CN109748957A - The application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering - Google Patents
The application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering Download PDFInfo
- Publication number
- CN109748957A CN109748957A CN201711079375.1A CN201711079375A CN109748957A CN 109748957 A CN109748957 A CN 109748957A CN 201711079375 A CN201711079375 A CN 201711079375A CN 109748957 A CN109748957 A CN 109748957A
- Authority
- CN
- China
- Prior art keywords
- nttctp
- plant
- sequence
- gene
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering.NtTCTP albumen provided by the invention is following (a1) or (a2): the protein that (a1) amino acid sequence shown in sequence 1 in sequence table forms；(a2) by amino acid sequence shown in sequence 1 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues and the protein as derived from sequence 1 relevant to plant stress tolerance.The gene (NtTCTP gene) for encoding the NtTCTP albumen also belongs to protection scope of the present invention.After NtTCTP gene silencing, the increased genetically modified plants of drought-enduring and/or salt tolerance can be obtained.The present invention is significant in cultivating stable crop yield.
Description
Technical field
The present invention relates to be related to field of biotechnology, and in particular to a kind of tobacco NtTCTP albumen and its encoding gene are being planted
Object is drought-enduring, the application in resistant gene of salt engineering.
Background technique
The variation of physical chemical factor in environment, for example, it is arid, saline and alkaline, damage to plants caused by sudden drop in temperature, freeze injury, Stress Factors and the life such as waterlogging
Object factor such as pest and disease damage has great influence to the growth and development of plant, will cause the crops extensive underproduction when serious, trains
Educating resistance of reverse crop is one of main target of planting industry.The resistance of reverse for improving crop, in addition to utilizing traditional breeding method, mesh
Before, molecular genetic breeding has become scientific worker one of field of interest.Under abiotic and biotic stress stress,
Extracellular signal is become intracellular there are many variation of physico-chemical parameter in approach impression and response external environment by higher plant cell
Signal passes the signal along to nucleus by a series of reaction of phosphorylation cascades, regulates and controls relevant functional gene through transcription factor,
The expression for starting induced gene in adversity, improves the resistance of reverse of plant.
Summary of the invention
The object of the present invention is to provide a kind of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt work
Application in journey.
Protein provided by the invention is obtained from tobacco, is named as NtTCTP albumen, is following (a1) or (a2):
(a1) protein that the amino acid sequence shown in sequence 1 in sequence table forms；
(a2) by amino acid sequence shown in sequence 1 in sequence table by one or several amino acid residues substitution and/
Or deletion and/or addition and the protein as derived from sequence 1 relevant to plant stress tolerance.
The resistance of reverse concretely salt tolerance and/or drought tolerance.
In order to make NtTCTP albumen in (a1) convenient for purifying and detection, can in as sequence table amino shown in sequence 1
The amino terminal or carboxyl terminal of the protein of acid sequence composition connect upper label as shown in Table 1.
The sequence of 1 label of table
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
NtTCTP albumen in above-mentioned (a2) can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression
It obtains.The encoding gene of NtTCTP albumen in above-mentioned (a2) can be by will lack in DNA sequence dna shown in sequence 2 in sequence table
The codon of one or several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 '
The coded sequence that end and/or 3 ' ends connect label shown in table 1 obtains.
The gene (NtTCTP gene) for encoding the NtTCTP albumen also belongs to protection scope of the present invention.
The NtTCTP gene is any DNA molecular in following (b1)-(b3):
(b1) code area DNA molecular as shown in sequence 2 in sequence table；
(b2) hybridize under strict conditions with (b1) DNA sequence dna limited and encode and plant stress tolerance correlative protein
DNA molecular；
(b3) there is 90% or more homology to the DNA sequence dna that (b1) or (b2) is limited and coding is related with plant stress tolerance
The DNA molecular of albumen.
The resistance of reverse concretely salt tolerance and/or drought tolerance.
Above-mentioned stringent condition can be for 0.1 × SSPE (or 0.1 × SSC), the solution of 0.1%SDS be miscellaneous in DNA or RNA
It hands over and hybridizes at 65 DEG C in experiment and wash film.
Recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing the NtTCTP gene also belong to this
The protection scope of invention.
