CN109762831A

CN109762831A - For treating the genomic medicine construct of 3A type mucopolysaccharidosis

Info

Publication number: CN109762831A
Application number: CN201910069883.4A
Authority: CN
Inventors: 马文豪; 武志杰; 董哲岳
Original assignee: Beijing Ruxi Rare Disease Gene Therapy Technology Research Institute
Current assignee: Beijing Ruxi Rare Disease Gene Therapy Technology Research Institute
Priority date: 2019-01-24
Filing date: 2019-01-24
Publication date: 2019-05-17
Anticipated expiration: 2039-01-24
Also published as: CN109762831B

Abstract

Invention provides the novel gene therapeutic agent construct that can be used for 3A type mucopolysaccharidosis, can effective expression recombined human heparan-N- sulfatase (SGSH), be used to prepare the gene therapy medicament product of mediated by adeno-associated virus vector.

Description

For treating the genomic medicine construct of 3A type mucopolysaccharidosis

Technical field

The present invention relates to field of biotechnology, and in particular to the recombinant adeno-associated virus of two kinds of carrying SGSH gene expression frames Carrier and its treatment IIIA type mucopolysaccharidosis application.

Background technique

Mucopolysaccharidosis (mucopolysaccharidosis, MPS) is one kind because of acidic hydrolysis relevant in lysosome Azymia or activity, which reduce, makes acidic mucopolysaccharide (also referred to as glycosaminoglycan, glycosaminoglycan, GAG) that can not degrade or drop Solution not exclusively, causes GAG and its mesostate seriously to be disabled caused by accumulating in vivo, lethal monogenic inheritance generation It declines office, invitation, etc. on account of illness^[1].GAG is a proteoglycan, and the main Types of metabolite and distribution situation in vivo are as follows: (1) sulfuric acid skin Skin element (dermatan sulfate, DS), is distributed mainly in skin, ligament, artery and heart valve tissue；(2) chondroitin sulfate Plain (chondroitin sulfate, CS) (including 4-CS, 6-CS), is primarily present in bone, cartilage, cornea, tendon, blood vessel etc. Tissue；(3) Heparan sulfate (Heparan Sulphate, HS), is primarily present in main artery, liver, lung and various cell membranes Surface；(4) keratan sulfate (keratan sulfate, KS) is the matrix components of cornea, cartilage；(5) hyaluronan (hyaluronan, HA) is widely present in joint fluid, cartilage, connective tissue matrix, skin, umbilical cord and vitreous humor^[2].This Be metabolized the excessive accumulation of incomplete object a bit, will affect the normal function of cell, so as to cause patient's multiple organ, multiple groups knit by Damage.

Enzyme defect is decomposed according to lysosome and stores up the difference of mucopolysaccharide type, can be at present 7 large-scale 17 kinds of Asias by MPS points Type, comprising: I type of MPS (contains I H, I S, I H/S, tri- kinds of hypotypes), and II type of MPS (contains II A, II B, two kinds of hypotypes), and III type of MPS (contains III A, III B, III C, III D, tetra- kinds of hypotypes), IV type of MPS (contains IV A, IV B, two kinds of hypotypes), and VI type of MPS (contains VI A, the two kinds of Asias VI B Type), VII type of MPS, Ⅸ type of MPS (tri- kinds of hypotypes containing HYAL1, HYAL2, HYAL3)^[3].Confirmed after V type of MPS be actually I S hypotype of MPS, VIII type of MPS are also proved it is not a new type, because of the proposal of international MPS name mechanism, original Number is retained.The country is more typical with I, II, IV, VI 4 type of MPS.Except II type of MPS is X-linkage recessive inheritance (XR) Outside, remaining is autosomal recessive inheritance (AR).

III type of MPS (also known as Sanffilippo syndrome) is mixed according to the difference of the enzyme of shortage and fibroblast As a result this disease is divided into tetra- kinds of hypotypes of A, B, C, D.A type is heparan-N- sulfatase (N-sulfoglucosamine Sulfohydrolase, SGSH) lack, Type B is alpha-N-acetylglucosaminidase deficiency, and c-type is N- acetyl grouptransfer azymia, D Type is that aminoglucose -6-sulfatase lacks.The shortage of the above enzyme can cause sulfuric acid (class) heparin (HS) in vivo can not be normal Degradation is to accumulate^[4]。

Mucopolysaccharidosis type ⅢA (mucopolysaccharidosis type 3A, MPS 3A, also known as Sanffilippo syndrome type A) it is a kind of autosomal recessive hereditary diseases as caused by gene defect, disease incidence is according to population Difference about 1/100000 to 1/500000^[5].The patient's body lysosome of the disease lacks heparan-N- sulfatase (N- Sulfoglucosamine sulfohydrolase, SGSH) make Heparan sulfate (Heparan Sulphate, HS) can not From lysosomal degradation to constantly accumulate, the normal physiological activity of cell is influenced^[6].Disease will lead to the feeblemindedness of progressive, It may occur in which progressive nervous symptoms, such as exhausting acrokinesia, spastic tetraplegia, general weakness, aggression simultaneously, this For disease symptom most outstanding^[7].Most patient face is acted normally, and a few patients performance head is big, face is ugly, abdomen is swollen It is grand, progressive is deaf, joint stiffness and hand buckling are in claw-like^[8].Skeleton change only has multiple osteogenesis imperfecta and postparietal causes It is close, thicken.These, which change this disease to diagnosis, has a degree of specificity^[9].Liver, splenomegaly are light to moderate, no cornea Muddiness, acardia involvement.The skeletal abnormality of this type is slighter, can have calvarium, temporo rear portion and occipital bone to thicken mastoid process gasification bad；Vertebra Lower edge slightly swells or oval on body；Internal extremity of clavicle is broadening, and rib is broadening in " quant " sample before some patients；Outside alaossisilii Exhibition, body of ilium are short and narrow.Acetabular bone upper limb is more straight；Tubular bone tubbiness, metaphysis is slightly broadening, can be with the moulding obstacle of bone.Bone Pulp cavity is narrow, irregular etc.^[10].The main clinical manifestation that H é ron etc. reports 15 MPS IIIA diagnosis is delayed speech (93%), rough features (92%), abnormal behaviour (75%), hepatomegaly (51%), autism spectrum disorder (29%) and insane Epilepsy (17%).Delgadillo etc. reports the similar symptom of 34 MPS IIIA patients;Speech delay, thick facial characteristics and Hyperactivity is 3 occurred most frequently, and hyperactivity occurs in the median age to be 3.8 years old, and speech loss is 5.8 years old, and epileptic attack is 7.0 years old (range, 2.5-16.0 years old), and losing walking ability is 10.4 years old.Valstar etc. has found hypoevolutism and/or row The median age generally occurred within for the initial sign of problem is 2.5 years old.There are 53 to be diagnosed as epilepsy, middle position year in 80 patients Age is 11.0 years old^[11]。

Currently, MPS 3A does not have effective treatment method, the existence matter of patient can only be improved by assisting in the treatment of Amount^[12].That treats MPS 3A is critical that patient's lysosome obtains the SGSH of enough degradation HS, and means include marrow and do thin Born of the same parents' transplanting, enzyme replacement therapy and gene therapy.Regrettably, clinical research discovery bone-marrow transplantation can not mitigate moving back for intelligence Change^[13]；Enzyme replacement treatment is that patient inputs recombination SGSH albumen, and difficult point is that the albumen inputted is difficult to send out by blood-brain barrier The effect of waving^[14], patient needs lifelong medication, painful and somewhat expensive.Gene therapy is believed to fundamentally control More this disease^[15].There are both Lysogene (France) and Abeona (U.S.) that gene therapy medicament is advanced to one in the world at present Phase and the second stage of clinical stage.Lysogene is administered by the way of intracranial injection, is performed the operation, and administration process complexity is disease People brings pain.The drug of Abeona company design uses U1a promoter, and U1a promoter expression is weaker^[16-17].It is domestic It yet there are no the relevant gene therapy project report of MPS 3A.In order to thoroughly cure MPS 3A disease, patient is set to have medicine that can cure, having must To develop new drug.

The pathogenesis for looking back MPS 3A, the SGSH gene mutation positioned at 17q25.3 cause body that cannot synthesize Correct SGSH albumen results in this progressive disease^[18], had now been found that 100 kinds or more of SGSH gene mutation and disease The quick or chronic progress of disease is related^[19].MPS 3A is a kind of autosomal recessive hereditary diseases, when parent is dcc gene When carrier, it may be infant that the child given birth to, which has 25%, and 50% possibility is also carrier.The enzyme of the SGSH albumen of carrier Activity has a reduction, the enzymatic activity of about 50% or so, the MPS 3A patient of normal individual be generally normal level 10% or more It is low^[20].HS is widely present in animal tissue and various structures, is primarily present in main artery, liver, lung and various cell membranes Surface, it is corresponding equally also have the function of multiple biological activities and, sticking including cell, regulating cell growth and proliferation, Growth course and blood clotting, cell surface proteolipid protein lipase and other oroteins, angiogenesis, poisoning intrusion and swollen Tumor metastasis etc..It is not degraded in addition, HS participates in protected protein matter, regulation protein passes through substrate film transfer, mediating protein It is built-in etc.^[21].SGSH protein deficiency causes HS to be unable to eubolism to the accumulation in cell and tissue, to influence organizer The normal physiological function of official forms a series of disease.

Adeno-associated virus (Adeno-associated virus, AAV) is obtained because finding in adenoviral preparation Name^[22-23].AAV is Parvoviridae (Parvovirus) member, includes various serotype, and genome is single stranded DNA^[24], Wherein the Genome Size of AAV2 is 4682 nucleotide.AAV is dependovirus, needs other viruses such as adenovirus, merely Herpesviral and human papilloma virus^[25]Or cofactor provides miscellaneous function ability reproducible.Exist in no helper virus When, its genome, which would be integrated into, after AAV infection cell becomes latence in cell chromosome^[26], without generating progeny virus.

