing the content of GAG in the tissues and achieving the purpose of treatment.
(5) Determination of model mouse rope grabbing experiment for intravenous injection of rAAV9-SGSH
After injecting the virus for 3 months, the mouse is subjected to rope grabbing training, the height of the mouse is 40cm from a desktop, the mouse is buffered by a sponge cushion laid under the mouse, the training is carried out for 5min each time, the training is carried out for 3 times every day, and the detection is carried out after the training lasts for 3 days. The results are shown in FIG. 14. Compared with the control group model mouse, the rope grabbing time of the model mouse injected with the virus is obviously improved. Wherein the rope grabbing time of the model mouse injected with the rAAV9-CA-SGSH is lower than that of the model mouse injected with the scAAV9-CMR-SGSH and a control wild mouse, and the rope grabbing time of the model mouse injected with the scAAV9-CMR-SGSH and that of the control wild mouse have no obvious difference.
Example 7 MPS 3A therapeutic Agents and other in-research Agents in vivo efficacy evaluation experiments in model mice
MPS 3A gene therapy drugs reported at present mainly include AAVrh10-h.SGSH used in clinical experiments by French Lysogene company and scAAV9.U1a.hSGSH used in clinical experiments by American Abeona company. The Lysogene AAVrh10-h.sgsh uses a carrier with serotype AAVrh10 and is administered by intracranial injection, which is not comparable to the present invention. Comparison was made primarily with the present invention using scaav9.u1a. hsgshgshgshgsh of the same serotype and administered by intravenous route.
The genome of the scAAV9.U1a. hSGSH vector contains AAV2 terminal repetitive sequences, the sequence information of a mouse micronucleus RNA promoter U1a is shown in SEQ ID No14, the sequence information of an hSGSH coding sequence is shown in SEQ ID No15 and a polyadenylation signal from a bovine growth hormone gene. Recombinant AAV viruses were packaged and purified using a three plasmid packaging system. Briefly, AAV vector plasmids, helper plasmids (pHelper) and AAV Rep and Cap protein expression plasmids (pAAV-R2C9) are mixed uniformly according to the molar ratio of 1:1:1, HEK293 cells are transfected by a calcium phosphate method, the cells and culture supernatant are harvested after transfection for 48h, and the recombinant AAV viruses are separated and purified by a cesium chloride density gradient centrifugation method. Packaging and purifying to obtain the scAAV9.U1a. hSGSH.
Model mice (4-6 weeks old) with homozygous mutations in the SGSH gene were 16 mice, and were randomly and evenly divided into 4 groups. Group 1 mice were injected with rAAV9-CA-SGSH into each tail vein at a dose of 5X 1013GC/kg. Group 2 mice were injected intravenously with scAAV9-CMR-SGSH at a dose of 5X 10 per tail13GC/kg. Group 3 mice were injected intravenously with scaav9.u1a. hsgsh at a dose of 5 × 10 per tail13GC/kg. Group 4 mice served as negative controls and were injected with 200 μ L PBS each. An additional 1 group of 4C 57BL/6J wild mice (4-6 weeks old) was added as controls.