The recombinant expression carrier of NtTCTP gene can be contained with existing plant expression vector construction.The plant expression carries
Body includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.It is carried using the gene constructed recombinant expression of NtTCTP
It, can be before its transcription initiation nucleotide plus any enhanced, composing type, organizing specific type or induction type starting when body
Son, they can be used alone or are used in combination with other plant promoters；In addition, using the gene constructed recombinant expression of NtTCTP
When carrier, enhancer, including translational enhancer or transcriptional enhancer also can be used, these enhancer regions can be ATG starting
Codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, to guarantee entire sequence just
Really translation.The source of the translation control signal and initiation codon be it is extensive, can be natural, be also possible to synthesize
's.Translation initiation region can come from transcription initiation region or structural gene.For the ease of to transgenic plant cells or plant
It is identified and is screened, plant expression vector used can be processed, the expression in plant, which is such as added, can produce color change
Enzyme or gene, resistant antibiotic marker or the anti-chemical reagent marker gene of luminophor etc..From turning base
Because of the security consideration of plant, it can also be added without any screening-gene, directly screened by environment stress.
The present invention also protects the application of NtTCTP albumen or NtTCTP gene in regulation plant stress tolerance.The resistance of reverse
For salt tolerance and/or drought tolerance.
The present invention also protects the application of NtTCTP albumen or NtTCTP gene in plant breeding.
The plant breeding is the plant high for breeding resistance of reverse.The resistance of reverse is salt tolerance and/or drought tolerance.
The present invention also protects a kind of method for cultivating genetically modified plants, includes the following steps: to inhibit in purpose plant
The expression of NtTCTP gene obtains the genetically modified plants of resistance of reverse raising.The resistance of reverse is salt tolerance and/or drought tolerance.
In the method, " expression for inhibiting NtTCTP gene in purpose plant " is realized by interference carrier.
The interference carrier can pass through Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity
It leads, the conventional biology methods such as mediated by agriculture bacillus are transformed into purpose plant.
The interference carrier is concretely containing the recombinant expression carrier of interference fragment.
The interference fragment includes section first and section second.The section first and the section second are reverse complementary sequence.
The sequence of the section first is as shown in the sequence 3 of sequence table.
The interference carrier concretely replaces the small fragment between Sac I and Kpn the I restriction enzyme site of carrier pZH01
For DNA molecular shown in sequence 3 in sequence table, and will be small between Xba I and Sal the I restriction enzyme site of carrier pZH01
Segment replaces the recombinant expression carrier obtained for DNA molecular shown in sequence 4 in sequence table.
The present invention also protects a kind of method for improving plant stress tolerance, includes the following steps: to reduce in purpose plant
The activity and/or expression quantity of NtTCTP albumen obtain the genetically modified plants of resistance of reverse raising.The resistance of reverse be salt tolerance and/
Or drought tolerance.
Any description above purpose plant concretely monocotyledon or dicotyledon.The dicotyledon can be
Eggplant mesh plant.The eggplant mesh plant can be plant of Solanaceae.The plant of Solanaceae can be dama de noche race plant.The dama de noche race plants
Object can be Nicotiana plant.The concretely tobacco, such as tobacco (Nicotiana of plant described in the Nicotiana plant
tabacum var.Xanthi)。
The present invention also protects application of any description above method in plant breeding.
The plant breeding is the plant high for breeding resistance of reverse.The resistance of reverse is salt tolerance and/or drought tolerance.
The present invention also protects a kind of method for reducing plant stress tolerance, includes the following steps: to lead the NtTCTP gene
Enter in purpose plant, or, improving the activity and/or expression quantity of NtTCTP albumen in purpose plant, obtains the plant of resistance of reverse reduction
Object.The resistance of reverse is salt tolerance and/or drought tolerance.
In the method, the NtTCTP gene can import purpose by the recombinant expression carrier containing NtTCTP gene
Plant.The recombinant expression carrier can pass through Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity
Lead, the conventional biology methods such as mediated by agriculture bacillus are transformed into plant cell or tissue in.The recombinant expression carrier is concretely
The sequence 2 of sequence table will be inserted between the multiple cloning sites of carrier pROK II holds DNA shown in 1-504 nucleotide points from 5 '
The recombinant plasmid that son obtains.The recombinant expression carrier concretely by the BamH I of carrier pROK II and I restriction enzyme site of Kpn it
Between small fragment be substituted by sequence table sequence 2 the obtained recombination matter of DNA molecular shown in the 5 ' 1-504 nucleotide in end
Grain.