The AAV virus being separated to earliest is 2 type AAV (AAV2) of serotype^[27].AAV2 genome is about 4.7kb, genome Both ends are " inverted terminal repeat " (inverted the terminal repeat, ITR) of length 145bp, are in the palindrome-hair Card structure^[28].There are two great opening reading frame (ORF) in genome, are separately encoded rep and cap gene.The full-length gene of AAV2 Group has been cloned into escherichia coli plasmid^[29-30]。

ITR is the cis-acting elements of AAV vector gene group, in the integration of AAV virus, rescue, duplication and genome packet It plays a significant role in dress^[31].It include Rep protein binding site (Rep binding site, RBS) and end in ITR sequence Unwinding site trs (terminal resolution site), can be identified by Rep protein binding and generate at trs and cut Mouthful^[32].ITR sequence can also form unique " T " alpha type secondary structure, and important work is played in the life cycle of AAV virus With^[33]。

AAV2 genome rest part can be divided into 2 functional areas, the gene regions rep and the gene regions cap^[34].It compiles the gene regions rep Code tetra- kinds of Rep albumen of Rep78, Rep68, Rep52 and Rep40.Rep albumen is for the duplication of AAV virus, integration, rescue and packet Dress all plays a significant role.Wherein end unwinding site trs (the terminal resolution in Rep78 and Rep68 and ITR Site) and GAGY repeats motif (repeat motif) specific binding^[35], start AAV genome from single-stranded answering to double-strand Process processed.Trs and GAGC repeats the center that motif is AAV genome duplication in ITR, thus while in the AAV of various serotypes ITR sequence is all not quite similar in virus, but can form hairpin structure and there are Rep binding sites.In AAV2 gene group picture There is p19 promoter at spectral position 19, expresses Rep52 and Rep40 respectively.Rep52 and Rep40 is not bound with the function of DNA, and has The DNA helicase activity that ATP is relied on.Capsid protein VP1, VP2 and VP3 of cap gene coding AAV virus.Wherein, VP3 molecule Amount is minimum, but quantity is most, the ratio substantially 1:1:10 of VP1, VP2, VP3 in mature AAV particle.VP1 is to be formed with Necessary to infective AAV；VP2 assists VP3 to enter nucleus；VP3 is the major protein for forming AAV particle.

With the understanding to AAV vial life period and its relevant molecule biological mechanism, AAV virus has been transformed into one The efficient foreign gene transfer tool of kind, i.e. AAV carrier.It only include the ITR of AAV virus in improved AAV vector gene group Sequence and the exogenous gene expression frame for carrying transhipment, the Rep and Cap protein that virus packaging needs are mentioned by the way that exogenous plasmid is trans- For reducing rep and cap gene and being packaged into the possible harm of AAV carrier.In addition, AAV virus itself, which does not have, causes a disease Property, so that AAV carrier is become generally acknowledged one of safest viral vectors.Delete the D sequence in the side ITR sequence of AAV virus Can also make to be packaged to be with trs (terminal resolution site) sequence recombination AAV (recombinate AAV, RAAV) viral vectors carries genomic self complementation, forms double-strand, significantly improves the inside and outside transduction effect of AAV carrier Rate^[36-37].The virus being packaged to be becomes scAAV (self-complementary AAV) virus, i.e., so-called double-strand AAV disease Poison.Different from bilateral ITR unmutated ssAAV (single-stranded AAV), i.e., traditional AAV virus.ScAAV disease The bale capacity of poison is smaller, the only half of ssAAV bale capacity, about 2.2kb-2.5kb, but transduction efficiency after infection cell It is higher.AAV virus serotype is numerous, and different serotype has different tissue infection preferendums, therefore application AAV carrier can Foreign gene is transported to specific organ and tissue^[38].Certain serotypes A AV carriers can also pass through blood-brain barrier, by external source Gene causes in cerebral neuron, provides possibility for the cerebripetal gene transfer of target^[39].In addition, the physicochemical property of AAV carrier Stablize, stronger tolerance is embodied to soda acid and high temperature^[40], it is easy to develop the biological products of high stability.

AAV carrier also has the packaging system of relative maturity, is convenient for large-scale production.Common AAV is carried both at home and abroad at present Body packaging system mainly include three plasmid co-transfection systems, adenovirus for auxiliary virus system, herpes simplex virus (Herpes Simplex virus type 1, HSV1) it is the packaging system of helper virus and the packaging system based on baculoviral.Its In, it is the AAV vector packaging system being most widely used that three plasmid transfection packaging systems are highly-safe because being not necessarily to helper virus, It is also the production system of current mainstream in the world.It shows slightly unfortunately, the missing of efficiently extensive transfection method limits three matter Application of the grain transfection system in AAV carrier large scale preparation.Yuan etc. establishes extensive as the AAV of helper virus using adenovirus Packaging system^[41], the system production is high-efficient, but trace of the adenovirus in last AAV finished product exists in packaging system, influences The safety of AAV finished product.HSV1 is another kind of widely used AAV carrier package as the packaging system of helper virus System.Wu Zhijian and Conway etc. almost while in the world proposes the AAV2 carrier package plan using HSV1 as helper virus Slightly^[42-43].Subsequent Wustner etc. proposes the AAV5 carrier package strategy using HSV1 as helper virus^[44].On this basis, Booth etc. carries the rep/cap gene of AAV and the opposing end sequence (Inverted of AAV using two HSV1 respectively Terminal repeat, ITR)/exogenous gene expression frame, so latter two recombination HSV1 virus co-infection produces cell, packaging Generate AAV virus^[45].Thomas etc. further establishes the suspension cell system of double HSV1 virus AAV productions^[46], make more extensive AAV virus production be possibly realized.In addition, Urabe etc. carried respectively using three baculovirals AAV structure, it is non-structural and ITR/ exogenous gene expression frame constructs the baculoviral packaging system of AAV carrier.In view of baculoviral foreign gene-carrying Unstability, then reduce the number of required baculoviral in production system, gradually the needs since most three are rod-shaped Virus, which arrives, needs two or baculovirals^[47-48]And a baculoviral adds one plant of inducible cell line strategy^[49-50].Every kind Packaging system all differs from one another, and can make suitable selection as needed.

Due to These characteristics, AAV carrier is increasingly becoming the gene that one kind is widely used in gene therapy, especially hereditary disease The foreign gene transfer tool for the treatment of.By 04 month 2017, global clinical gene therapy scheme totally 2463 passed through, The disease treated mainly threatens various diseases that are serious, not being satisfied clinical demand to human health, specifically includes something lost Pass disease, tumour, cardiovascular disease, infectious diseases, autoimmune disease, central nervous system disease, blood disease, metabolic disease And various other refractory diseases etc..And due to safety and expression persistently etc. advantages, AAV carrier become base more and more Because of the first choice for the treatment of^[51].In the clinical protocol passed through, about 7.4% has used AAV carrier as the transmission system of gene.In detail Information can refer to website http://abedia.com/wiley/indications.php.More importantly being carried based on AAV The lipoprotein lipase gene therapeutic agent Glybera of body was ratified to list in 2012 by European Bureau of Drugs Supervision, became the Western countries First AAV vector gene therapy drug of approval^[52]；Haemophilia B^[53]With congenital amaurosis disease (RPE65Gene mutation is drawn It rises)^[54]AAV vector gene therapy drug obtain good clinical trial result, it is contemplated that pin can be listed in the near future It sells, benefits many patients.

In the present invention, we select AAV carrier to carry SGSH gene expression frame, are mainly based upon the following of AAV carrier Feature.First, AAV carrier only retains two ITR sequences for packing needs in wild-type virus, wild-type virus gene is not contained Protein coding gene in group^[55], immunogenicity is low.Second, AAV is real usually in the form of unconformable extrachromosomal genetic element Now carry the continual and steady expression of gene frame^[56], avoid being inducted into gene random integration and bring safety issue.Its Three, AAV carrier are by being injected intravenously transduction efficiency with higher^[57-61], guarantee that SGSH gene expression frame can be high in vivo The expression of effect ground.

According to the above mentality of designing, single-stranded rAAV-CA-SGSH and double-strand rAAV-CMR-SGSH virus is prepared in we, And design the rAAV-CA-EGFP that the glimmering albumen of expression green is prepared, the control virus such as rAAV-CMR-EGFP.By these viruses Equal dosage are injected in the model mice body of SGSH gene defect respectively, evaluation design rAAV-CA-SGSH,rAAV-CMR-SGSH Validity.The results show that rAAV-CA-SGSH and rAAV-CMR-SGSH can sustainedly and stably be grown in model mice body Temporal expressions SGSH albumen, significantly improves the intracorporal SGSH content of model mice, excessive sulfuric acid second in hydrolyzed cellular lysosome Acyl heparin makes the content of Heparan sulfate in cell decline to a great extent, and reaches and maintains normal level.Show huge healing The potentiality of MPS IIIA disease.

Summary of the invention

In view of this, the present invention provides the gene therapy medicament of two kinds of novel MPS IIIA diseases based on AAV carrier.Medicine Object carries SGSH gene expression frame by AAV carrier.SGSH gene is Wild type human SGSH gene.In gene expression frame, CA The high efficient expression of promoter and the CMR promoter regulation SGSH gene artificially designed.Based on above-mentioned design, it is contemplated that the drug passes through After intravenous injection can high efficient expression SGSH albumen in vivo, significantly improve the content of intracellular SGSH albumen, it is molten to participate in hydrolysis Excessive Heparan sulfate in enzyme body, makes the content of Heparan sulfate in cell decline to a great extent, and reaches and maintains normal water It is flat, to achieve the purpose that treat MPS IIIA.

In order to achieve the above-mentioned object of the invention, the present invention the following technical schemes are provided:

The present invention provides the gene therapy medicaments that two kinds are treated MPS IIIA disease, which is characterized in that drug is based on recombination AAV Drug effect element can be imported efficiently in vivo using AAV carrier by intravenous injection, realize drug effect element table by carrier Up to the high efficient expression of therapeutic effect product albumen SGSH.In order to realize the high efficient expression of SGSH albumen, according to different serotypes AAV Transduction feature, be injected intravenously main selection AAV9 to break through the limitation of blood-brain barrier.