All mice were sacrificed 3 months after injection, and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were dissected and isolated. Equal masses of different tissues were taken and total cellular Protein was extracted using a Protein extraction Kit (Applygen Technologies inc., P1250), followed by separate determination of the amount of total Protein using the Pierce BCA Protein aasy Kit (ThermoFisher, usa). 30 μ g of total protein was taken from different tissues of all mice for the determination of SGSH enzyme activity. The results are shown in fig. 15, and SGSH enzyme activity in multiple tissues of 3 treatment groups is higher than that of the negative control model mice, and the SGSH enzyme activity is ranked from high to low as: the model mouse injected with scAAV9-CMR-SGSH is higher than the model mouse injected with rAAV9-CA-SGSH than the model mouse injected with scAAV9.u1a. hsgssh.
The measured value of the enzyme activity of the model mouse injected with the scaaV9.U1a. hSGSH has larger difference with the value reported in the literature, and the analysis reason is caused by different detection methods and detection conditions.
Example 8 in vivo efficacy of different serotypes of AAV vectors on MPS Gene drugs
The effect of AAV vectors of different serotypes on the in vivo efficacy of MPS gene drugs was compared. 28 SGSH gene homozygous mutant model mice (4-6 weeks old) are averagely divided into 7 groups, 6 groups of experimental groups are respectively injected with rAAV5-CA-SGSH, rAAV9-CA-SGSH, rAAVrh10-CA-SGSH, rscAAV5-CMR-SGSH, rscAAV9-CMR-SGSH and rscAAVrh10-CMR-SGSH, and the dosage is 5 multiplied by 1013GC/kg. Control group 1 group was injected with 200. mu.L of PBS per group. An additional 1 group of 4C 57BL/6J wild mice (4-6 weeks old) was added as controls.
After 3 months of virus injection, all mice were sacrificed and brain tissue, heart, liver, spleen, lung, kidney, small intestine, muscle tissue, etc. of each mouse were isolated. Equal masses of different tissues were taken and total cellular Protein was extracted using a Protein extraction Kit (Applygen Technologies inc., P1250), followed by separate determination of the amount of total Protein using the Pierce BCA Protein aasy Kit (ThermoFisher, usa). 30 μ g of total protein was taken from different tissues of all mice for the determination of SGSH enzyme activity. As shown in FIG. 16, the SGSH enzyme activity was very low in each tissue and organ of the model mouse to which no virus was injected, and the SGSH enzyme activity was significantly increased in each tissue and organ of the model mouse after virus injection. Compared with the activity of each tissue enzyme injected with different serotype AAV vectors, the activity of each tissue enzyme is lowest when the serotype is AAV5, is obviously lower than that of the serotype is AAV9, and is slightly lower than that of AAV9 when the serotype is AAVrh 10.
Reference to the literature
1. Hopwood J J, Morris C P. Molecular Biology & Medicine, 1990, 7(5):381.
2. Iozzo R V. Annual Review of Biochemistry, 1998, 67(1):609-652.
3. Jurecka A, Ługowska A, Golda A, et al. Journal of Applied Genetics, 2015, 56(2):205-210.
4. Gilkes J A, Heldermon C D. Pediatric Endocrinology Reviews Per, 2014, 12 Suppl 1:133-140.
5. Heron B, Mikaeloff Y, Froissart R, Caridade G, Maire I, Caillaud C, et al. Am J Med Genet A 2011;155A:58-68.
6. Buhrman D, Thakkar K, Poe M, Escolar ML. Inherit Metab Dis 2014;37:431-7.
7. Shapiro, Elsa G., et al. J Pediatr 170(2016):278-287.
8. Rumsey RK, Rudser K, Delaney K, Potegal M, Whitley CB, Pediatr 2014;164:1147-51
9. James R A, Singh‐Grewal D, Lee S, et al. Journal of Paediatrics & Child Health, 2016, 52(3):262-271.
10. Valstar MJ, Neijs S, Bruggenwirth HT, Olmer R, Ruijter GJ, Wevers RA,et al. Ann Neurol 2010;68:876-87
11. Zelei T, Csetneki K, Vokó Z, et al. Orphanet Journal of Rare Diseases, 2018, 13(1):53.
12.Cleary, M. A., and J. E. Wraith. Archives of Disease in Childhood 69.3(1993):403-406.