The present invention also protects a kind of specific DNA molecular, including section first and section second.The section first and the section second
For reverse complementary sequence.The sequence of the section first is as shown in the sequence 3 of sequence table.
The present invention also protects a kind of interference carrier, is to obtain specific DNA molecular importing expression vector.
The interference carrier concretely replaces the small fragment between Sac I and Kpn the I restriction enzyme site of carrier pZH01
For DNA molecular shown in sequence 3 in sequence table, and will be small between Xba I and Sal the I restriction enzyme site of carrier pZH01
Segment replaces the recombinant expression carrier obtained for DNA molecular shown in sequence 4 in sequence table.
The present invention also protects the application of the specific DNA molecular or the interference carrier in plant breeding.
The plant breeding is the plant high for breeding resistance of reverse.The resistance of reverse is salt tolerance and/or drought tolerance.
Any description above plant concretely monocotyledon or dicotyledon.The dicotyledon can be eggplant mesh
Plant.The eggplant mesh plant can be plant of Solanaceae.The plant of Solanaceae can be dama de noche race plant.Dama de noche race plant can
For Nicotiana plant.The concretely tobacco, such as tobacco (Nicotiana tabacum of plant described in the Nicotiana plant
var.Xanthi)。
Present invention finds a kind of albumen, derive from tobacco (Nicotiana tabacum var.Xanthi), entitled
The increased genetically modified plants of drought-enduring and/or salt tolerance can be obtained after its encoding gene silencing in NtTCTP, and cultivating, crop is steady
It is significant in production.
Detailed description of the invention
Fig. 1 is the schematic diagram of NtTCTP Overexpression vector (A) and RNAi carrier (B).
Fig. 2 is the Molecular Identification of NtTCTP overexpression and RNAi plant.
Fig. 3 is the phenotypic analysis under NtTCTP transgenic plant and the with high salt or drought stress of control.
Fig. 4 is NtTCTP overexpression, RNAi plant and restores 40 days survival rate systems to the processing of with high salt or drought stress is impinged upon
Meter.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
Carrier pZH01 is documented in Han Xiao, et al.Functional analysis of the rice AP3
homologue OsMADS16by RNA interference,Plant Molecular Biology,2003,52,957-
966, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research.
Tobacco (Nicotiana tabacum var.Xanthi) is documented in Hong SH, Kim KI, Chung HY, Kim
YJ,Sunter G,Bisaro DM,Chung IS,Expression of recombinant endostated leaf
disks of Nicotiana tabacum var.Xanthi,Biotechnology Letters,2004,26(18),1433-
1439, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research.
Carrier pROKII (binary expression vector) is documented in D.C.Baulcombe, G.R.Saunders, M.W.Bevan,
M.A.Mayo and B.D.Harrison,Expression of biologically active viral satellite
RNA from the nuclear genome of transformed plants.Nature 321(1986),pp.446–449
In, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research.
The acquisition of embodiment 1, NtTCTP albumen and its encoding gene
Sequence analysis, section interception and functional verification are carried out to each kind tobacco gene group, from tobacco (Nicotiana
Tabacum var.Xanthi) in find a kind of protein, NtTCTP albumen is named as, as shown in the sequence 1 of sequence table.
The unnamed gene NtTCTP gene of NtTCTP albumen will be encoded, as shown in the sequence 2 of sequence table.
The function of embodiment 2, NtTCTP albumen and its encoding gene
One, the building of II-NtTCTP of over-express vector pROK is recombinated
1, tobacco (Nicotiana tabacum var.Xanthi) blade RNA is extracted, reverse transcription obtains cDNA.
2, the cDNA obtained using step 1 carries out PCR expansion as primer using NtTCTP-F1 and NtTCTP-R1 as template
Increase, obtained PCR product.
NtTCTP-F1:CAGGATCCATGTTGGTTTATCAGGATCTTCTC；
NtTCTP-R1:ACGGGTACCACACTTGACCTCCTTGAGTCC。
In NtTCTP-F1 and NtTCTP-R1, underscore marks I restriction enzyme site of BamH I and Kpn respectively.