The gene therapy medicament for the treatment of MPS IIIA disease provided by the invention, it is further characterized in that, based on design SGSH gene expression frame can be realized the high efficient expression of SGSH albumen.In the translation initiation password of wild type human SGSH gene order 5 '-GCCACC-3 ' of Kozak sequence is added before sub, improves accurate start efficiency when protein translation.Be respectively adopted CA promoter and The CMR promoter regulation SGSH genetic transcription artificially designed, CA promoter by people's CMV virus enhancer sequence and chicken β- The basal promoter of actin albumen forms, and enables SGSH gene efficient transcription in various kinds of cell.CMR promoter is by people CMV The enhancer sequence of virus is formed through structure optimization, avoids traditional CMV promoter in the characteristic of liver silencing, can be in whole body Popularity expression, and there is preferable specificity in liver.

MPS IIIA disease gene therapeutic agent provided by the invention, which is characterized in that infuse the drug intravenous administration After being incident upon in SGSH gene defect model mice body, high-efficiency continuous in Mice Body SGSH albumen can be steadily expressed, expression produces Raw SGSH albumen participates in the hydrolysis of intracellular Heparan sulfate, reduces its accumulation in cell, and maintain it Normal level.To eliminate the various disease symptoms as caused by the excessive accumulation of Heparan sulfate in cell, reach treatment mesh ?

MPS IIIA disease gene therapeutic agent provided by the invention, it is further characterized in that, single administration can continue for a long time Ground makes cell high-efficient express SGSH albumen, participates in hydrolyzed more Heparan sulfate, ties up the Heparan sulfate in cell It holds in normal level.To reach prolonged therapeutic effect.

The important Initial experiments material that the present invention uses is as follows:

PHelper plasmid derives from AAV Helper Free System (Agilent Technologies, the U.S.), by this Research institute is purchased from AgilentTechnologies company and saves.The plasmid is prepared comprising three plasmid co-transfection HEK293 cells Recombinate adenovirus source helper function genes E2A, E4 and VA RNA required for AAV virus etc..

PAAV-R2C9 plasmid is saved by this research is constructed.With AAV Helper Free System (Agilent Technologies, the U.S.) in pAAV-RC plasmid be basic framework, with AAV9 coat protein coding sequence (GenBank ID:AY530579) replace pAAV-RC plasmid in the 2013rd to 4220 bit sequence to get pAAV-R2C9 plasmid.Brief building Process is, pAAV-R2C9 plasmid sequence information is obtained according to aforementioned thinking, in artificial synthesized pAAV-R2C9 plasmidHinDIII is extremelyPmeSequence between I restriction enzyme site is obtained using the molecular cloning method of standard with composition sequence replacement pAAV-RC plasmid PAAV-R2C9 plasmid.PAAV-R2C9 plasmid includes the cap gene of complete AAV9 and the rep gene of AAV2, is total in three plasmids There is provided in transfection packaging preparation and reorganization AAV1 virus 4 kinds of Rep albumen necessary to packaging (Rep78, Rep68, Rep52 and ) and AAV9 coat protein Rep40.

PAAV-R2C5 plasmid is saved by this research is constructed.With AAV Helper Free System(Agilent Technologies, the U.S.) in pAAV-RC plasmid be basic framework, with AAV genome (GenBank ID:NC_ 006152.1) the 2207th to 4381 bit sequence in coat protein coding sequence Cap5(genome in) it replaces in pAAV-RC plasmid 2013rd to 4220 bit sequence is to get pAAV-R2C5 plasmid sequence.Brief building process is to be obtained according to aforementioned thinking PAAV-R2C5 plasmid sequence information, HindIII is adopted to sequence between PmeI restriction enzyme site in artificial synthesized pAAV-R2C5 plasmid With the molecular cloning method of standard, pAAV-RC plasmid HindIII is replaced to sequence between PmeI with composition sequence, obtains pAAV- R2C5 plasmid.PAAV-R2C5 plasmid includes the cap gene of complete AAV5 and the rep gene of AAV2, in three plasmid co-transfection packets It fills and 4 kinds of Rep albumen (Rep78, Rep68, Rep52 and Rep40) necessary to virus is packed is provided in preparation and reorganization AAV5 virus With AAV5 coat protein.

PAAV-R2C10 plasmid is saved by this research is constructed.With AAV Helper Free System(Agilent Technologies, the U.S.) in pAAV-RC plasmid be basic framework, with AAVrh10 coat protein coding sequence (GenBank ID:AY243015.1) replace pAAV-RC plasmid in the 2013rd to 4220 bit sequence to get pAAV-R2C10 plasmid.Brief structure The process of building is, pAAV-R2C10 plasmid sequence information is obtained according to aforementioned thinking, in artificial synthesized pAAV-R2C10 plasmid HindIII replaces pAAV-RC matter with composition sequence using the molecular cloning method of standard to sequence between PmeI restriction enzyme site Sequence obtains pAAV-R2C10 plasmid between grain HindIII and PmeI restriction enzyme site.PAAV-R2C10 plasmid includes complete The cap gene of AAVrh10 and the rep gene of AAV2 provide packet in three plasmid co-transfections packaging preparation and reorganization AAVrh10 virus 4 kinds of Rep albumen (Rep78, Rep68, Rep52 and Rep40) necessary to filling and AAVrh10 coat protein.

The packaging system of packaging recombination AAVDJ uses Cell Biolabs company AAV-DJ/8 Helper Free Packaging System (article No.: VPK-400-DJ-8, Cell Biolabs), operating process is referring to specification.

The model mice of SGSH gene defect: being purchased from U.S. the jackson laboratory (jax), No.003780.By Beijing Ai Demo Bioisystech Co., Ltd on behalf of breeding.The homozygosis of the SGSH gene defect of 6-10 week old is small Mouse is for testing.Control mice, C57BL/6J mouse are purchased from Beijing Ai Demo Bioisystech Co., Ltd, are used as zoopery Wild type control.

Detailed description of the invention

In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below There is attached drawing needed in technical description to be briefly described.

Fig. 1: pRDAV-CMV carrier structure schematic diagram.It is given by Beijing FivePlus Molecular Medicine Institute, base In AAV carrier pAAV2neo^[62]Building.ITR, inverted terminal repeat, length are the reversed of 145 bp Terminal repeat.CMV promoter, human cytomegalovirus early promoter.BGH polyA, the poly core of bovine growth hormone Thuja acid tailing signal.Amp, ampicillin resistance gene frame.Neo, neomycin resistance gene frame.The carrier contains multiple Restriction enzyme site.

Fig. 2: pRDAV-CA carrier structure schematic diagram.ITR, inverted terminal repeat, length are 145 bp Inverted terminal repeat.CA promoter, human cytomegalovirus early gene enhancer sequence, Chickenβ-actin promoter Sequence assembly.BGH polyA, the polynucleotide tailing signal of bovine growth hormone.Amp, ampicillin resistance gene frame. Neo, neomycin resistance gene frame.The carrier contains multiple restriction enzyme sites.

Fig. 3: pRDAV-CA-SGSH carrier structure schematic diagram.ITR, inverted terminal repeat, length are The inverted terminal repeat of 145 bp.CA promoter, human cytomegalovirus early gene enhancer sequence, chicken β-actin Promoter sequence splicing.SGSH: the coded sequence (coding sequence, CDS) of people's heparan-N- sulfatase.bGH PolyA, the polynucleotide tailing signal of bovine growth hormone.Neo, neomycin resistance gene frame.

Fig. 4: pscAAV-CMV carrier structure schematic diagram.ITR, inverted terminal repeat, two sides it is reversed Terminal repeat.Δ ITR deletes the inverted terminal repeat of D sequence.CMV promoter, human cytomegalovirus early stage The sequence of promoter.BGH polyA, the polynucleotide tailing signal of bovine growth hormone.Amp, ampicillin resistance gene Frame.Neo, neomycin resistance gene frame.The carrier contains multiple restriction enzyme sites.

Fig. 5: pscAAV-CMR-SGSH carrier structure schematic diagram.ITR, inverted terminal repeat, two sides Inverted terminal repeat.Δ ITR deletes the inverted terminal repeat of D sequence.CMR promoter, that artificially designs opens Mover.SGSH: the CDS of people's heparan-N- sulfatase.SV40 polyA, the polynucleotide tailing of vacuolating virus of monkey Signal.Amp, ampicillin resistance gene frame.Neo, neomycin resistance gene frame.

Fig. 6: pRDAV-CA-SGSH, protein expression testing result after pscAAV-CMR-SGSH plasmid transfection Huh-7 cell. PRDAV-CA-SGSH and pscAAV-CMR-SGSH transfects Huh-7 cell.After 48 h, cell is collected in digestion and to extract Huh-7 thin Born of the same parents' total protein takes 30 μ g measurement SGSH expression, and method is Western blotting.PRDAV-CA-SGSH is transfected as the result is shown And after pscAAV-CMR-SGSH, the SGSH protein band of cell is obvious, and SGSH albumen is not detected in blanc cell total protein Band.Swimming lane 1, the SGSH albumen and internal reference Protein G APDH of blank Huh-7 cell；Swimming lane 2, transfects pRDAV-CA-SGSH's The SGSH albumen and internal reference Protein G APDH, swimming lane 3 of Huh-7 cell, transfect the SGSH of the Huh-7 cell of pscAAV-CMR-SGSH Albumen and internal reference Protein G APDH.

SGSH enzymatic activity is examined after Fig. 7: pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmid in-vitro transfection Huh-7 cell Survey result.PRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmid transfection Huh-7 cell.After 48 h, digestion is collected cell and is mentioned Huh-7 total protein of cell is taken, BCA method detects protein concentration, and 30 μ g is taken to measure SGSH enzymatic activity.PRDAV- is transfected as the result is shown After CA-SGSH and pscAAV-CMR-SGSH plasmid, the SGSH enzymatic activity of cell compares the extremely significant rising of ghost.

SGSH Enzyme assay knot after Fig. 8: rAAVDJ-CA-SGSH and rAAVDJ-CMR-SGSH infection Huh-7 cell Fruit.RAAVDJ-SGSH and rAAVDJ-CMR-SGSH infects Huh-7 cell, and MOI is respectively 2000 and 10,000 vector genome (GC)/cell.After 48 h, total protein of cell is extracted, 30 μ g is taken to measure SGSH enzymatic activity.The results show that infection After rAAVDJ-SGSH, Huh-7 cell is significantly increased relative to blank Huh-7 cell SGSH enzymatic activity, when MOI is 10,000 When GC/cell, the more significant MOI that is higher than of the activity of SGSH is 2000 GC/cell.