13.Sivakumur, P., and J. E. Wraith. Journal of Inherited Metabolic Disease 22.7(1999):849-50.
14.Abbott, N. J., et al. Neurobiology of Disease 37.1(2010):13.
15.Scarpa, M., et al. Molecular Genetics & Metabolism (2017).
16.Tardieu, M., et al. Collaborative Congress of the European-Society-for-Gene- and-Cell-Therapy 2013:A23-A24.
17.Duncan, F. J., et al. Molecular Therapy the Journal of the American Society of Gene Therapy 23.4(2015):638-47.
18.Potegal M, Yund B, Rudser K, Ahmed A, Delaney K, Nestrasil I, et al. Clin Exp Neuropsychol 2013;35:608-16.
19：Sidhu, N. S., et al. Acta Crystallographica 70.5(2014):1321–1335.
20.Yogalingam G, Hopwood JJ. Hum Mutat 2001;18:264-81
21. Jiang Du Yin, pay for soldiers, and Sheng Zhi Yong, Chinese pathophysiology journal 21.5(2005):1020-1025.
22. Atchison RW, et al. Science. 1965; 149: 754-756.
23. Hoggan MD, et al. Proc Natl Sci USA. 1966; 55: 1467-1474.
24. Rose JA, et al. Proc Natl Acad Sci USA. 1969; 64: 863-869.
25. Geoffroy MC, et al. Curr Gene Ther. 2005; 5(3): 265-271.
26. Chiorini JA, et al. Curr Top Microbiol Immunol. 1996; 218:25-33.
27. Atchison RW, et al. Science. 1965; 149: 754-756.
28. Lusby E, et al. J Virol. 1980; 34: 402-409.
29. Samulski RJ, et al. Proc Natl Acad Sci USA. 1982; 79: 2077-2081.
30. Laughlin CA, et al. Gene. 1983; 23: 65-73.
31. Xiao X, et al. J Virol. 1997; 71(2): 941-948.
32. Linden RM, et al. Proc Natl Acad Sci USA. 1996; 93(15): 7966-7972.
33. Ashktorab H, et al. J Virol. 1989; 63(7): 3034-3039.
34. Srivastava A, et al. J Virol. 1983; 45(2): 555-564.
35. Hüser D, et al. PLoS Pathog. 2010; 6(7): e1000985.
36. Wang Z, et al. Gene Ther. 2003;10(26):2105-2111.
37. McCarty DM, et al. Gene Ther. 2003;10(26):2112-2118.
38. Wu Z, et al. Mol Ther. 2006; 14(3): 316-327.
39. Samaranch L, et al. Hum Gene Ther. 2012; 23(4): 382-389.
40. Gruntman AM, et al. Hum Gene Ther Methods. 2015; 26(2): 71-76.
41. Yuan Z, et al. Hum Gene Ther, 2011,22(5):613-624.
42. Wu Xiao Bing Jian, etc. Scientific announcement, 1999, 44 (5): 506-509.
43. Conway JE, et al. Gene Ther, 1999,6:986-993.
44. Wustner JT, et al. Mol Ther, 2002,6(4):510-518.
45. Booth MJ,et al. Gene Ther,2004,11:829-837.
46. Thomas DL, et al. Gene Ther,2009,20:861-870.
47. Chen H. Mol Ther.2008;16(5):924-930.
48. Galibert L,et al.J Invertebr Pathol, 2011,107 Suppl:S80-93.
49. Mietzsch M, et al. Hum Gene Ther. 2014;25:212-222.
50. Mietzsch M, et al. Hum Gene Ther. 2015;26(10):688-697.
51.Bryant LM, et al. Hum Gene Ther Clin Dev. 2013, 24(2): 55-64.
52. Ylä-Herttuala S. Mol Ther. 2012; 20(10): 1831-1832.
53. Kay MA, et al. Nat Genet. 2000; 24(3): 257-261.
54. Jacobson SG, et al. Arch Ophthalmol. 2012; 130(1): 9-24.
55. Salgenik M, et al. Microbiol Spectr. 2015; 3(4).
56. Chen ZY, et al. Mol Ther. 2001; 3(3): 403-410.
57. Wang Z, et al. Nat Biotechnol. 2005;23:321-328.
58. Bish LT, et al. Hum Gene Ther. 2008;19:1359-1368.
59. Zincarelli C, et al. Mol Ther. 2008;16:1073-1080.
60. Prasad KM, et al. Gene Ther. 2011;18:43-52.
61. Rebuffat A, et al. Hum Gene Ther.2010;21(4):463-477.
62. Zhou Q, et al. Sci Rep. 2017; doi: 10.1038/s41598-017-04054-4.
63. Karpova EA. et al. J Inherit Metab Dis. 1996; 19: 278-285
64. Chiorini JA, et al. J Virol. 1994, 68(2): 797-804.
65.Bishop BM, et al. FEBS Lett. 1996, 397(1): 97-100.
66.Duncan FJ, et al. Mol Ther. 2015; 23(4): 638-647.
67. Ch V D L, Versteeg E M, Veerkamp J H, et al. Analytical Biochemistry, 1994, 221(2):356.
68. Gemst J J V, Loeven M A, Graaf M J J D, et al. Plos One, 2016, 11(11):e0167336.