3, with the pcr amplification product of I double digestion step 2 of restriction enzyme BamH I and Kpn, digestion products are recycled.
4, with I double digestion carrier pROK II of restriction enzyme BamH I and Kpn, the carrier framework of about 12900bp is recycled.
5, the digestion products of step 3 are connected with the carrier framework of step 4, obtains recombination over-express vector pROK II-
NtTCTP.According to sequencing result, structure is carried out to recombination II-NtTCTP of over-express vector pROK and is described as follows: by carrier pROK
Small fragment between II I restriction enzyme site of BamH I and Kpn replace in order in sequence table sequence 2 from the nucleosides of 5 ' end 1-504
DNA molecular shown in acid.It is as shown in Figure 1A to recombinate II part-NtTCTP original part schematic diagram of over-express vector pROK.
Two, the acquisition of recombinant RNA i interference vector pZH01-NtTCTP-RNAi
1, tobacco (Nicotiana tabacum var.Xanthi) blade RNA is extracted, reverse transcription obtains cDNA.
2, the cDNA obtained using step 1 carries out PCR using the primer pair that NtTCTP-RF and NtTCTP-RR is formed as template
Pcr amplification product is recycled in amplification.
NtTCTP-RF:TGCTCTAGAGAGCTCCGGATTCATTTCCCTACACTG；
NtTCTP-RR:ACGCGTCGACGGTACCACACTTGACCTCCTTGAGTCC。
In NtTCTP-RF and NtTCTP-RR, underscore marks Xba I restriction enzyme site of I Sac I and I Kpn of Sal respectively.
3, with the pcr amplification product of restriction enzyme Sac I and Kpn I double digestion step 1, digestion products are recycled.
4, with restriction enzyme Sac I and Kpn I double digestion carrier pZH01, the carrier framework of about 11900bp is recycled.
5, the digestion products of step 3 are connected with the carrier framework of step 4, obtains recombinant vector pZH01-RNAi-1.Root
According to sequencing result, structure is carried out to recombinant vector pZH01-RNAi-1 and is described as follows: by Sac I and Kpn the I enzyme of carrier pZH01
Small fragment between enzyme site replaces for DNA molecular shown in sequence 3 in sequence table.
6, with the pcr amplification product of restriction enzyme Xba I and Sal I double digestion step 1, digestion products are recycled.
7, the recombinant vector pZH01-RNAi-1 obtained with restriction enzyme Xba I and Sal I double digestion step 5 is returned
Receive the carrier framework of about 12400bp.
8, the digestion products of step 6 are connected with the carrier framework of step 7, obtains recombinant RNA i interference vector pZH01-
NtTCTP-RNAi.According to sequencing result, structure is carried out to recombination RNAi interference vector pZH01-NtTCTP-RNAi and is described as follows:
Small fragment between Xba I and Sal the I restriction enzyme site of Vectors Recombinant vectors pZH01-RNAi-1 is replaced in order in sequence table
DNA molecular shown in sequence 4.The part recombinant RNA i interference vector pZH01-NtTCTP-RNAi original part schematic diagram is as shown in Figure 1B.
Three, overexpression turns NtTCTP tobacco and RNA interference turns the acquisition and identification of NtTCTP tobacco
1, the II-NtTCTP of recombination over-express vector pROK that step 1 obtains is transferred to tobacco through leaf disc method
In (Nicotiana tabacum var.Xanthi), 22 plants of T are obtained0Generation, which is overexpressed, turns NtTCTP tobacco.
2, the T of step 1 is taken0In generation, is overexpressed the blade for turning NtTCTP tobacco, extracts total serum IgE and reverse transcription is cDNA, with
CDNA is template, and the method for using qRT-PCR detects the expression of NtTCTP gene (using Tubllin gene as internal reference base
Cause), using the expression of the primer QRT-NtTCTPF1 and primer QRT-NtTCTPR1 primer pair detection NtTCTP gene formed, adopt
With the expression of the primer QRT-NttubA1F1 and primer QRT-NttubA1R1 primer pair detection Tubllin gene formed.Setting
Using tobacco (Nicotiana tabacum var.Xanthi) cDNA as the control of template.