Fig. 9: pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmid hydrodynamic force injects C57BL/6J wild-type mice The result of SGSH Enzyme assay.PRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmid is injected by tail vein hydrodynamic force C57BL/6J wild-type mice, addition do not inject wild type C57BL/6J mouse as control.Mouse is put to death after 18 h, takes liver It is dirty, take 30 μ g to measure SGSH enzyme activity after extracting total protein.The result shows that injection pRDAV-CA-SGSH and pscAAV-CMR- The mouse liver SGSH enzymatic activity of SGSH plasmid significantly increases.

Figure 10: rAAV9-CA-SGSH and scAAV9-CMR-SGSH injects the inspection of C57BL/6J wild-type mice SGSH enzymatic activity The result of survey.RAAV9-CA-SGSH and scAAV9-CMR-SGSH passes through tail vein injection C57BL/6J wild-type mice, dosage Respectively 1 × 10¹³GC/kg and 5 × 10¹³GC/kg.The wild type C57BL/6J mouse conduct pair of injection PBS is added simultaneously According to.After 1 month, whole mouse are put to death, separate brain tissue, heart, liver, spleen, lung, kidney, small intestine and the muscle of every mouse Tissue etc..After extracting total protein, 30 μ g is taken to measure SGSH enzyme activity.The result shows that injection rAAV9-CA-SGSH and scAAV9- The mouse of CMR-SGSH is improved in each tissue SGSH enzymatic activity, and liver and the promotion of spleen tissue are the most significant.Dosage is 5 × 10¹³ Respectively organizing SGSH enzymatic activity to be above dosage when GC/kg is 1 × 10¹³GC/kg.ScAAV9-CMR-SGSH compares rAAV9-CA- SGSH multiple groups knit interior enzymatic activity promoted it is higher.

SGSH enzyme after the model mice of Figure 11: rAAV9-CA-SGSH and scAAV9-CMR-SGSH injection SGSH gene defect Activity determination result.RAAV9-CA-SGSH and scAAV9-CMR-SGSH is small by the model of tail vein injection SGSH gene defect Mouse, dosage are 5 × 10¹³GC/kg.The model mice that injection PBS is added simultaneously and wild type C57BL/6J mouse are as control.3 After a month, whole mouse are put to death, separate brain tissue, heart, liver, spleen, lung, kidney, small intestine and the musculature of every mouse Deng.After extracting total protein, 30 μ g is taken to measure SGSH enzyme activity.The result shows that in each histoorgan of the model mice of non-injecting virus SGSH enzymatic activity is extremely low almost not to be detected, and each histoorgan SGSH enzymatic activity of the model mice of injecting virus significantly increases, and is only omited Lower than wild-type mice.SGSH enzymatic activity in heart and liver is even more than the wild-type mice of non-injecting virus.

1 rAAV9-SGSH of table injects the testing result of the model mice restrovirus carrying capacity of SGSH gene defect.rAAV9- CA-SGSH and scAAV9-CMR-SGSH passes through the model mice of tail vein injection SGSH gene defect, and dosage is 5 × 10¹² vg/ kg.The model mice that non-injecting virus is added simultaneously and wild type C57BL/6J mouse are as control.It, will be all small after 3 months Mouse is put to death, and brain tissue, heart, liver, spleen, lung, kidney, small intestine and the musculature etc. of every mouse are separated.After extracting total protein, Measure virus load.The result shows that each histoorgan of model mice and wild-type mice of non-injecting virus does not almost detect disease Malicious carrying capacity.And the model mice of injecting virus respectively organizes organopathy poison carrying capacity significantly raised, wherein virus load highest in liver.

Urine after the model mice of Figure 12: rAAV9-CA-SGSH and scAAV9-CMR-SGSH injection SGSH gene defect GAG content detection result.RAAV9-CA-SGSH and scAAV9-CMR-SGSH passes through the mould of tail vein injection SGSH gene defect Type mouse, dosage are 5 × 10¹³GC/kg.Model mice and the conduct pair of wild type C57BL/6J mouse of injection PBS are added simultaneously According to.After 3 months, each 200 μ L of the urine of whole mouse of experimental group and control group is taken, mouse retention is measured using DMMB development process Liquid GAG content.The result shows that the model mice urine GAG content of injecting virus is decreased obviously.

It is organized after the model mice of Figure 13: rAAV9-CA-SGSH and scAAV9-CMR-SGSH injection SGSH gene defect GAG content detection result.RAAV9-CA-SGSH and scAAV9-CMR-SGSH passes through the mould of tail vein injection SGSH gene defect Type mouse, dosage are 5 × 10¹³GC/kg.Model mice and the conduct pair of wild type C57BL/6J mouse of injection PBS are added simultaneously According to.After 3 months, whole mouse are put to death, separate brain tissue, heart, liver, spleen, lung, kidney, small intestine and the muscle of every mouse Tissue etc..The GAG for extracting tissue measures Mouse Liver, spleen GAG content using DMMB development process.The result shows that the mould of injecting virus Type mouse is decreased obviously in each tissue GAG content.

It is real that rope is grabbed after the model mice of Figure 14: rAAV9-CA-SGSH and scAAV9-CMR-SGSH injection SGSH gene defect Test testing result.RAAV9-CA-SGSH and scAAV9-CMR-SGSH is small by the model of tail vein injection SGSH gene defect Mouse, dosage are 5 × 10¹³GC/kg.The model mice that injection PBS is added simultaneously and wild type C57BL/6J mouse are as control.3 After a month, the limb force and balanced capacity for grabbing the whole mouse of rope experiment detection are utilized.The result shows that model is small compared to the control group Mouse, treatment group's model mice grab rope the time be obviously prolonged, with the basic indifference of normal mouse.Inject scAAV9-CMR-SGSH compared with It is more long that the model mice of injection rAAV9-CA-SGSH grabs the rope time.

Figure 15: rAAV9-CA-SGSH, scAAV9-CMR-SGSH and scAAV9.U1a.hSGSH injects SGSH gene defect Model mice after SGSH activity ratio compared with.RAAV9-CA-SGSH, scAAV9-CMR-SGSH and scAAV9.U1a.hSGSH are logical The model mice of tail vein injection SGSH gene defect is crossed, dosage is 5 × 1013 GC/kg.After 3 months, at whole mouse Extremely, brain tissue, heart, liver, spleen, lung, kidney, small intestine and the musculature etc. of every mouse are separated.After extracting total protein, 30 are taken μ g measures SGSH enzyme activity.The result shows that SGSH enzymatic activity is extremely low in each histoorgan of the model mice of non-injecting virus, injection disease Each histoorgan SGSH enzymatic activity of model mice of poison significantly increases, and enzymatic activity injects the model mice of scAAV9-CMR-SGSH Model mice higher than injection rAAV9-CA-SGSH is higher than the model mice of injection scAAV9.U1a.hSGSH.

Figure 16: AAV carrier different serotypes inject SGSH gene defect model mice after SGSH activity ratio compared with. rAAV5-CA-SGSH、rAAV9-CA-SGSH、rAAVrh10-CA-SGSH、rscAAV5-CMR-SGSH、rscAAV9-CMR- SGSH, rscAAVrh10-CMR-SGSH, by the model mice of tail vein injection SGSH gene defect, dosage is 5 × 10¹³ GC/kg.After 3 months, whole mouse are put to death, separate brain tissue, heart, liver, spleen, lung, kidney, small intestine and the flesh of every mouse Meat tissue etc..After extracting total protein, 30 μ g is taken to measure SGSH enzyme activity.The result shows that the model mice of non-injecting virus is respectively organized SGSH enzymatic activity is extremely low in organ, and each histoorgan SGSH enzymatic activity of the model mice of injecting virus significantly increases.Each histaminase Expression activitiy, it is AAVrh10 lower than AAV9. that carrier serotype, which is AAV5 lower than serotype,

Specific embodiment

The invention discloses two kinds of IIIA type mucopolysaccharidosis gene therapy medicaments, the design comprising drug, a small amount of systems Standby and functional verification, those skilled in the art can use for reference present disclosure, be suitably modified realization of process parameters.In particular , all similar substitutions and modifications are apparent to those skilled in the art, they are considered as being included in The present invention.Method and application of the invention is described by preferred embodiment, and related personnel can obviously not depart from Method described herein and application are modified or appropriate changes and combinations in the content of present invention, spirit and scope, Lai Shixian With apply the technology of the present invention.Wherein, unless otherwise specified, various reaction reagents involved in embodiment can pass through business canal Road is commercially available.

Below with reference to embodiment, the present invention is further explained:

The building of 1 plasmid vector of embodiment

In order to construct the pRDAV-CA-SGSH plasmid for obtaining packaging recombination AAV virus and needing, what we were saved first with company Based on pRDAV-CMV (Fig. 1), the CA promoter (SEQ ID No.1) obtained with autonomous Design is replaced in pRDAV carrier CMV promoter obtains pRDAV-CA carrier.Next, artificial synthesized mankind SGSH (SEQ ID No.2) sequence is cloned Enter pRDAV-CA carrierKpnI andEcoRBetween I restriction enzyme site, pRDAV-CA-SGSH and carrier are obtained.

(1) pRDAV-CA vector construction

By human cytomegalovirus early gene enhancer sequence, Chickenβ-actin promoter sequence assembly, CA promoter sequence is obtained Column, sequence information are shown in SEQ ID No.1.It is added respectively at the both ends of CA promoter sequenceXhoI andKpnI restriction enzyme site.Addition Sequence is synthesized by Jin Sirui Biotechnology Co., Ltd after restriction enzyme site, and composition sequence is cloned into pUC57 simple carrier (gold This auspicious biotechnology, Nanjing), obtain pUC57-CA.WithXhoI andKpnI distinguish double digested pUC57-CA carrier and PRDAV-CMV carrier, recycling CA segment and the pRDAV-CMV carrier segments (about 6.3kb) for cutting CMV promoter, two segments connect It is converted after connecingE.coliJM109 competent cell (precious biology, Dalian), obtains the AAV containing CA promoter after screening, identification Plasmid vector pRDAV-CA (Fig. 2).