Nucleotide and amino acid sequence table SEQ ID
No. 1: CA promoter
5’-attgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattacccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcg-3’
No. 2: SGSH cDNA sequence
5’-atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacctggacgccttggcccgccgcagcctcctctttcgcaatgccttcacctcggtcagcagctgctctcccagccgcgccagcctcctcactggcctgccccagcatcagaatgggatgtacgggctgcaccaggacgtgcaccacttcaactccttcgacaaggtgcggagcctgccgctgctgctcagccaagctggtgtgcgcacaggcatcatcgggaagaagcacgtggggccggagaccgtgtacccgtttgactttgcgtacacggaggagaatggctccgtcctccaggtggggcggaacatcactagaattaagctgctcgtccggaaattcctgcagactcaggatgaccggcctttcttcctctacgtcgccttccacgacccccaccgctgtgggcactcccagccccagtacggaaccttctgtgagaagtttggcaacggagagagcggcatgggtcgtatcccagactggaccccccaggcctacgacccactggacgtgctggtgccttacttcgtccccaacaccccggcagcccgagccgacctggccgctcagtacaccaccgtaggccgcatggaccaaggagttggactggtgctccaggagctgcgtgacgccggtgtcctgaacgacacactggtgatcttcacgtccgacaacgggatccccttccccagcggcaggaccaacctgtactggccgggcactgctgaacccttactggtgtcatccccggagcacccaaaacgctggggccaagtcagcgaggcctacgtgagcctcctagacctcacgcccaccatcttggattggttctcgatcccgtaccccagctacgccatctttggctcgaagaccatccacctcactggccggtccctcctgccggcgctggaggccgagcccctctgggccaccgtctttggcagccagagccaccacgaggtcaccatgtcctaccccatgcgctccgtgcagcaccggcacttccgcctcgtgcacaacctcaacttcaagatgccctttcccatcgaccaggacttctacgtctcacccaccttccaggacctcctgaaccgcactacagctggtcagcccacgggctggtacaaggacctccgtcattactactaccgggcgcgctgggagctctacgaccggagccgggacccccacgagacccagaacctggccaccgacccgcgctttgctcagcttctggagatgcttcgggaccagctggccaagtggcagtgggagacccacgacccctgggtgtgcgcccccgacggcgtcctggaggagaagctctctccccagtgccagcccctccacaatgagctgtga-3’
NO.3ΔITR
5’-ccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggacagatccc-3’
CMR promoter No.4
5’-tctcgagcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccggactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaacCGCTcgaccggtgtgagtgagtgatttgatctaaatgcctttttgtaatcaagtgactgtgtgtgtgtgtatctgagtgcctgattcttttcatcacag-3’
NO.5:SV40polyA
5’-cagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttttttag-3’
NO.6: CA-Q-F
5’-cccataaggtcatgtactgggcat-3’
NO.7: CA-Q-R
5’-gttcccatagtaacgccaataggg-3’
No.8:CMR-Q-F
5’-ttatatagacctcccaccgt-3’
No.9:CMR-Q-R
5’-taaatggcccgcctggctga-3’
NO.10: beta-Actin-F
5’- gtcatcactattggcaacga-3’
NO.11: beta-Actin-R
5’- cctaagagaagagtgacaga-3’
NO.12: hSGSH-F
5’- aagtcagcgaggcctacgt -3’
NO.13: hSGSH-R
5’-gatggtcttcgagccaaagat-3’
No.14: U1a promoter
5’-cactatggaggcggtactatgtagatgagaattcaggagcaaactgggaaaagcaactgcttccaaatatttgtgatttttacagtgtagttttggaaaaactcttagcctaccaattcttctaagtgttttaaaatgtgggagccagtacacatgaagttatagagtgttttaatgaggcttaaatatttaccgtaactatgaaatgctacgcatatcatgctgttcaggctccgtggccacgcaactc-3’
NO.15 hSGSH CDNA sequence
atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacctggacgccttggcccgccgcagcctcctctttcgcaatgccttcacctcggtcagcagctgctctcccagccgcgccagcctcctcactggcctgccccagcatcagaatgggatgtacgggctgcaccaggacgtgcaccacttcaactccttcgacaaggtgcggagcctgccgctgctgctcagccaagctggtgtgcgcacaggcatcatcgggaagaagcacgtggggccggagaccgtgtacccgtttgactttgcgtacacggaggagaatggctccgtcctccaggtggggcggaacatcactagaattaagctgctcgtccggaaattcctgcagactcaggatgaccggcctttcttcctctacgtcgccttccacgacccccaccgctgtgggcactcccagccccagtacggaaccttctgtgagaagtttggcaacggagagagcggcatgggtcgtatcccagactggaccccccaggcctacgacccactggacgtgctggtgccttacttcgtccccaacaccccggcagcccgagccgacctggccgctcagtacaccaccgtcggccgcatggaccaaggagttggactggtgctccaggagctgcgtgacgccggtgtcctgaacgacacactggtgatcttcacgtccgacaacgggatccccttccccagcggcaggaccaacctgtactggccgggcactgctgaacccttactggtgtcatccccggagcacccaaaacgctggggccaagtcagcgaggcctacgtgagcctcctagacctcacgcccaccatcttggattggttctcgatcccgtaccccagctacgccatctttggctcgaagaccatccacctcactggccggtccctcctgccggcgctggaggccgagcccctctgggccaccgtctttggcagccagagccaccacgaggtcaccatgtcctaccccatgcgctccgtgcagcaccggcacttccgcctcgtgcacaacctcaacttcaagatgccctttcccatcgaccaggacttctacgtctcacccaccttccaggacctcctgaaccgcaccacagctggtcagcccacgggctggtacaaggacctccgtcattactactaccgggcgcgctgggagctctacgaccggagccgggacccccacgagacccagaacctggccaccgacccgcgctttgctcagcttctggagatgcttcgggaccagctggccaagtggcagtgggagacccacgacccctgggtgtgcgcccccgacggcgtcctggaggagaagctctctccccagtgccagcccctccacaatgagctgtga
SEQUENCE LISTING
<110> research institute of gene therapy technology for Beijing Raichh's disease
<120> Gene drug construct for treating mucopolysaccharidosis type 3A
<130> 2019.01.24
<160> 15
<170> PatentIn version 3.5
<210> 1
<211> 527
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
attgacgtca ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg 60
tcaatgggtg gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat 120
gccaagtacg ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca 180
gtacatgacc ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat 240
tacccatggt cgaggtgagc cccacgttct gcttcactct ccccatctcc cccccctccc 300
cacccccaat tttgtattta tttatttttt aattattttg tgcagcgatg ggggcggggg 360
gggggggggg gcgcgcgcca ggcggggcgg ggcggggcga ggggcggggc ggggcgaggc 420
ggagaggtgc ggcggcagcc aatcagagcg gcgcgctccg aaagtttcct tttatggcga 480
ggcggcggcg gcggcggccc tataaaaagc gaagcgcgcg gcgggcg 527
<210> 2
<211> 1509
<212> DNA
<213> ethnic species (Homo sapiens)
<400> 2
atgagctgcc ccgtgcccgc ctgctgcgcg ctgctgctag tcctggggct ctgccgggcg 60
cgtccccgga acgcactgct gctcctcgcg gatgacggag gctttgagag tggcgcgtac 120
aacaacagcg ccatcgccac cccgcacctg gacgccttgg cccgccgcag cctcctcttt 180
cgcaatgcct tcacctcggt cagcagctgc tctcccagcc gcgccagcct cctcactggc 240
ctgccccagc atcagaatgg gatgtacggg ctgcaccagg acgtgcacca cttcaactcc 300
ttcgacaagg tgcggagcct gccgctgctg ctcagccaag ctggtgtgcg cacaggcatc 360
atcgggaaga agcacgtggg gccggagacc gtgtacccgt ttgactttgc gtacacggag 420
gagaatggct ccgtcctcca ggtggggcgg aacatcacta gaattaagct gctcgtccgg 480
aaattcctgc agactcagga tgaccggcct ttcttcctct acgtcgcctt ccacgacccc 540
caccgctgtg ggcactccca gccccagtac ggaaccttct gtgagaagtt tggcaacgga 600
gagagcggca tgggtcgtat cccagactgg accccccagg cctacgaccc actggacgtg 660
ctggtgcctt acttcgtccc caacaccccg gcagcccgag ccgacctggc cgctcagtac 720
accaccgtag gccgcatgga ccaaggagtt ggactggtgc tccaggagct gcgtgacgcc 780
ggtgtcctga acgacacact ggtgatcttc acgtccgaca acgggatccc cttccccagc 840
ggcaggacca acctgtactg gccgggcact gctgaaccct tactggtgtc atccccggag 900
cacccaaaac gctggggcca agtcagcgag gcctacgtga gcctcctaga cctcacgccc 960
accatcttgg attggttctc gatcccgtac cccagctacg ccatctttgg ctcgaagacc 1020
atccacctca ctggccggtc cctcctgccg gcgctggagg ccgagcccct ctgggccacc 1080
gtctttggca gccagagcca ccacgaggtc accatgtcct accccatgcg ctccgtgcag 1140
caccggcact tccgcctcgt gcacaacctc aacttcaaga tgccctttcc catcgaccag 1200
gacttctacg tctcacccac cttccaggac ctcctgaacc gcactacagc tggtcagccc 1260
acgggctggt acaaggacct ccgtcattac tactaccggg cgcgctggga gctctacgac 1320
cggagccggg acccccacga gacccagaac ctggccaccg acccgcgctt tgctcagctt 1380
ctggagatgc ttcgggacca gctggccaag tggcagtggg agacccacga cccctgggtg 1440
tgcgcccccg acggcgtcct ggaggagaag ctctctcccc agtgccagcc cctccacaat 1500
gagctgtga 1509
<210> 3
<211> 121
<212> DNA
<213> adeno-associated virus 2 (adeno-associated virus 2)
<400> 3
ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag gtcgcccgac 60
gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagagag ggacagatcc 120
c 121
<210> 4
<211> 331