QRT-NtTCTPF1:5'-CAGGGAGCTGTTGATGTGAACAT-3'；
QRT-NtTCTPR1:5'-TGCTCCTGAAGCCTGAAAGTGT-3'；
QRT-NttubA1F1:5'-ACGTGCTTTCGTGCACTGGTAT-3'；
QRT-NttubA1R1:5’-GCACCAACTTCCTCGTAATCCT-3’。
3, the recombinant RNA i interference vector pZH01-NtTCTP-RNAi that step 2 obtains is transferred to tobacco through leaf disc method
In (Nicotiana tabacum var.Xanthi), 25 plants of T are obtained0Turn NtTCTP tobacco for RNA interference.
4, the T of step 3 is taken0The blade for turning NtTCTP tobacco for RNA interference, extracts total serum IgE and reverse transcription is cDNA, with
CDNA is template, and the method for using qRT-PCR detects the expression of NtTCTP gene (using Tubllin gene as internal reference base
Cause), using the expression of the primer QRT-NtTCTPF1 and primer QRT-NtTCTPR1 primer pair detection NtTCTP gene formed, adopt
With the expression of the primer QRT-NttubA1F1 and primer QRT-NttubA1R1 primer pair detection Tubllin gene formed.Setting
Using tobacco (Nicotiana tabacum var.Xanthi) cDNA as the control of template.
QRT-NtTCTPF1:5'-CAGGGAGCTGTTGATGTGAACAT-3'；
QRT-NtTCTPR1:5'-TGCTCCTGAAGCCTGAAAGTGT-3'；
QRT-NttubA1F1:5'-ACGTGCTTTCGTGCACTGGTAT-3'；
QRT-NttubA1R1:5’-GCACCAACTTCCTCGTAATCCT-3’。
Partial results are as shown in Figure 2.Through detecting 22 plants of T0Generation, which is overexpressed, to be turned to have in NtTCTP tobacco in 19 strains
NtTCTP expression quantity is significantly higher than control, and 25 plants of T0Interfering in strain for RNA has 18 strain NtTCTP expression quantity significantly low
In control.It chooses NtTCTP and is overexpressed in strain OE-02 and OE-07 and RNA interference strain and almost fail to detect NtTCTP table
The Ri-16 and Ri-20 reached does further Function Identification.By T0It is selfed for tobacco, the pure lines of above-mentioned strain is obtained by 4 generations.
Four, turn the acquisition of empty carrier tobacco
1, it is transferred in tobacco (Nicotiana tabacum var.Xanthi), is obtained through leaf disc method using carrier pROK II
It must turn empty carrier tobacco (being overexpressed control).
2, it is transferred in tobacco (Nicotiana tabacum var.Xanthi), is obtained through leaf disc method using carrier pZH01
It must turn empty carrier tobacco (RNA interference control).
Five, phenotypic analysis
Plant to be measured: tobacco (Nicotiana tabacum var.Xanthi, control), T4Generation, which is overexpressed, turns NtTCTP cigarette
Grass (OE-02 and OE-07), T4Turn NtTCTP tobacco (Ri-16 and Ri-20) for RNA interference, turn empty carrier tobacco (overexpression pair
According to) and turn empty carrier tobacco (RNA interference control).
1, plant seed to be measured is inoculated in MS solid medium, 22 DEG C of cultures (16h illumination/8h is dark), about 8 days
Afterwards, cotyledon is grown.
2, the cotyledon for obtaining step 1 is transferred to the MS solid medium of NaCl containing 250mM or 600mM mannitol (Man)
In, plant strain growth is very slow at this time, and all plant have growing point to bleach, and moves in vermiculite all plant after 30 days, pours
Water makes its restoration ecosystem, observes phenotype and counts survival rate.
Each group plant is as shown in Figure 3 in 23 days or 40 days Phenotypic Observation results of restoration ecosystem.The result shows that no matter
250mM NaCl stress or 600mM mannitol stress are restored 23 days or 40 days after Stress treatment, compared with the control, cross table
It is obvious sensitive up to plant, and the patience of RNAi plant increases.