(2) pRDAV-CA-SGSH vector construction

The cDNA sequence (GenBank:BC047318.1) of mankind's SGSH gene is synthesized by Jin Sirui Biotechnology Co., Ltd, Sequence information is shown in SEQ ID No.2, and is separately added into KpnI and EcoRI in the SGSH gene cDNA sequence upstream and downstream of composition sequence Restriction enzyme site, the sequence after synthesis are cloned into pUC57 simple carrier (Jin Sirui biotechnology, Nanjing), obtain pUC57- SGSH carrier.KpnI and EcoRI distinguish double digested pUC57-SGSH carrier and pRDAV-CA carrier, recycling SGSH segment and The pRDAV-CA carrier segments of linearisation, two segments are ligated and transformed intoE.coliJM109 competent cell (precious biology, Dalian), Screening, identification obtain pRDAV-CA-SGSH carrier (Fig. 3).

(3) pscAAV-CMV vector construction

Based on 3 ' end ITR sequences in AAV2 genome (GenBank No. AF043303), delete according to the literature Trs sequence and D sequence in ITR sequence^[36], obtain Δ ITR sequence SEQ ID No3..For convenience of clone, pRDAV- is synthesized CMV carrier B amHI replaces original ITR sequence to the sequence between ApaI, and using Δ ITR, is cloned into pMD18T carrier.Make The carrier is digested with BamHI and ApaI, recycles the segment of ITR containing Δ of 402bp.BamHI and ApaI digests pRDAV-CMV carrier, Recycle 6505bp skeleton segment.It connects two segments and obtains pscAAV-CMV carrier.(Fig. 4)

(4) pscAAV-CMR-SGSH vector construction

CM promoter that the enhancer sequence of people's CMV virus is obtained through structure optimization simultaneously holds in promoter sequence 3 ' and introduces people 62804th to 62890 introne in TATA box binding protein associated factor 1 gene (GenBank:NG_012771.2) Sequence, obtains the promoter sequence for being named as CMR, and sequence information is shown in SEQ ID No4.The CMR promoter of synthesis and in upstream and downstream XhoI and the site KpnI are introduced respectively.Use the skeleton of XhoI and the double digested pscAAV-CMV carrier recovery 6129bp of KpnI Segment, connection obtain pscAAV-CMR.

Use the SGSH segment of KpnI and the double digested pRDAV-CA-SGSH carrier recovery 1509bp of BglII.Synthesize monkey The polynucleotide tailing signal SV40 polyASEQ ID No5 of vacuolating virus, upstream and downstream be separately added into BglII and The site BamHI.

Using the skeleton segment of KpnI and the double digested pscAAV-CMR carrier recovery 6214bp of BamHI, by SGSH piece Section, SV40 polyA are connected thereto to obtain pscAAV-CMR-SGSH carrier (Fig. 5).

The vivoexpression of 2 pRDAV-CA-SGSH carrier of embodiment is verified

(1) the expression measurement of SGSH albumen

Well-grown Huh-7 cell is uniformly laid on 9 holes in six porocyte culture plates, the cell density to every hole, which reaches, is When 80%, pRDAV-CA-SGSH and pscAAV- is transfected respectively using Lipofectamine2000 (Invitrogen, the U.S.) Each 3 hole of CMR-SGSH (detailed process is referring to specification).After 48 h to be transfected, cell is collected after digestion, after multigelation The mode of centrifugation extracts total protein of cell.Utilize Pierce BCA Protein Aaasy Kit (ThermoFisher, beauty State) total protein concentration of measurement transfection pRDAV-CA-SGSH, pscAAV-CMR-SGSH and blanc cell, detailed process are joined respectively Examine kit specification.

After extracting Huh-7 total protein of cell, the expression of SGSH albumen in cell is detected using Western Blotting, Method is detailed in " molecular cloning " (third edition).The result shows that when several total protein of cell applied sample amounts are 30 μ g, internal reference albumen Expression quantity it is approximate, the SGSH protein band of the Huh-7 cell of blank is invisible.The pRDAV-CA-SGSH and pscAAV- of transfection The Huh-7 cell detection of CMR-SGSH plasmid shows that SGSH protein band is obvious, and content is higher (Fig. 6).

(2) determination of activity of SGSH albumen

After extracting total protein of cell, 30 μ g are taken to be used to measure SGSH protease activity respectively in the albumen of said extracted, side Method is detailed in^[63].The result shows that the extremely low SGSH enzymatic activity of blank Huh-7 cell is 0.76 ± 0.16 in Huh-7 cell nmol/17 h/mg protein.And transfect pRDAV-CA-SGSH plasmid Huh-7 cell SGSH enzymatic activity be 13.86 ± 0.34 nmol/17 h/mg protein is 18.2 times of ghost, transfects the Huh-7 cell of pscAAV-CMR-SGSH plasmid SGSH enzymatic activity is 14.02 ± 0.69 nmol/17 h/mg protein, is 18.5 times (Fig. 7) of ghost.

The above results show that constructed pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmid can have in the cell The expression SGSH albumen of effect, and the protein active expressed is very high.

The preparation and calibrating of 3 rAAV-SGSH of embodiment

(1) packaging of different serotypes recombination AAV virus

Recombination AAV virus is packed using three plasmid packaging systems and purified to reference literature [64].Briefly, AAV vector plasmid The Rep and Cap protein expression plasmid of (pRDAV-CA-SGSH or pscAAV-CMR-SGSH), helper plasmid (pHelper) and AAV After (pAAV-R2C5, pAAV-R2C9 or pAAV-R2C10) is mixed according to the molar ratio of 1:1:1, transfected using calcium phosphate procedure HEK293 cell after transfecting 48h, harvests cell and culture supernatant, isolates and purifies recombination using cesium chloride density gradient centrifugation AAV virus.Packaging purifying obtains rAAV5-CA-SGSH, rAAV9-CA-SGSH, rAAVrh10-CA-SGSH, rscAAV5-CMR- SGSH、rscAAV9-CMR-SGSH、rscAAVrh10-CMR-SGSH。

(2) packaging of rAAVDJ-SGSH

Using Cell Biolabs company AAV-DJ/8 Helper Free Packaging System (article No.: VPK-400- DJ-8, Cell Biolabs), rAAVDJ-CA-SGSH and rAAVDJ-CMR-SGSH is packed, operating process is referring to specification.

(3) the titre detection of AAV virus is recombinated

RAAV genome titer is prepared using quantifying PCR method measurement.Detailed process is as follows:

Two primers CA-Q-F and CA-Q-R are designed in CA promoter:

CA-Q-F:5 '-CCCATAAGGTCATGTACTGGGCAT-3 ' (SEQ ID No.6)

CA-Q-R:5 '-GTTCCCATAGTAACGCCAATAGGG-3 ' (SEQ ID No.7)

Two primers CMR-Q-F and CMR-Q-R are designed in CMR promoter:

CMR-Q-F:5 '-ttatatagacctcccaccgt-3 ' (SEQ ID No.8)

CMR-Q-R:5 '-taaatggcccgcctggctga-3 ' (SEQ ID No.9)

It is 175bp segment that CA promoter length as primer specificity is expanded using CA-Q-F and CA-Q-R, primer by Thermofisher Scientific synthesis.Using SYBR Green dye binding method, with the pRDAV-CA-SGSH of 1 μ g/ μ L The sample of plasmid and its 10 times of gradient dilutions is standard items, using SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent (Takara, Dalian, China), detects virus using fluorescence quantitative PCR instrument (model: ABI 7500 fast, ABI) Genome titer.Operating process is referring to SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent specification.Virus Processing method^[65]。

It is 188bp segment that CMR promoter length as primer specificity is expanded using CMR-Q-F and CMR-Q-R, primer by Thermofisher Scientific synthesis.Using SYBR Green dye binding method, with the pscAAV-CMR- of 1 μ g/ μ L The sample of SGSH plasmid and its 10 times of gradient dilutions is standard items, using SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent (Takara, Dalian, China), detects virus using fluorescence quantitative PCR instrument (model: ABI 7500 fast, ABI) Genome titer.Operating process is referring to SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent specification.Virus Processing method.

The vivoexpression of 4 rAAVDJ-SGSH of embodiment is verified

In the expression levels in vitro for carrying out that virus before expression study, need to be verified in virion.Due to the vivoexpression pole of rAAV9 Difference, therefore this research carries out the vivoexpression research of virus using rAAVDJ-SGSH.

Well-grown Huh-7 cell is uniformly laid on 16 holes in six porocyte culture plates, the cell to every hole is close When degree is up to for 80%, 1 hole is selected to carry out cell count, passes through to calculate rAAVDJ-CA-SGSH and rAAVDJ-CMR-SGSH difference is added With MOI for 2,000,10, the dosage of 000 GC/cell infects the Huh-7 cell in 3 holes, and the Huh-7 cell in the other three hole is not Virus infection, as control.After 48 h of virus infection, cell is collected, total protein of cell is extracted by the way of multigelation. Measure the total protein of 3 groups of cells respectively using Pierce BCA Protein Aaasy Kit (ThermoFisher, the U.S.) Concentration, detailed process refer to kit specification.

30 μ g are taken to be used to measure SGSH protease activity respectively in the albumen of said extracted.The result shows that blank Huh-7 is thin The SGSH enzymatic activity of born of the same parents is extremely low, is 0.65 ± 0.05 nmol/17 h/mg protein.Infect the Huh- of rAAVDJ-CA-SGSH 7 cell SGSH enzymatic activitys are to increase obviously.Wherein MOI is 10, when 000 GC/cell, and the SGSH enzymatic activity of Huh-7 cell is 15.48 ± 1.11 nmol/17 h/mg protein, and MOI is 2, the SGSH enzymatic activity of Huh-7 cell when 000 GC/cell For 10.62 ± 0.59 nmol/17 h/mg protein.Infection rAAVDJ-CMR-SGSH Huh-7 cell SGSH enzymatic activity be Increase obvious.Wherein MOI is 10, when 000 GC/cell, and the SGSH enzymatic activity of Huh-7 cell is 18.53 ± 0.50 nmol/17 H/mg protein, and MOI is 2, the SGSH enzymatic activity of Huh-7 cell is 11.54 ± 0.75 nmol/17 when 000 GC/cell H/mg protein (Fig. 8).Cell SGSH enzymatic activity is significantly higher than MOI when MOI is 10,000 when being 2,000.