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tctcgagcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc 60
ggactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca 120
ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg 180
cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga accgctcgac 240
cggtgtgagt gagtgatttg atctaaatgc ctttttgtaa tcaagtgact gtgtgtgtgt 300
gtatctgagt gcctgattct tttcatcaca g 331
<210> 5
<211> 194
<212> DNA
<213> Simian Virus 40 (Simian Virus 40)
<400> 5
cagacatgat aagatacatt gatgagtttg gacaaaccac aactagaatg cagtgaaaaa 60
aatgctttat ttgtgaaatt tgtgatgcta ttgctttatt tgtaaccatt ataagctgca 120
ataaacaagt taacaacaac aattgcattc attttatgtt tcaggttcag ggggaggtgt 180
gggaggtttt ttag 194
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cccataaggt catgtactgg gcat 24
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gttcccatag taacgccaat aggg 24
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ttatatagac ctcccaccgt 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
taaatggccc gcctggctga 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gtcatcacta ttggcaacga 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cctaagagaa gagtgacaga 20
<210> 12
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aagtcagcga ggcctacgt 19
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gatggtcttc gagccaaaga t 21
<210> 14
<211> 250
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
cactatggag gcggtactat gtagatgaga attcaggagc aaactgggaa aagcaactgc 60
ttccaaatat ttgtgatttt tacagtgtag ttttggaaaa actcttagcc taccaattct 120
tctaagtgtt ttaaaatgtg ggagccagta cacatgaagt tatagagtgt tttaatgagg 180
cttaaatatt taccgtaact atgaaatgct acgcatatca tgctgttcag gctccgtggc 240
cacgcaactc 250
<210> 15
<211> 1509
<212> DNA
<213> ethnic species (Homo sapiens)
<400> 15
atgagctgcc ccgtgcccgc ctgctgcgcg ctgctgctag tcctggggct ctgccgggcg 60
cgtccccgga acgcactgct gctcctcgcg gatgacggag gctttgagag tggcgcgtac 120
aacaacagcg ccatcgccac cccgcacctg gacgccttgg cccgccgcag cctcctcttt 180
cgcaatgcct tcacctcggt cagcagctgc tctcccagcc gcgccagcct cctcactggc 240
ctgccccagc atcagaatgg gatgtacggg ctgcaccagg acgtgcacca cttcaactcc 300
ttcgacaagg tgcggagcct gccgctgctg ctcagccaag ctggtgtgcg cacaggcatc 360
atcgggaaga agcacgtggg gccggagacc gtgtacccgt ttgactttgc gtacacggag 420
gagaatggct ccgtcctcca ggtggggcgg aacatcacta gaattaagct gctcgtccgg 480
aaattcctgc agactcagga tgaccggcct ttcttcctct acgtcgcctt ccacgacccc 540
caccgctgtg ggcactccca gccccagtac ggaaccttct gtgagaagtt tggcaacgga 600
gagagcggca tgggtcgtat cccagactgg accccccagg cctacgaccc actggacgtg 660
ctggtgcctt acttcgtccc caacaccccg gcagcccgag ccgacctggc cgctcagtac 720
accaccgtcg gccgcatgga ccaaggagtt ggactggtgc tccaggagct gcgtgacgcc 780
ggtgtcctga acgacacact ggtgatcttc acgtccgaca acgggatccc cttccccagc 840
ggcaggacca acctgtactg gccgggcact gctgaaccct tactggtgtc atccccggag 900
cacccaaaac gctggggcca agtcagcgag gcctacgtga gcctcctaga cctcacgccc 960
accatcttgg attggttctc gatcccgtac cccagctacg ccatctttgg ctcgaagacc 1020
atccacctca ctggccggtc cctcctgccg gcgctggagg ccgagcccct ctgggccacc 1080
gtctttggca gccagagcca ccacgaggtc accatgtcct accccatgcg ctccgtgcag 1140
caccggcact tccgcctcgt gcacaacctc aacttcaaga tgccctttcc catcgaccag 1200
gacttctacg tctcacccac cttccaggac ctcctgaacc gcaccacagc tggtcagccc 1260
acgggctggt acaaggacct ccgtcattac tactaccggg cgcgctggga gctctacgac 1320
cggagccggg acccccacga gacccagaac ctggccaccg acccgcgctt tgctcagctt 1380
ctggagatgc ttcgggacca gctggccaag tggcagtggg agacccacga cccctgggtg 1440
tgcgcccccg acggcgtcct ggaggagaag ctctctcccc agtgccagcc cctccacaat 1500
gagctgtga 1509