Each group plant sees Fig. 4 in restoration ecosystem 40 days survival rate statistical results.The result shows that being handled through 250mM NaCl
The survival rate of the control, OE-02, OE-07, Ri-16 and Ri-20 that restore afterwards is respectively 48 ± 7,30 ± 12,32 ± 10,57 ± 8
With 65 ± 10%, two NtTCTP, which are overexpressed survival rate of the strains after high-salt stress and are substantially less than, to be compareed, and NtTCTP RNA
Survival rate of (RNAi) strain after high-salt stress is interfered to be significantly higher than control.The control that restores after 600mM treatment with mannitol,
The survival rate of OE-02, OE-07, Ri-16 and Ri-20 are respectively 57 ± 7,38 ± 9,35 ± 10,83 ± 11 and 87 ± 9%, and two
It is extremely significant lower than control that NtTCTP is overexpressed survival rate of the strain after the drought stress that mannitol is simulated, and NtTCTP RNA is dry
It is extremely significant higher than control to relate to survival rate of (RNAi) strain after mannitol stress.Turn empty carrier tobacco (being overexpressed control) and turns
The statistical result of empty carrier tobacco (RNA interference control) with compare that there was no significant difference.
Above-mentioned experiment shows that the encoding gene NtTCTP's of content reduction namely NtTCTP of the NtTCTP in plant is heavy
Silent drought-enduring/the salt tolerance for improving transgenic plant.Drought-enduring/salt tolerant of this result for raising plant, especially plant of Solanaceae
Property has larger value.
<110>Inst. of Genetics and Development Biology, CAS
<120>application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering
<160> 4
<210> 1
<211> 168
<212> PRT
<213>tobacco (Nicotiana tabacum var. Xanthi)
<400> 1
Met Leu Val Tyr Gln Asp Leu Leu Ser Gly Asp Glu Leu Leu Ser Asp
1 5 10 15
Ser Phe Pro Tyr Thr Glu Leu Glu Asn Gly Val Leu Trp Glu Val Gln
20 25 30
Gly Lys Trp Val Val Gln Gly Ala Val Asp Val Asn Ile Gly Ala Asn
35 40 45
Pro Ser Ala Glu Gly Ala Asp Glu Asp Glu Gly Val Asp Asp Gln Ala
50 55 60
Ile Lys Val Val Asp Ile Val Asp Thr Phe Arg Leu Gln Glu Gln Pro
65 70 75 80
Ser Phe Asp Lys Lys Gln Phe Val Ala Tyr Met Lys Lys Tyr Ile Lys
85 90 95
Ser Leu Thr Pro Lys Leu Gly Ala Glu Gln Glu Glu Val Phe Lys Asn
100 105 110
Asn Ile Gln Gly Ala Thr Lys Tyr Leu Leu Ser Lys Leu Ser Asp Leu
115 120 125
Gln Phe Phe Val Gly Glu Ser Met Ala Asp Asp Thr Gly Met Val Phe
130 135 140
Ala Tyr Tyr Lys Asp Gly Ala Thr Asp Pro Thr Phe Leu Tyr Leu Ala
145 150 155 160
His Gly Leu Lys Glu Val Lys Cys
165
<210> 2
<211> 507
<212> DNA
<213>tobacco (Nicotiana tabacum var. Xanthi)
<400> 2
atgttggttt atcaggatct tctctccggg gatgagctcc tttcggattc atttccctac 60
actgaacttg agaatggagt gctttgggaa gtacaaggga agtgggttgt tcagggagct 120
gttgatgtga acatcggggc gaatccatct gctgaaggtg cagatgaaga cgaaggtgtt 180
gatgatcaag ccatcaaggt tgttgatatt gttgacactt tcaggcttca ggagcagcct 240
tcttttgaca agaagcagtt tgttgcctac atgaagaaat atatcaagag ccttacaccc 300
aagttaggcg cagagcagga agaagttttt aagaacaaca ttcaaggagc aaccaagtac 360
cttttgtcaa agctcagtga ccttcaattc tttgttggtg agagcatggc tgatgatact 420