The above results show after rAAVDJ-SGSH infection cell can effective expression SGSH albumen, and the SGSH egg expressed White enzymatic activity is very high.

5 MPS 3A therapeutic agent of embodiment efficiency evaluation in normal mouse body is tested

(1) C57 BL/6J mouse tail vein hydrodynamic force injects pRDAV-CA-SGSH, pscAAV-CMR-SGSH plasmid

6 week old C57 BL/6J mouse totally 9, are randomly divided into 3 groups.Injection is dissolved in 2 mL in every tail vein 10s of 1st group of mouse The 10 μ g of pRDAV-CA-SGSH plasmid of PBS.Injection is dissolved in the pscAAV- of 2 mL PBS in every tail vein 10s of 2nd group of mouse 10 μ g of CMR-SGSH plasmid.2 mL PBS are injected in every tail vein 10s of 3rd group of mouse.18h puts to death whole mouse after injection, Anatomical isolation liver extracts tissue total protein.Using Pierce BCA Protein Aaasy Kit (ThermoFisher, The U.S.) 3 groups of total protein concentration is measured respectively, detailed process refers to kit specification.The albumen of extraction is taken into 30 μ g respectively For measuring SGSH protease activity.As a result as shown in figure 9, normal mouse liver SGSH enzyme activity is 1.58 ± 0.28 nmol/17 H/mg protein, mouse liver SGSH enzyme activity is 2.61 ± 0.57 nmol/17 h/mg after injecting pRDAV-CA-SGSH plasmid protein.The mouse liver SGSH enzyme activity for injecting pscAAV-CMR-SGSH plasmid is 2.94 ± 0.53 nmol/17 h/mg protein.The result shows that the mouse liver SGSH enzymatic activity of injection pRDAV-CA-SGSH and pscAAV-CMR-SGSH plasmid is aobvious It writes and is promoted.

(2) C57 BL/6J mouse tail vein injection rAAV9-CA-SGSH and rscAAV9-CMR-SGSH

6 week old C57 BL/6J wild mouses totally 15, are randomly divided into 5 groups.Every tail vein injection rAAV9-CA- of 1st group of mouse SGSH, dosage are 1 × 10¹³GC/kg.Every tail vein injection rAAV9-CA-SGSH of 2nd group of mouse, dosage are 5 × 10¹³ GC/kg.Every tail vein injection scAAV9-CMR-SGSH of 3rd group of mouse, dosage are 1 × 10¹³GC/kg.4th group of mouse every Tail vein injection scAAV9-CMR-SGSH, dosage are 5 × 10¹³GC/kg.200 μ L of every tail vein injection of 5th group of mouse PBS is as control.The whole of execution in 1 month mouse after injection, the brain tissue of every mouse of anatomical isolation, heart, liver, spleen, lung, Kidney, small intestine and musculature etc. such as take at the different tissues of quality, extract tissue total protein.Utilize Pierce BCA Protein Aaasy Kit (ThermoFisher, the U.S.) measures the total protein concentration of each group respectively, and detailed process refers to kit explanation Book.The different tissues of all mouse take 30 μ g total proteins for measuring SGSH enzymatic activity.The results are shown in Figure 10, injection disease The activity of C57 BL/6J wild mouse after poison, the SGSH albumen in each tissue is significant or extremely significant higher than non-injecting virus Wild-type mice.The mouse of injection scAAV9-CMR-SGSH is above injection in high dose group and low dose group SGSH enzymatic activity The mouse of rAAV9-CA-SGSH.

The above result shows that we design MPS 3A therapeutic agent after tail vein injection enters in Mice Body, Neng Gouyou The expression of effect ground generates active SGSH albumen.

6 MPS 3A therapeutic agent of embodiment efficiency evaluation in model mice body is tested

After jax buys the MPS IIIA model mice of SGSH gene mutation from the U.S., the limited public affairs of Beijing Ai Demo biotechnology are asked Department obtains the model mice 45 (4-6 week old) of SGSH homozygous mutation on behalf of breeding, and stochastic averagina is divided into 3 groups.Wherein 1 group is used as negative control group, and every is only injected 200 μ L PBS；Other two groups are used as experimental group to inject rAAV9-CA- respectively SGSH and rscAAV9-CMR-SGSH, injection dosage are every 5 × 10¹³GC/kg.It is wild small that 1 group of 15 C57BL/6J is separately added Mouse (4-6 week old) is as control.

(1) the greatly horizontal SGSH protein active for improving model mice different tissues organ of intravenous injection rAAV9-SGSH

After injecting virus 3 months, whole mouse are put to death, separate the brain tissue of every mouse, heart, liver, spleen, lung, kidney, small Intestines and musculature etc..The different tissues for the quality such as taking extract total protein of cell (Applygen using Protein Extraction Reagent kit Technologies Inc., P1250), then using Pierce BCA Protein Aaasy Kit (ThermoFisher, The U.S.) respectively measure total protein amount.The different tissues of all mouse take 30 μ g total proteins for measuring SGSH enzymatic activity. As a result as shown in figure 11, the activity of SGSH is extremely low in each histoorgan of the model mice of non-injecting virus is nearly no detectable.Note Model mice after penetrating virus, heart, liver, spleen, lung, kidney, small intestine, muscle, brain tissue SGSH enzymatic activity have significantly Rise.The significant or extremely significant model mice higher than non-injecting virus in each tissue.SGSH enzymatic activity and open country in multiple groups are knitted It is fair or slightly lower that raw type mouse is compared, and the wild type that the SGSH enzymatic activity in heart and liver is even more than non-injecting virus is small Mouse.Injection scAAV9-CMR-SGSH knits SGSH enzymatic activity in multiple groups compared to the model mice of injection rAAV9-CA-SGSH will be more It is high.

This shows that we design viral after in tail vein injection model mice body, can knit and be widely and effectively in multiple groups Infection cell simultaneously expresses the active SGSH albumen of generation.

(2) it is injected intravenously the measurement of the model mice different tissues organ virus load of rAAV9-SGSH

On the other hand, after injecting virus 3 months, whole mouse are put to death, separate the brain tissue of every mouse, heart, liver, Spleen, lung, kidney, intestines and musculature etc..The different tissues for the quality such as taking, using blood/cell/tissue extracting genome DNA reagent Box (Tiangeng Beijing, DP304) extracts cell total DNA.

In model mice and wild-type mice house-keeping genebeta-ActinMiddle design two primers beta-Actin-F and beta- Actin-R；?hTwo primers hSGSH-F and hSGSH-R are designed in SGSH gene；

Beta-Actin-F:5 '-GTCATCACTATTGGCAACGA-3 ' (SEQ ID No.10)

Beta-Actin-R:5 '-CCTAAGAGAAGAGTGACAGA-3 ' (SEQ ID No.11)

HSGSH-F:5 '-aagtcagcgaggcctacgt -3 ' (SEQ ID No.12)

HSGSH-R:5 '-GATGGTCTTCGAGCCAAAGAT-3 ' (SEQ ID No.13)

It as primer specificity is expanded using beta-Actin-F and beta-Actin-Rbeta-ActinSegment, hSGSH-F and HSGSH-R expands hSGSH segment for primer specificity.Using SYBR Green dye binding method, respectively with 10.815 ng/ μ The sample of the mouse gene group DNA of L and its 10 times of gradient dilutions isbeta-ActinStandard items；1×10⁷ copies/μL The sample of pRDAV-CA-SGSH Plasmid DNA and its 10 times of gradient dilutions is hSGSH standard items.Using SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent, using fluorescence quantitative PCR instrument (model: ABI 7500 fast, ABI) according to text It offers^[66]It is described, measure the virus load in 1 genome copies in each sample.Operating process is referring to SYBR Premix Ex Taq II (Tli RNaseH Plus) reagent specification.

The result shows that each histoorgan of model mice and wild-type mice of non-injecting virus does not almost detect viral load Amount.And the model mice of injecting virus respectively organizes organopathy poison carrying capacity significantly raised, wherein virus load highest in liver, is injected Model mice of the scAAV9-CMR-SGSH compared to injection rAAV9-CA-SGSH knits interior carrying capacity in multiple groups and slightly promotes (table 1).

(3) it is injected intravenously the model mice urine GAG assay of rAAV9-SGSH

After injecting virus 3 months, all mouse take 200 μ L of urine, are contained using GAG in DMMB spectrophotometry urine Amount^[67].The result is shown in Figure 12.GAG content is substantially less than the model mice of non-injecting virus in the model mice urine of injecting virus, Slightly above normal mouse.Inject model mice urine GAG content of the scAAV9-CMR-SGSH compared to injection rAAV9-CA-SGSH It is slightly lower.

The result shows that the SGSH albumen generated in model mice body can be stored up in effective decomposer after injecting virus GAG, so that GAG content in urine be made to be decreased obviously.

(4) it is injected intravenously the model mice tissue GAG assay of rAAV9-SGSH

After injecting virus 3 months, whole mouse are put to death, separate brain tissue, heart, liver, spleen, lung, kidney, the intestines of every mouse And musculature etc..The different tissues for the quality such as taking, extract the GAG of tissue^[68].Using in DMMB spectrophotometry tissue GAG content.The result is shown in Figure 13.The model mice multiple groups of injecting virus knit the model that middle GAG content is substantially less than non-injecting virus Mouse, slightly above normal mouse.Injection scAAV9-CMR-SGSH is knitted compared to the model mice multiple groups of injection rAAV9-CA-SGSH GAG content no significant difference.

The result shows that the SGSH albumen generated in model mice body can be store in effective break-up tissue after injecting virus Long-pending GAG achievees the purpose that treatment so that GAG content in tissue be made to reduce.