Claims (9)

1. The artificially designed human heparan-N-sulfatase gene expression cassette is characterized by comprising an artificially designed promoter with a sequence shown as SEQ ID number 4 and a human heparan-N-sulfatase coding gene with a sequence shown as SEQ ID number 2.
2. A recombinant adeno-associated viral vector carrying the gene expression cassette of claim 1.
3. The recombinant adeno-associated viral vector according to claim 2, wherein the serotype of the recombinant adeno-associated viral vector is AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or AAVrh 10.
4. The recombinant adeno-associated viral vector according to claim 3 wherein the recombinant adeno-associated viral vector serotype is AAV5, AAV9 or AAVrh 10.
5. The recombinant adeno-associated viral vector according to claim 2 wherein the genome of the recombinant adeno-associated viral vector is a single-stranded DNA or a self-complementary double-stranded DNA.
6. The recombinant adeno-associated viral vector according to claim 5 wherein the genome of the recombinant adeno-associated viral vector is self-complementary double-stranded DNA.
7. A gene medicament comprising the gene expression cassette of claim 1 or the recombinant adeno-associated virus vector of any one of claims 2 to 6.
8. The gene drug of claim 7, which is administered by intravenous injection.
9. Use of the gene expression cassette of claim 1 or the recombinant adeno-associated viral vector of any one of claims 2 to 6 in the manufacture of a medicament for the treatment of mucopolysaccharidosis type 3A.
CN201910069883.4A 2019-01-24 2019-01-24 Gene drug constructs for the treatment of mucopolysaccharidosis type 3A Active CN109762831B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910069883.4A CN109762831B (en) 2019-01-24 2019-01-24 Gene drug constructs for the treatment of mucopolysaccharidosis type 3A