ggaatggtgt ttgcctacta caaggatggc gccactgatc cgaccttttt gtaccttgca 480
catggactca aggaggtcaa gtgttaa 507
<210> 3
<211> 461
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
cggattcatt tccctacact gaacttgaga atggagtgct ttgggaagta caagggaagt 60
gggttgttca gggagctgtt gatgtgaaca tcggggcgaa tccatctgct gaaggtgcag 120
atgaagacga aggtgttgat gatcaagcca tcaaggttgt tgatattgtt gacactttca 180
ggcttcagga gcagccttct tttgacaaga agcagtttgt tgcctacatg aagaaatata 240
tcaagagcct tacacccaag ttaggcgcag agcaggaaga agtttttaag aacaacattc 300
aaggagcaac caagtacctt ttgtcaaagc tcagtgacct tcaattcttt gttggtgaga 360
gcatggctga tgatactgga atggtgtttg cctactacaa ggatggcgcc actgatccga 420
cctttttgta ccttgcacat ggactcaagg aggtcaagtg t 461
<210> 4
<211> 461
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
acacttgacc tccttgagtc catgtgcaag gtacaaaaag gtcggatcag tggcgccatc 60
cttgtagtag gcaaacacca ttccagtatc atcagccatg ctctcaccaa caaagaattg 120
aaggtcactg agctttgaca aaaggtactt ggttgctcct tgaatgttgt tcttaaaaac 180
ttcttcctgc tctgcgccta acttgggtgt aaggctcttg atatatttct tcatgtaggc 240
aacaaactgc ttcttgtcaa aagaaggctg ctcctgaagc ctgaaagtgt caacaatatc 300
aacaaccttg atggcttgat catcaacacc ttcgtcttca tctgcacctt cagcagatgg 360
attcgccccg atgttcacat caacagctcc ctgaacaacc cacttccctt gtacttccca 420
aagcactcca ttctcaagtt cagtgtaggg aaatgaatcc g 461
Claims (10)
1. a kind of protein is following (a1) or (a2):
(a1) protein that the amino acid sequence shown in sequence 1 in sequence table forms；
(a2) amino acid sequence shown in sequence 1 in sequence table by the substitution of one or several amino acid residues and/or is lacked
Mistake and/or addition and the protein as derived from sequence 1 relevant to plant stress tolerance.
2. encoding the gene of protein described in claim 1.
3. recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing gene described in claim 2.
4. protein described in claim 1, or, gene described in claim 2, the application in regulation plant stress tolerance.
5. a kind of method for cultivating genetically modified plants includes the following steps: to inhibit gene described in claim 2 in purpose plant
Expression obtains the genetically modified plants of resistance of reverse raising.
6. a kind of method for improving plant stress tolerance includes the following steps: to reduce protein described in claim 1 in purpose plant
Activity and/or expression quantity, obtain resistance of reverse raising plant.
7. a kind of method for reducing plant stress tolerance, includes the following steps: channel genes purpose plant described in claim 2
In, or, improving the activity and/or expression quantity of protein described in claim 1 in purpose plant, obtain the plant of resistance of reverse reduction
Object.
8. a kind of specific DNA molecular, including section first and section second；The section first and the section second are reverse complemental sequence
Column；The sequence of the section first is as shown in sequence 3 in sequence table.
9. a kind of interference carrier is the recombinant expression carrier containing specific DNA molecular described in claim 8.
10. protein described in claim 1, or, gene described in claim 2, or, method described in claim 5 or 6, or,
Specific DNA molecular according to any one of claims 8, or, application of the interference carrier as claimed in claim 9 in plant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711079375.1A CN109748957A (en) | 2017-11-06 | 2017-11-06 | The application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711079375.1A CN109748957A (en) | 2017-11-06 | 2017-11-06 | The application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109748957A true CN109748957A (en) | 2019-05-14 |
Family
ID=66400878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711079375.1A Pending CN109748957A (en) | 2017-11-06 | 2017-11-06 | The application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109748957A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115724929A (en) * | 2022-08-16 | 2023-03-03 | 华中农业大学 | Eukaryotic expression and purification method of ginseng TCTP protein |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20020023471A (en) * | 2000-09-22 | 2002-03-29 | 박찬구 | Transgenic Plants and Plant Cells with Improved Growth Rate and Related Methods |
| CN105586346A (en) * | 2015-12-01 | 2016-05-18 | 贵州省烟草科学研究院 | Tobacco gene NtTCTP and application thereof |
-
2017
- 2017-11-06 CN CN201711079375.1A patent/CN109748957A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20020023471A (en) * | 2000-09-22 | 2002-03-29 | 박찬구 | Transgenic Plants and Plant Cells with Improved Growth Rate and Related Methods |
| US20020104127A1 (en) * | 2000-09-22 | 2002-08-01 | Jeong-Gu Kang | Transgenic plants and plant cells with improved growth rate and related methods |
| CN105586346A (en) * | 2015-12-01 | 2016-05-18 | 贵州省烟草科学研究院 | Tobacco gene NtTCTP and application thereof |
| WO2017092538A1 (en) * | 2015-12-01 | 2017-06-08 | 贵州省烟草科学研究院 | Use of tobacco gene nttctp in plants against potato virus y |
Non-Patent Citations (5)
| Title |
|---|
| GENEBANK: ""Accession No.: XM_019398888，Nicotiana attenuata translationally-controlled tumor protein homolog (LOC109233117), mRNA）"", 《GENEBANK》 * |
| GENEBANK: ""Accession No.:XP_019254433,translationally-controlled tumor protein [Nicotiana attenuata]"", 《GENEBANK》 * |
| JIAN-JUN TAO: "Tobacco Translationally Controlled Tumor Protein Interacts with Ethylene Receptor Tobacco Histidine Kinase1 and Enhances Plant Growth through Promotion of Cell Proliferation", 《PLANT PHYSIOLOGY》 * |
| 于延文等: "乙烯与植物抗逆性", 《中国农业科技导报》 * |
| 王得元: "《蔬菜生物技术概论》", 31 January 2002, 中国农业出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115724929A (en) * | 2022-08-16 | 2023-03-03 | 华中农业大学 | Eukaryotic expression and purification method of ginseng TCTP protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101775381B (en) | Plant stress tolerance correlative protein kinase, encoding gene and application thereof | |
| CN101182353B (en) | Rice stress-tolerance related receptor protein OsSIK1 as well as coding gene and application thereof | |
| CN101775070B (en) | Plant stress tolerance correlative protein, encoding gene and application thereof | |
| CN102532287B (en) | Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof | |
| CN108948170A (en) | A kind of plant plant type growth and development GAP-associated protein GAP and its encoding gene and application | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN115612695A (en) | Application of GhGPX5 and GhGPX13 genes in improving salt stress tolerance of plants | |
| CN110713994B (en) | Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof | |
| CN112724213B (en) | Sweet potato anthocyanin synthesis and stress resistance related protein IbMYB4, and coding gene and application thereof | |
| CN107326035B (en) | Deubiquitinating enzyme gene UBP5 for regulating rice grain shape and leaf color and application thereof | |
| CN106432449B (en) | Drought tolerance in plants GAP-associated protein GAP VPS23A and its encoding gene and application | |
| CN104480120A (en) | Plant salt-tolerant related gene PpSIG2 as well as encoding protein and application thereof | |
| CN109748957A (en) | The application of tobacco NtTCTP albumen and its encoding gene in drought tolerance in plants, resistant gene of salt engineering | |
| CN114560919B (en) | Plant drought tolerance related transcription factor VcMYB and coding gene and application thereof | |
| CN114716522B (en) | Application of KIN10 protein and related biological materials thereof in saline-alkali tolerance of plants | |
| CN112813079B (en) | Danbo black soybean GmFER84 gene and application thereof in soybean aluminum stress improvement | |
| CN107987139A (en) | A kind of Dof transcription factors and its application in terms of plant salt tolerance is improved | |
| CN104164450B (en) | Use of ubiquitin acceptor protein OsDSK2b in improvement of stress tolerance of plants | |
| CN108690127A (en) | Resistance relevant protein TaMYB85 and its encoding gene and application | |
| CN101993479B (en) | Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof | |
| CN105924511B (en) | A kind of Leaf shape, plant type GAP-associated protein GAP GhBRH1-L and its encoding gene and application | |
| CN107176983B (en) | Application of protein PpLEA3-3 in regulation and control of plant stress resistance | |
| CN109355270A (en) | A kind of rice kinases OSK1 and its application | |
| CN110358774A (en) | Control gene, protein, expression casette, expression vector, host cell, method and the application of Rice Flowering time | |
| CN111205355B (en) | Plant stress tolerance related protein SiWRKY76 and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190514 |
|
| WD01 | Invention patent application deemed withdrawn after publication |