(5) model mice for being injected intravenously rAAV9-SGSH grabs rope measuring

After injecting virus 3 months, mouse is carried out to grab rope training, from desktop 40cm high, lower berth foam-rubber cushion buffering, every time training 5min, training 3 times, are detected after continuing 3 days daily.The result is shown in Figure 14.The model mice of injecting virus grabs the rope time compared to control Group model mouse is obviously improved.The model mice for wherein injecting rAAV9-CA-SGSH grabs the rope time lower than injection scAAV9-CMR- The model mice and control wild mouse, the model mice for injecting scAAV9-CMR-SGSH of SGSH grabs rope with wild mouse is compareed Time no significant difference.

7 MPS 3A therapeutic agent of embodiment and other grinding drug in model mice body efficiency evaluation test

Currently reported MPS 3A gene therapy medicament mainly has French Lysogene company for clinical trial AAVrh10-h.SGSH and Abeona company, the U.S. are used for the scAAV9.U1a.hSGSH of clinical trial.Lysogene company AAVrh10-h.SGSH use serotype be administered for the carrier of AAVrh10 and by the way of intracranial injection with difference of the present invention It is larger, therefore not compare.Mainly to the present invention using phase homologous serotype and administration mode is intravenous injection ScAAV9.U1a.hSGSH is compared.

ScAAV9.U1a.hSGSH vector gene group contains AAV2 terminal repeat, mouse small nuclear rna promoter U1a sequence Information is shown in that SEQ ID No14, hSGSH coded sequence sequence information is shown in SEQ ID No15 and from the more of bovine growth hormone gene Polyadenylation signal.Recombination AAV virus is packed and purified using three plasmid packaging systems.Briefly, AAV vector plasmid, auxiliary After the Rep and Cap protein expression plasmid (pAAV-R2C9) of plasmid (pHelper) and AAV are mixed according to the molar ratio of 1:1:1, adopt With calcium phosphate procedure transfected HEK 293, after transfecting 48h, harvest cell and culture supernatant, using cesium chloride step gradients from Heart method isolates and purifies recombination AAV virus.Packaging purifying obtains scAAV9.U1a.hSGSH.

The model mice (4-6 week old) totally 16 of SGSH homozygous mutation, stochastic averagina is divided into 4 groups.1st group of mouse is every Tail vein injection rAAV9-CA-SGSH, dosage are 5 × 10¹³GC/kg.Every tail vein injection scAAV9- of 2nd group of mouse CMR-SGSH, dosage are 5 × 10¹³GC/kg.Every tail vein injection scAAV9.U1a.hSGSH of 3rd group of mouse, dosage be 5 × 10¹³GC/kg.4th group of mouse is as negative control group, every 200 μ L PBS of injection.It is wild that 1 group of 4 C57BL/6J is separately added Mouse (4-6 week old) is as control.

Put to death whole mouse after injection 3 months, the brain tissue of every mouse of anatomical isolation, heart, liver, spleen, lung, kidney, Small intestine and musculature etc..The different tissues for the quality such as taking extract total protein of cell (Applygen using Protein Extraction Reagent kit Technologies Inc., P1250), then using Pierce BCA Protein Aaasy Kit (ThermoFisher, The U.S.) respectively measure total protein amount.The different tissues of all mouse take 30 μ g total proteins for measuring SGSH enzymatic activity. As a result as shown in figure 15, SGSH enzymatic activity of 3 treatment groups in multiple groups are knitted is above the model mice of negative control, by enzyme activity Property from high to low sequence be respectively as follows: injection scAAV9-CMR-SGSH model mice be higher than injection rAAV9-CA-SGSH model Mouse is higher than the model mice of injection scAAV9.U1a.hSGSH.

The model mice enzymatic activity numerical value and document report of the injection scAAV9.U1a.hSGSH measured there are larger difference, Analysis reason is that detection method and testing conditions difference cause.

8 AAV carrier different serotypes of embodiment test the internal availability influence of MPS genomic medicine

Compare the influence of the AAV carriers of different serotypes to the internal validity of MPS genomic medicine.SGSH homozygous mutation Model mice (4-6 week old) totally 28 is equally divided into 7 groups, and experimental group injects rAAV5-CA-SGSH, rAAV9- for totally 6 groups respectively CA-SGSH、rAAVrh10-CA-SGSH、rscAAV5-CMR-SGSH、rscAAV9-CMR-SGSH、rscAAVrh10-CMR- SGSH, dosage are 5 × 10¹³GC/kg.1 group of every 200 μ L PBS of injection of control group.It is wild that 1 group of 4 C57BL/6J is separately added Mouse (4-6 week old) is as control.

After injecting virus 3 months, whole mouse are put to death, separate the brain tissue of every mouse, heart, liver, spleen, lung, Kidney, small intestine and musculature etc..The different tissues for the quality such as taking extract total protein of cell using Protein Extraction Reagent kit (Applygen Technologies Inc., P1250) then uses Pierce BCA Protein Aaasy Kit (ThermoFisher, the U.S.) measures the amount of total protein respectively.The different tissues of all mouse take 30 μ g total proteins to be used for Measure SGSH enzymatic activity.As a result as shown in figure 16, SGSH enzymatic activity is extremely low in each histoorgan of the model mice of non-injecting virus, Each histoorgan SGSH enzymatic activity of model mice significantly increases after injecting virus.Inject each histaminase of different serotypes AAV carrier Expression activitiy, serotype is minimum when being AAV5, and substantially less than serotype is AAV9, slightly below AAV9. when serotype is AAVrh10

Bibliography

1. Hopwood J J, Morris C P. Molecular Biology & Medicine, 1990, 7(5):381.

2. Iozzo R V. Annual Review of Biochemistry, 1998, 67(1):609-652.

3. Jurecka A, Ługowska A, Golda A, et al. Journal of Applied Genetics, 2015, 56(2):205-210.

4. Gilkes J A, Heldermon C D. Pediatric Endocrinology Reviews Per, 2014, 12 Suppl 1:133-140.

5. Heron B, Mikaeloff Y, Froissart R, Caridade G, Maire I, Caillaud C, et al. Am J Med Genet A 2011;155A:58-68.

6. Buhrman D, Thakkar K, Poe M, Escolar ML. Inherit Metab Dis 2014;37: 431-7.

7. Shapiro, Elsa G., et al. J Pediatr 170(2016):278-287.

8. Rumsey RK, Rudser K, Delaney K, Potegal M, Whitley CB, Pediatr 2014; 164:1147-51

9. James R A, Singh‐Grewal D, Lee S, et al. Journal of Paediatrics & Child Health, 2016, 52(3):262-271.

10. Valstar MJ, Neijs S, Bruggenwirth HT, Olmer R, Ruijter GJ, Wevers RA, et al. Ann Neurol 2010;68:876-87

11. Zelei T, Csetneki K, Vokó Z, et al. Orphanet Journal of Rare Diseases, 2018, 13(1):53.

12.Cleary, M. A., and J. E. Wraith. Archives of Disease in Childhood 69.3 (1993):403-406.

13.Sivakumur, P., and J. E. Wraith. Journal of Inherited Metabolic Disease 22.7(1999):849-50.

14.Abbott, N. J., et al. Neurobiology of Disease 37.1(2010):13.

15.Scarpa, M., et al. Molecular Genetics & Metabolism (2017).

16.Tardieu, M., et al. Collaborative Congress of the European-Society- for-Gene- and-Cell-Therapy 2013:A23-A24.

17.Duncan, F. J., et al. Molecular Therapy the Journal of the American Society of Gene Therapy 23.4(2015):638-47.

18.Potegal M, Yund B, Rudser K, Ahmed A, Delaney K, Nestrasil I, et al. Clin Exp Neuropsychol 2013;35:608-16.

19:Sidhu, N. S., et al. Acta Crystallographica 70.5 (2014): 1321-1335.

20.Yogalingam G, Hopwood JJ. Hum Mutat 2001;18:264-81

21. the brave Chinese Journal of Pathophysiology 21.5 (2005) of Jiang Duyin, Fu little Bing, and Sheng Zhi: 1020-1025.

22. Atchison RW, et al. Science. 1965; 149: 754-756.

23. Hoggan MD, et al. Proc Natl Sci USA. 1966; 55: 1467-1474.

24. Rose JA, et al. Proc Natl Acad Sci USA. 1969; 64: 863-869.

25. Geoffroy MC, et al. Curr Gene Ther. 2005; 5(3): 265-271.

26. Chiorini JA, et al. Curr Top Microbiol Immunol. 1996; 218:25-33.

27. Atchison RW, et al. Science. 1965; 149: 754-756.

28. Lusby E, et al. J Virol. 1980; 34: 402-409.

29. Samulski RJ, et al. Proc Natl Acad Sci USA. 1982; 79: 2077-2081.

30. Laughlin CA, et al. Gene. 1983; 23: 65-73.

31. Xiao X, et al. J Virol. 1997; 71(2): 941-948.

32. Linden RM, et al. Proc Natl Acad Sci USA. 1996; 93(15): 7966-7972.

33. Ashktorab H, et al. J Virol. 1989; 63(7): 3034-3039.

34. Srivastava A, et al. J Virol. 1983; 45(2): 555-564.

35. Hüser D, et al. PLoS Pathog. 2010; 6(7): e1000985.

36. Wang Z, et al. Gene Ther. 2003;10(26):2105-2111.

37. McCarty DM, et al. Gene Ther. 2003;10(26):2112-2118.

38. Wu Z, et al. Mol Ther. 2006; 14(3): 316-327.

39. Samaranch L, et al. Hum Gene Ther. 2012; 23(4): 382-389.

40. Gruntman AM, et al. Hum Gene Ther Methods. 2015; 26(2): 71-76.

41. Yuan Z, et al. Hum Gene Ther, 2011,22(5):613-624.

42. Wu Zhijian, Wu little Bing etc..Science Bulletin, 1999,44 (5): 506-509.

43. Conway JE, et al. Gene Ther, 1999,6:986-993.

44. Wustner JT, et al. Mol Ther, 2002,6(4):510-518.

45. Booth MJ,et al. Gene Ther,2004,11:829-837.

46. Thomas DL, et al. Gene Ther,2009,20:861-870.

47. Chen H. Mol Ther.2008;16(5):924-930.

48. Galibert L,et al.J Invertebr Pathol, 2011,107 Suppl:S80-93.

49. Mietzsch M, et al. Hum Gene Ther. 2014;25:212-222.

50. Mietzsch M, et al. Hum Gene Ther. 2015;26(10):688-697.

51.Bryant LM, et al. Hum Gene Ther Clin Dev. 2013, 24(2): 55-64.