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910069883.4A CN109762831B (en) 2019-01-24 2019-01-24 Gene drug constructs for the treatment of mucopolysaccharidosis type 3A

Publications (2)

Publication Number Publication Date
CN109762831A CN109762831A (en) 2019-05-17
CN109762831B true CN109762831B (en) 2021-04-27

Family

ID=66454419

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910069883.4A Active CN109762831B (en) 2019-01-24 2019-01-24 Gene drug constructs for the treatment of mucopolysaccharidosis type 3A

Country Status (1)

Country Link
CN (1) CN109762831B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2718248C2 (en) * 2014-05-14 2020-03-31 Эстев Фармасьютикалс, С.А. Adeno-associated virus vectors for treating lysosomal storage diseases
CN111718947B (en) * 2020-06-18 2022-08-23 舒泰神（北京）生物制药股份有限公司 Adeno-associated virus vector for treating type IIIA or IIIB mucopolysaccharidosis and use thereof
CN115029360A (en) * 2022-05-30 2022-09-09 上海勉亦生物科技有限公司 Transgenic expression cassette for treating mucopolysaccharidosis type IIIA

Also Published As

Publication number Publication date
CN109762831A (en) 2019-05-17

Similar Documents

Publication Publication Date Title
US20220016263A1 (en) Fabry disease gene therapy
AU2014337783B2 (en) AAV-5 pseudotyped vector for gene therapy for neurological diseases
CN108795946B (en) Recombinant adeno-associated virus carrying SMN1 gene expression cassette and application thereof
AU2021203044A1 (en) Adeno-Associated Virus Vector Delivery Of B-Sarcoglycan And Microrna-29 And The Treatment Of Muscular Dystrophy
CN109762831B (en) Gene drug constructs for the treatment of mucopolysaccharidosis type 3A
US20210060176A1 (en) Methods and compositions for treatment of ocular disorders and blinding diseases
US20220306696A1 (en) Isolated modified vp1 capsid protein of aav5
CN108103096A (en) A kind of Xian Xing Before-daybreak diseases gene therapy medicament
US20230227515A1 (en) Optimized gene therapy for targeting muscle in muscle diseases
CN108611355A (en) The genomic medicine of X-linkage myotublar myopathy
US20230211018A1 (en) Materials and methods for treatment of disorders associated with the ighmbp2 gene
US20230149564A1 (en) Aav-naglu vectors for treatment of mucopolysaccharidosis iiib
US20220389453A1 (en) Materials and methods for the treatment of disorders associated with the irf2bpl gene
US20220143217A1 (en) Neuroprotective gene therapy targeting the akt pathway
WO2023076972A1 (en) Aav-idua vector for treatment of mps i
JP2024505885A (en) Materials and methods for the treatment of lysosomal acid lipase deficiency (LAL-D)
CA3234702A1 (en) Products and methods for myelin protein zero silencing and treating cmt1b disease
JP2021527418A (en) Recombinant adeno-associated virus products and methods for treating dystroglycanopathies and laminin-deficient muscular dystrophy

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant