CN109738648B - Engineering cell strain for stably and efficiently expressing hepatitis C virus core antigen antibody and application thereof - Google Patents

Abstract

The invention discloses a pair of engineering cell strains for stably and efficiently expressing hepatitis C virus core antigen antibodies, wherein one of the engineering cell strains is a Chinese hamster ovary cell strain CHO/3A2 capable of generating an antibody 3A2, and the other engineering cell strain is a Chinese hamster ovary cell strain CHO/5H7 capable of generating an antibody 5H7, the cell strains are preserved in a Chinese typical culture collection in 12 months and 12 days in 2018, and the preservation numbers are CCTCC NO. C2018188 and NO. C2018226 in sequence. Experiments prove that the antibody prepared by the two strains of cells has the antibody amount of about 2g/L, the yield is improved by 100 times compared with that of the previous hybridoma cells, the sensitivity of the antibody is consistent with that of the previous monoclonal antibody, and the formed antibody pair is specifically combined with HCV-cAg and can be used for ELISA detection.

Description

Engineering cell strain for stably and efficiently expressing hepatitis C virus core antigen antibody and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a pair of engineering cell strains for stably and efficiently expressing a hepatitis C virus core antigen antibody and application thereof.

Background

Viral hepatitis c, a viral hepatitis caused by Hepatitis C Virus (HCV) infection, is mainly transmitted by blood transfusion, acupuncture, drug inhalation, etc., and according to the statistics of the world health organization, the global HCV infection rate is about 3%, and about 1.8 million people are estimated to be infected with HCV, and about 3.5 ten thousand new cases of hepatitis c are given every year. Hepatitis c is a global epidemic that can lead to chronic inflammatory necrosis and fibrosis of the liver, and some patients can develop cirrhosis and even hepatocellular carcinoma (HCC). The mortality associated with HCV infection will continue to increase over the next 20 years, and therefore all effective measures should be taken to avoid infection.

At present, no vaccine for preventing HCV infection exists, and early discovery is a main method for timely treating and isolating hepatitis C infected patients. The diagnosis of hepatitis c relies primarily on the detection of hepatitis c antigens and nucleic acids. However, since viral RNA is easily degraded and unstable in serum samples of infected persons, detection of HCV RNA is not suitable for large-scale population screening. The development of HCV related antigen detection kit has important value for early discovery and treatment of carriers and control of virus transmission, and has profound significance for guaranteeing the health of people and maintaining public safety.

HCV RNA consists of approximately 9500-10000 bp, and is followed by an Open Reading Frame (ORF) downstream of the 5' non-coding region, wherein the genome is arranged in the order of 5' -C-E1-E2-p7-NS2-NS3-NS4-NS5-3', and can encode a polyprotein precursor of 3014 amino acids in length, which can be cleaved by host cell and viral autoproteases into 10 viral proteins, including three structural proteins, namely a nucleocapsid protein (or Core) with a molecular weight of 19KD and two glycoproteins (E1 with a molecular weight of 33KD and an E2 protein with a molecular weight of 72 Kd), and p7 encodes an integral membrane protein, which may function as an ion channel. The nonstructural protein part includes NS2, NS3, NS4A, NS5A and NS5B, and the nonstructural protein is important to the life cycle of hepatitis C virus.

Among HCV-infected patients, RNA detection enables accurate screening of HCV-infected patients, and HCV cAg, a substance related to HCV RNA, is difficult to detect because of its extremely low content of HCV antigen in the patient's serum. The positive coincidence rate of the HCV cAg detection and the HCV RNA detection is not higher than 60 percent generally, and the detection is easy to miss. However, RNA is used as a molecular detection means, has long detection period, very high technical requirements on detection personnel and higher cost, is not suitable for popularization and use in all hospitals, and on the basis, an antibody which can be combined with HCV cAg with high affinity and specificity is searched, so that the sensitivity and accuracy of HCV cAg detection in serum of HCV infectors can be improved, the improvement and coincidence of positive coincidence rate of HCV cAg detection and HCV RNA detection can be realized, and the method has important significance for clinical detection and application of hepatitis C.