52. Ylä-Herttuala S. Mol Ther. 2012; 20(10): 1831-1832.

53. Kay MA, et al. Nat Genet. 2000; 24(3): 257-261.

54. Jacobson SG, et al. Arch Ophthalmol. 2012; 130(1): 9-24.

55. Salgenik M, et al. Microbiol Spectr. 2015; 3(4).

56. Chen ZY, et al. Mol Ther. 2001; 3(3): 403-410.

57. Wang Z, et al. Nat Biotechnol. 2005;23:321-328.

58. Bish LT, et al. Hum Gene Ther. 2008;19:1359-1368.

59. Zincarelli C, et al. Mol Ther. 2008;16:1073-1080.

60. Prasad KM, et al. Gene Ther. 2011;18:43-52.

61. Rebuffat A, et al. Hum Gene Ther.2010;21(4):463-477.

62. Zhou Q, et al. Sci Rep. 2017; doi: 10.1038/s41598-017-04054-4.

63. Karpova EA. et al. J Inherit Metab Dis. 1996; 19: 278-285

64. Chiorini JA, et al. J Virol. 1994, 68(2): 797-804.

65.Bishop BM, et al. FEBS Lett. 1996, 397(1): 97-100.

66.Duncan FJ, et al. Mol Ther. 2015; 23(4): 638-647.

67. Ch V D L, Versteeg E M, Veerkamp J H, et al. Analytical Biochemistry, 1994, 221(2):356.

68. Gemst J J V, Loeven M A, Graaf M J J D, et al. Plos One, 2016, 11 (11):e0167336.

Nucleotide and amino acid sequence table SEQ ID

No.1:CA promoter

5’-attgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggt ggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatct acgtattagtcatcgctattacccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccct ccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcg cgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagc ggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcggg cg-3’

No.2:SGSH cDNA sequence

5’-atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccgg aacgcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgc acctggacgccttggcccgccgcagcctcctctttcgcaatgccttcacctcggtcagcagctgctctcccagccg cgccagcctcctcactggcctgccccagcatcagaatgggatgtacgggctgcaccaggacgtgcaccacttcaac tccttcgacaaggtgcggagcctgccgctgctgctcagccaagctggtgtgcgcacaggcatcatcgggaagaagc acgtggggccggagaccgtgtacccgtttgactttgcgtacacggaggagaatggctccgtcctccaggtggggcg gaacatcactagaattaagctgctcgtccggaaattcctgcagactcaggatgaccggcctttcttcctctacgtc gccttccacgacccccaccgctgtgggcactcccagccccagtacggaaccttctgtgagaagtttggcaacggag agagcggcatgggtcgtatcccagactggaccccccaggcctacgacccactggacgtgctggtgccttacttcgt ccccaacaccccggcagcccgagccgacctggccgctcagtacaccaccgtaggccgcatggaccaaggagttgga ctggtgctccaggagctgcgtgacgccggtgtcctgaacgacacactggtgatcttcacgtccgacaacgggatcc ccttccccagcggcaggaccaacctgtactggccgggcactgctgaacccttactggtgtcatccccggagcaccc aaaacgctggggccaagtcagcgaggcctacgtgagcctcctagacctcacgcccaccatcttggattggttctcg atcccgtaccccagctacgccatctttggctcgaagaccatccacctcactggccggtccctcctgccggcgctgg aggccgagcccctctgggccaccgtctttggcagccagagccaccacgaggtcaccatgtcctaccccatgcgctc cgtgcagcaccggcacttccgcctcgtgcacaacctcaacttcaagatgccctttcccatcgaccaggacttctac gtctcacccaccttccaggacctcctgaaccgcactacagctggtcagcccacgggctggtacaaggacctccgtc attactactaccgggcgcgctgggagctctacgaccggagccgggacccccacgagacccagaacctggccaccga cccgcgctttgctcagcttctggagatgcttcgggaccagctggccaagtggcagtgggagacccacgacccctgg gtgtgcgcccccgacggcgtcctggaggagaagctctctccccagtgccagcccctccacaatgagctgtga-3’

NO.3ΔITR

5’-ccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggct ttgcccgggcggcctcagtgagcgagcgagcgcgcagagagggacagatccc-3’

NO.4:CMR promoter

5’-tctcgagcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccggactcacg gggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaa tgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctc gtttagtgaacCGCTcgaccggtgtgagtgagtgatttgatctaaatgcctttttgtaatcaagtgactgtgtgtg tgtgtatctgagtgcctgattcttttcatcacag-3’

NO.5:SV40polyA

5’-cagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgcttta tttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattg cattcattttatgtttcaggttcagggggaggtgtgggaggttttttag-3’

NO.6: CA-Q-F

5’-cccataaggtcatgtactgggcat-3’

NO.7: CA-Q-R

5’-gttcccatagtaacgccaataggg-3’

No.8:CMR-Q-F

5’-ttatatagacctcccaccgt-3’

No.9:CMR-Q-R

5’-taaatggcccgcctggctga-3’

NO.10: beta-Actin-F

5’- gtcatcactattggcaacga-3’

NO.11: beta-Actin-R

5’- cctaagagaagagtgacaga-3’

NO.12: hSGSH-F

5’- aagtcagcgaggcctacgt -3’

NO.13: hSGSH-R

5’-gatggtcttcgagccaaagat-3’

NO.14:U1a promoter

5’-cactatggaggcggtactatgtagatgagaattcaggagcaaactgggaaaagcaactgcttccaaata tttgtgatttttacagtgtagttttggaaaaactcttagcctaccaattcttctaagtgttttaaaatgtgggagc cagtacacatgaagttatagagtgttttaatgaggcttaaatatttaccgtaactatgaaatgctacgcatatcat gctgttcaggctccgtggccacgcaactc-3’

NO.15:hSGSH CDNA sequence

atgagctgccccgtgcccgcctgctgcgcgctgctgctagtcctggggctctgccgggcgcgtccccggaac gcactgctgctcctcgcggatgacggaggctttgagagtggcgcgtacaacaacagcgccatcgccaccccgcacc tggacgccttggcccgccgcagcctcctctttcgcaatgccttcacctcggtcagcagctgctctcccagccgcgc cagcctcctcactggcctgccccagcatcagaatgggatgtacgggctgcaccaggacgtgcaccacttcaactcc ttcgacaaggtgcggagcctgccgctgctgctcagccaagctggtgtgcgcacaggcatcatcgggaagaagcacg tggggccggagaccgtgtacccgtttgactttgcgtacacggaggagaatggctccgtcctccaggtggggcggaa catcactagaattaagctgctcgtccggaaattcctgcagactcaggatgaccggcctttcttcctctacgtcgcc ttccacgacccccaccgctgtgggcactcccagccccagtacggaaccttctgtgagaagtttggcaacggagaga gcggcatgggtcgtatcccagactggaccccccaggcctacgacccactggacgtgctggtgccttacttcgtccc caacaccccggcagcccgagccgacctggccgctcagtacaccaccgtcggccgcatggaccaaggagttggactg gtgctccaggagctgcgtgacgccggtgtcctgaacgacacactggtgatcttcacgtccgacaacgggatcccct tccccagcggcaggaccaacctgtactggccgggcactgctgaacccttactggtgtcatccccggagcacccaaa acgctggggccaagtcagcgaggcctacgtgagcctcctagacctcacgcccaccatcttggattggttctcgatc ccgtaccccagctacgccatctttggctcgaagaccatccacctcactggccggtccctcctgccggcgctggagg ccgagcccctctgggccaccgtctttggcagccagagccaccacgaggtcaccatgtcctaccccatgcgctccgt gcagcaccggcacttccgcctcgtgcacaacctcaacttcaagatgccctttcccatcgaccaggacttctacgtc tcacccaccttccaggacctcctgaaccgcaccacagctggtcagcccacgggctggtacaaggacctccgtcatt actactaccgggcgcgctgggagctctacgaccggagccgggacccccacgagacccagaacctggccaccgaccc gcgctttgctcagcttctggagatgcttcgggaccagctggccaagtggcagtgggagacccacgacccctgggtg tgcgcccccgacggcgtcctggaggagaagctctctccccagtgccagcccctccacaatgagctgtga

Claims

1. people heparan-N- Sulfatase Gene (SGSH) expression cassette that people is design, which is characterized in that

(I) promoter sequence comprising artificially designing；And/or

(II)-the N- of heparan containing someone Sulfatase Gene coded sequence.

2. artificial design promoter sequence as described in claim 1, specially SEQ ID NO.1 and SEQ ID NO.5.

3. people's heparan-N- Sulfatase Gene coded sequence as described in claim 1, sequence information are shown in SEQ ID NO.2。

4. a kind of recombined glandulae correlation viral vectors, it is characterised in that carry gene expression frame as described in claim 1 or right It is required that 2,3 require the combination of sequence.

5. recombined glandulae correlation viral vectors as claimed in claim 5, which is characterized in that recombined glandulae correlation viral vectors serotype Including AAV1, AAV2, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh10, wherein preferred serotype is AAV5, AAV9 and AAVrh10.

6. recombined glandulae correlation viral vectors as claimed in claim 5, which is characterized in that the gene of recombined glandulae correlation viral vectors Group includes two kinds of forms of single stranded DNA and self-complementary double-stranded DNA, preferably the recombination gland phase of self-complementary double-stranded DNA gene group Close viral vectors.

7. a kind of genomic medicine, which is characterized in that including gene expression frame described in claim 1 or the requirement of claim 2,3 Recombined glandulae correlation viral vectors described in the combination and claim 4,5,6 of sequence.

8. genomic medicine as claimed in claim 7, which is characterized in that administration mode includes but is not limited to be injected intravenously administration.

9. genomic medicine according to any one of claims 8, which is characterized in that the sustainable expression of single administration generates people's heparan-N- Sulfatase is effectively relieved or is cured because people's heparan-N- Sulfatase Gene (SGSH) is mutated bring ill symptoms.