The technology of preparing monoclonal antibody pairs by using hybridoma cells is mature, and reports that the hybridoma cells are used for preparing monoclonal antibodies with high affinity and specific binding related to HCV cAg or developing HCV antigen detection reagents or kits by using the monoclonal antibodies are also available at present, but the monoclonal antibodies for detecting HCV-cAg prepared by the method are few in quantity and cannot meet the requirements of clinical examination or preparation of related detection reagents or kits.

Chinese Hamster Ovary (CHO) cells are mature mammalian cell lines expressing foreign proteins and have practical application experience for many years. The CHO cell is easy to culture in large scale, the exogenous gene is easy to be stably integrated into the genome of the cell, and the CHO cell has great advantages in expressing the exogenous protein, and the CHO cell is expected to realize the mass production of genetic engineering antibodies. But the search finds that: at present, there is no report on obtaining an engineering cell strain capable of stably and efficiently expressing the hepatitis C virus core antigen antibody by using Chinese hamster ovary Cells (CHO) as host cells and transfecting expression plasmids containing HCV-cAg monoclonal antibody genes, and there is no report on application of the CHO engineering cells to preparation of the hepatitis C virus core antigen antibody.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a pair of engineering cell strains for stably and efficiently expressing an antibody of a hepatitis C virus core antigen and application thereof.

The invention relates to a pair of engineering cell strains for stably and efficiently expressing hepatitis C virus core antigen antibodies, which are obtained by taking Chinese hamster ovary Cells (CHO) as host cells, transfecting expression plasmids containing HCV-cAg monoclonal antibody genes and screening; the method is characterized in that: the first engineering cell strain is named as Chinese hamster ovary cell strain CHO/3A2, which can secrete and produce hepatitis C virus core antigen antibody 3A2, and the cell strain is preserved in the China center for type culture Collection 12 months and 12 days in 2018, and the preservation numbers are as follows: CCTCC NO. C2018188; the second engineering cell strain is named as Chinese hamster ovary cell strain CHO/5H7, which can secrete and produce hepatitis C virus core antigen antibody 5H7, and the cell strain is preserved in the China center for type culture Collection 12 months and 12 days in 2018, and the preservation numbers are as follows: CCTCC NO. C2018226.

The eukaryotic cell exogenous gene expression system for constructing the engineering cell strain is characterized in that: the expression system comprises a eukaryotic expression vector and an HCV-cAg antibody gene or a nucleic acid molecule for coding the HCV-cAg amino acid sequence or an antigen binding fragment thereof, wherein the eukaryotic expression vector is pBudCE4.1 or pcDNA3.1, and the plasmid carries Zeocin resistance as a screening label which can be introduced into cells by a DNA transfection method.

Among them, the preferred embodiment is:

the expression system selects an expression vector pBUDCE4.1-H1-L1 (named pBUDCE4.1-3A2) and an expression vector pBUDCE4.1-H2-L2 (named pBUDCE4.1-5H 7); wherein the nucleotide sequence of pBudCE4.1-3A2 is shown in SEQ NO.9, and the nucleotide sequence of pBudCE4.1-5H7 is shown in SEQ NO. 10. The HCV-cAg antibody genes are respectively nucleic acid molecules which are coded and named as monoclonal antibodies 2G7 and are also nucleic acid molecules which are coded and used for a genetic engineering antibody hepatitis C virus core antigen antibody 3A2, the nucleotide sequence of the light chain of the HCV-cAg antibody genes is shown as SEQ ID NO.5, the nucleotide sequence of the heavy chain of the HCV-cAg antibody genes is shown as SEQ ID NO.6, wherein the monoclonal antibodies 2G7 are generated in hybridoma cell strains of CCTCC NO. C2018229; or a nucleic acid molecule which is named as a monoclonal antibody 6A2 and is also a nucleic acid molecule which is coded with a genetic engineering antibody hepatitis C virus core antigen antibody 5H7, wherein the nucleotide sequence of the light chain is shown as SEQ ID NO.7, and the nucleotide sequence of the heavy chain is shown as SEQ ID NO.8, wherein the monoclonal antibody 6A2 is generated in a hybridoma cell strain of CCTCC NO. C2018230; the two hybridoma cell lines are preserved in the China center for type culture Collection in 2018, 12 months and 12 days. China center for type culture Collection Address: china, wuhan university.

The invention relates to application of a pair of engineering cell strains stably and efficiently expressing a hepatitis C virus core antigen antibody in preparation of the hepatitis C virus core antigen antibody.

Wherein: the formula of the special culture medium capable of obviously improving the antibody yield during the engineering cell culture is as follows: 10g/L CHO-S-SFM II dry powder culture medium, NaHCO₃2.40-2.45 g/L, 7-8 mM glutamine, 2 + -0.2 mM ferric citrate, and a final pH of 7.0-7.2; the medium was named CHO-Med-01; the material supplementing mode adopted when the engineering cells are cultured is as follows: feeding FeedA with final concentration of 7ml/L, 8ml/L, 9ml/L, 10ml/L, 9ml/L and 8ml/L respectively on days 1, 3, 5, 7, 9 or 11.

Furthermore, the formula of the special culture medium capable of obviously improving the antibody yield during the culture of the engineering cells is preferably as follows: 10g/L CHO-S-SFM II dry powder culture medium, NaHCO₃2.45g/L, 8mM glutamine, 2mM ferric citrate, final pH 7.1.

The hepatitis C virus core antigen antibody pair secreted and produced by the pair of engineering cell strains comprises a first genetic engineering antibody and a second genetic engineering antibody which are independently stored; the method is characterized in that: the first genetic engineering antibody is named as hepatitis C virus core antigen antibody 3A2 and is secreted by Chinese hamster ovary cell strain CHO/3A2, the amino acid sequence of the light chain is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 2; the second genetic engineering antibody is named as hepatitis C virus core antigen antibody 5H7 and is secreted by Chinese hamster ovary cell strain CHO/5H7, the amino acid sequence of the light chain is shown as SEQ ID NO.3, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 4.

The CHO engineering cell strain can respectively and stably express the hepatitis C virus core antigen antibody to CHO/3A2 and CHO/5H7, and particularly the cell strain can secrete and express the antibody to cell culture supernatant, and the secreted antibody can be detected by an enzyme-linked immunosorbent assay (ELISA). After the cell number of the cell strain is multiplied for 1 to 40 times, the expression level of the antibody is stable, namely under the same culture condition, after the cell number is multiplied for 1 to 40 times, the antibody concentration in the cell culture supernatant is kept at about 2g/L through enzyme linked immunosorbent assay (ELISA) detection. The hepatitis c virus core antigen antibody can be purified from the cell culture supernatant using affinity purification.

The hepatitis C virus core antigen antibody pair is used as a coating antibody and a detection antibody in a matched mode to be applied to preparation of an ELISA detection reagent or kit of HCV-cAg.

The CHO engineering cell strain can form an antibody pair for detecting HCV-cAg by an ELISA method for hepatitis C virus core antigen antibodies prepared by CHO/3A2 and CHO/5H 7. Wherein: the coating antibody is selected from a first genetic engineering antibody 3A2, and the detection antibody is selected from a second genetic engineering antibody 5H 7; when the kit is applied, a first genetic engineering antibody 3A2 is coated on an ELISA detection plate, an HRP-labeled second genetic engineering antibody 5H7 is contained in an enzyme diluted sample, and the first genetic engineering antibody and the second genetic engineering antibody are used in a matched mode.

The invention has the advantages and outstanding effects that:

1) the CHO engineering cell strain related to the invention can respectively and stably express the hepatitis C virus core antigen antibody to CHO/3A2 and CHO/5H7, the expression level of the antibody is stable after the cell number is multiplied for 1 to 40 times, namely, the antibody concentration in the cell culture supernatant is kept at 2g/L through enzyme linked immunosorbent assay (ELISA) detection after the cell number is multiplied for 1 to 40 times under the same culture condition. Realizes the mass production of the hepatitis C virus core antigen antibody by using the engineering cell strain.

2) The invention utilizes the CHO engineering cell strain to prepare the hepatitis C virus core antigen antibody which has extremely high sensitivity and specificity to HCV-cAg. The experiment proves that: the antibody pair prepared by the invention can achieve the sensitivity of 5pg/ml for detecting HCV-cAg by an ELISA method, realize the detection coincidence rate of HCV patients to reach 98%, effectively reduce the omission phenomenon and remarkably improve the detection rate of HCV-cAg. The antibody provides a good antibody source for the development of an antigen detection kit applied to hepatitis C virus, and has important significance and value for the clinical detection application of hepatitis C.

Drawings

FIG. 1 is an SDS-PAGE electrophoresis of the pair of genetically engineered antibodies 3A2-5H 7.

Wherein: the lane 3A2 is the electrophoresis image of the 3A2 monoclonal antibody, and the lane 5H7 is the electrophoresis image of the 5H7 monoclonal antibody.

FIG. 2 is a graph showing the cell density and the cell viability at different time points in the case of culturing the CHO engineering cell strain CHO/3A2 for a long period of time.

FIG. 3 is a graph showing the cell density and the cell viability at different time points in the case of culturing the CHO engineering cell strain CHO/5H7 for a long period of time.

FIG. 4 is a graph showing the antibody production at various time points in the long-term culture of the CHO engineered cell line CHO/3A 2.

FIG. 5 is a graph showing the antibody production at various time points in the long-term culture of the CHO engineered cell line CHO/5H 7.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples are merely illustrative of the preferred embodiments of the present invention and are not intended to limit the present invention in any way, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention fall within the scope of the technical solution of the present invention.

The method used in the examples of the present invention is a conventional method; the carrier used was: pBUDCE4.1 was purchased from Biowind; restriction enzymes BamH I, Hand III, Not I, Kpn I, T4 ligase, and competent cell TOP10 were purchased from TaKaRa; CHO cells were purchased from Shanghai Jining JN-B1955; lipo2000 was purchased from thermo; the feed of FeedA was purchased from gibco, and the CHO-S-SFM II dry powder medium from invitrogen.

Example 1: preparation of expression plasmids pBUDCE4.1-H1-L1, pBUDCE4.1-H2-L2

Two hybridoma cells obtained by experimental screening are secreted and generated by CCTCC NO. C2018229 and CCTCC NO. C2018230, and 1 pair of monoclonal antibodies 2G7 and 6A2 are assigned to a sequencing company (Shanghai Boshang biotechnology limited) to carry out nucleotide sequencing on the antibodies.

The nucleotide sequence of the light chain of the monoclonal antibody 2G7 generated in the CCTCC NO. C2018229 hybridoma cell line is determined to be shown in SEQ ID NO.5, the nucleotide sequence of the heavy chain is determined to be shown in SEQ ID NO.6, and the nucleic acid molecule of the core antigen antibody 3A2 of the hepatitis C virus encoding genetic engineering antibody is also set, the nucleotide sequence of the light chain is also shown in SEQ ID NO.5, and the nucleotide sequence of the heavy chain is also shown in SEQ ID NO. 6. The sequencing company was requested to create cloning vectors that provide the gene sequences of the antibodies, and the cloning vectors were: PUC19-H1, PUC 19-L1.

The nucleotide sequence of the light chain of the monoclonal antibody 6A2 generated in the CCTCC NO. C2018230 hybridoma cell strain is determined to be shown in SEQ ID NO.7, the nucleotide sequence of the heavy chain is determined to be shown in SEQ ID NO.8, and the nucleic acid molecule of the core antigen antibody 5H7 of the hepatitis C virus of the genetic engineering antibody is also set, the nucleotide sequence of the light chain is also shown in SEQ ID NO.7, and the nucleotide sequence of the heavy chain is also shown in SEQ ID NO. 8. The sequencing company was requested to create cloning vectors that provide the gene sequences of the antibodies, and the cloning vectors were: PUC19-H2, PUC 19-L2.

The two hybridoma cell strains are preserved in a China center for type culture Collection in 2018, 12 months and 12 days respectively. China center for type culture Collection Address: china, wuhan university.

Constructing a vector and a plasmid:

1.1, pBUDCE4.1-H1-L1 and pBUDCE4.1-H2-L2 eukaryotic expression vectors

1) A3A 2 heavy chain primer and a light chain primer (3A 2L 1F and 3A 2L 1R, 3A 2H 1F and 3A 2H 1R) are respectively used, BamH I and Hand III are added at two ends of A3A 2 light chain gene L1 by a PCR method, Not I and Kpn I are added at two ends of A3A 2 heavy chain gene H1, and L1 and H1 gene fragments of the antibody are respectively obtained from pUC19-L1 and pUC 19-H1.

Wherein: the specific nucleotide sequences of the 3A2 heavy chain primer and the light chain primer are as follows:

3A2 L1F ATTTGCGGCCGCGAGATCGTGATGACCCAGAG

3A2 L1R GGGGTACCGCACTCGTTCCTGTAGAAG

3A2 H1F CCCAAGCTTATGGACAGGCTGACCAGCAGC

3A2 H1R CGGGATCCCTTGCCGGGGCTCCTGCTGATG

the PCR system was as follows: TaKaRa Ex Taq 0.25 u L, 10 x Ex Taq Buffer 5 u L, dNTP (each 2.5mM)4 u L, plasmid DNA 0.5 u L, upstream primer 1 u L, downstream primer 1 u L, distilled water 38.25 u L; the PCR procedure was as follows: 3min at 94 ℃; 30 cycles at 94 ℃ for 30s, at 55 ℃ for 30s, and at 72 ℃ for 1-2min (1 kbp/min); 5min at 72 ℃.

2) The 3A2 light chain nucleotide fragment and the pBudCE4.1 vector are cut by BamH I and Hand III enzyme, the 3A2 light chain nucleotide fragment is connected into the pBudCE4.1 vector after connection and transformation, and the NotI and KpnI enzyme digestion is carried out after the plasmid is extracted.

The enzyme digestion system and procedure were as follows: plasmid DNA/PCR product 1.2-1.5 μ g, endonuclease Not I (TaKaRa)2 μ L, endonuclease Kpn I (TaKaRa)2 μ L, 10 × buffer 5 μ L, water supplement to 50 μ L, 37 deg.C 4-6 h; the dephosphorization procedure was as follows: enzyme digestion product 1 μ g, CIAP 1 μ L, 10 × Aliline Phosphatase Buffer 5 μ L, and water supplement to 50 μ L; recovering at 37 deg.C for 1-2h according to conventional laboratory method. And is connected with a nucleotide fragment of a 3A2 heavy chain which is cut by Not I and Kpn I, and the system is as follows: according to the concentration, the vector is loaded according to the proportion of 10:1 of the fragment to the vector, 2.5 mu L of 10 XT 4 DNA Ligase Buffer and 1 mu L of T4 DNA Ligase are supplemented with water to 25 mu L, the temperature is kept overnight at 16 ℃, transformed Escherichia coli DH5 alpha competent cells are taken out the next day, positive clones are screened according to the general method of a laboratory, and finally the vector pBUDCE4.1-H1-L1 is obtained and named as pBUDCE4.1-3A 2.

The vector pBUDCE4.1-H2-L2 was obtained in the same manner as described above and named pBUDCE4.1-5H 7. Wherein, the specific nucleotide sequences of the 5H7 heavy chain primer and the light chain primer are as follows:

5H7 L2F ATTTGCGGCCGCGAGATCGTGATGGTGCAGAG

5H7 L2R GGGGTACCGCACTCGTTCCTGTAGAAGC

5H7 H2F CCCAAGCTTATGGACAGGCTGACCAGCAGC

5H7 H2R CGGGATCCGACCATCAGCAGGAGCCCCGGC

1.2, culturing escherichia coli, and greatly extracting plasmids:

the plasmid big extraction kit is purchased from holo-type gold company, and the product number is: EM121-01

The obtained Escherichia coli containing pBUDCE4.1-H1-L1 and pBUDCE4.1-H2-L2 was cultured and subjected to mass extraction of plasmids. The extraction step was performed according to kit instructions.

As a result:

1. sequencing results of all target vectors are consistent with the theoretical sequence alignment through sequencing, and sequencing results of target gene fragments H1 and L1 in the plasmid pBUDCE4.1-H1-L1 are respectively consistent with SEQ No.5 and SEQ No. 6; the sequencing results of target gene fragments H2 and L2 in pBUDCE4.1-H2-L2 are consistent with that of SEQ: No.7 and SEQ: No.8 respectively. The nucleotide sequence of pBudCE4.1-3A2(pBUDCE4.1-H1-L1) is shown in SEQ NO.9, and the nucleotide sequence of pBudCE4.1-5H7(pBUDCE4.1-H2-L) is shown in SEQ NO. 10.

2. The two extracted plasmids pBUDCE4.1-H1-L1 and pBUDCE4.1-H2-L2 have detection concentrations of 1.123mg/ml and 1.286mg/ml respectively.

Example 2 transfection of CHO cells and selection of pairs of cell lines expressing the antibody pairs

Materials and reagents: CHO cells were purchased from Shanghai Jinnin JN-B1955, lipo2000 from thermo, FeedeA supplement from gibco, CHO-S-SFM II dry powder medium from invitrogen.

2.1 CHO cell culture

CHO cells were treated at 5X 10⁵Each mL was inoculated into 15mL of a medium (CHO-S-SFM II (Invitrogen)) in a 125mL Erlenmeyer flask with a lid, glutamine was added to a final concentration of 8mM, and the flask was placed at 37 ℃ with a relative humidity of 70-80%, 5% dioxygenThe carbon cell is cultured in a shaking table incubator at the rotating speed of: 125 rpm.

The cells were observed daily starting from 2 days of culture and counted. When counting, 20. mu.L of 0.4% trypan blue staining solution was added to the sample, and the mixture was put on a cell counting plate and counted by a cell counter. The number of live cells and the number of dead cells were recorded at each time. When the number of cells is about 2.0X 10⁶When the survival rate is higher than 95 percent, the cells are transferred to a 6-hole cell culture plate for plating culture, and the number of the added cells in each hole is 3 multiplied by 10⁶The total volume of cell sap per ml was 3 ml.

2.2 CHO cell transfection

The plasmids pBUDCE4.1-H1-L1 and pBUDCE4.1-H2-L2 obtained by mass extraction are respectively transfected by cells, and the specific operation steps are as follows:

1) inoculating cells to 70-90% confluence, and transfecting;

2) diluting lipofectamine3000 reagent by using an opti-MEM culture medium, and fully and uniformly mixing;

3) diluting DNA by using an opti-MEM culture medium to prepare a DNA premix, adding a P3000 reagent, and fully and uniformly mixing;

4) mix the diluted DNA with diluted lipofectamine3000 reagent (1:1 ratio);

5) incubating for 5 min;

6) adding the DNA-liposome complex to the cells.

Plasmids pBUDCE4.1-H1-L1 and pBUDCE4.1-H2-L2 transfected three wells of 6-well plates, respectively.

2.3 selection of Stable cell lines

After 24h of transfection, the cells were screened by limiting dilution, the subcloned cells were mixed well using a pipette, the cells were diluted to a density of 4 cells/ml using zeocin (1mg/L) containing screening medium at 200. mu.l/well in 96 well plates, the cells transfected with each plasmid were plated in 10 well plates, and 5% CO was added₂Culturing in an incubator at 37 ℃; after 2 weeks, microscopically observing the holes marked with the growing single cell clusters, wherein about 20 clones grow out of each plate, microscopically observing and removing obvious non-monoclonal cells, and according to Poisson distribution, the rest clones can be considered as monoclonals; culturing until about day 20, collecting 100 μ l supernatant per well, and usingDetecting by an ELISA method, screening cell strains with high expression quantity, transferring the cell strains to a 24-pore plate, and culturing;

after 3 days, 100 mul of supernatant is taken from each hole of a 24-hole plate, the supernatant is detected by an ELISA method, and cell strains with high expression level are screened and transferred to a 6-hole plate for culture;

after 5 days, 100 mul of supernatant is taken from each hole of a 6-hole plate, the supernatant is detected by an ELISA method, and cell strains with high expression quantity are screened and transferred to a shake flask for culture;

subcloning the cells in the shake flask again, screening the cell strain with the highest expression quantity, performing amplification culture, and freezing and storing;

as a result:

for cells transfected with plasmid pBUDCE4.1-H1-L1 and plasmid pBUDCE4.1-H2-L2:

1) taking supernatant from the cultured monoclonal cells in a 96-well plate, determining the expression quantity of the antibody by an enzyme-linked immunosorbent assay (ELISA), selecting 100 high-expression clones, transferring the clones into a 24-well plate, and continuously culturing;

2) taking supernatant from the cultured monoclonal cells in a 24-well plate, determining the expression quantity of the antibody by an enzyme-linked immunosorbent assay (ELISA), and selecting 24 high-expression clones to transfer into a 6-well plate for continuous culture;

3) taking supernatant from the cultured monoclonal cells in a 6-well plate, determining the expression quantity of the antibody by an enzyme-linked immunosorbent assay (ELISA), and selecting 1 highly expressed clone to transfer into a shake flask for culture;

4) the cells in the shake flask were again subcloned, and 2 cell lines with the highest expression were selected and named CHO/3A2 and CHO/5H 7.

Example 3

Preparation of monoclonal antibody pairs and potency assay Using CHO cell lines

3.1 batch culture of two CHO cell lines CHO/3A2 and CHO/5H7

Cell lines CHO/3A2 and CHO/5H7 were mixed at 0.4X 10⁶The cell/ml is inoculated into an SF250ml cell culture triangular flask, the culture system is 50ml, the culture medium adopts a special culture medium (CHO-Med-01) capable of obviously improving the antibody yield, and the base formula is as follows: 10g/L CHO-S-SFM II dry powder culture medium, NaHCO₃2.45g/L, 8mM glutamine, 2mM ferric citrate, final pH 7.1. After inoculation, trypan blue staining is counted, the culture bottle is placed in a 37 ℃, the relative humidity is 70-80%, and 5% carbon dioxide cell shaking incubator is used for culture, and the rotating speed is as follows: 125 rpm.

Observing the growth condition of the cells every day, staining and counting trypan blue, taking 20 mu L of the cells when counting, adding the 20 mu L of the cells into a centrifuge tube with 0.4% trypan blue staining solution, mixing the cells uniformly, taking 20 mu L of the cells, adding the cells into a cell counting plate, and counting the cells by using a cell counter. The number of live cells, the number of dead cells, the cell viability and the cell clumping rate were recorded each time. At the same time of counting, 100 mul of cell culture fluid is taken each time to carry out ELISA detection of antibody expression quantity, and 500 mul is taken to carry out detection of biochemical index glucose.

According to the monitoring, 80.2g of Feed A powder was dissolved in 1L of ultrapure water to prepare a Feed A liquid. Feed a liquid was added according to the CHO cell culture feeding scheme of table 1.

Table 1: CHO cell culture feeding scheme

	Day 1	Day 3	Day 5	Day 7	Day 9	Day 11
							Final concentration of FeedA (ml/L)	7	8	9	10	9	8

According to the detection index number of glucose, 40% sterile glucose was added to make the glucose concentration after feeding at 6 g/L.

When the cell viability is lower than 90%, stopping culturing, collecting cell sap, centrifuging at 4 deg.C and 12000rpm for 10min, and filtering with 0.22 μm filter membrane.

In the experiment, cell density and activity curves at different time points during long-term culture and antibody production curves at different time points during long-term culture of cells were examined. The results are shown in FIGS. 2 to 5.

3.2 purification of HCV-3A2 and HCV-5H7 monoclonal antibodies from cell culture supernatants

1) The ProtienA column was washed with PBS buffer ph7.2 for about 5 column volumes.

2) Loading: the filtered cell culture supernatant was loaded and the antibody bound to ProteinA in the filler.

3) Balancing: the column is washed with PBS buffer until baseline equilibration, typically 5-10 column volumes.

4) And (3) elution: the antibody was eluted using a sodium citrate solution pH3.2 and collected.

5) Desalting: and (4) loading the collected antibody to a desalting chromatographic column for desalting.

6) Collecting: the antibody solution was collected and stored at 4 ℃ with 0.5% sodium azide.

The antibody concentration in the sample, the flow-through solution, the eluate, etc. is detected by enzyme-linked immunosorbent assay (ELISA method).

3.3 enzyme-labeling of monoclonal antibodies 3A2 and 5H7

In this example, the sodium periodate method is used to label the antibody, and the specific operation steps are as follows:

1) 5mg of HRP was weighed out and dissolved in 1ml of distilled water.

2) Adding 0.2ml of newly prepared 0.1M NaIO into the supernatant₄The solution was stirred at room temperature for 20 minutes in the absence of light. 5mg of purified antibody was added and mixed well.

3) The above solution was filled into a dialysis bag, dialyzed against 1mM sodium acetate buffer pH4.4 at 4 ℃ overnight.

4) Mu.l of 0.2M carbonate buffer pH9.5 was added to raise the pH of HRP to 9.0-9.5, and 10mg of IgG was immediately added to 1ml of 0.01M carbonate buffer, followed by gentle stirring at room temperature for 2 hours in the absence of light.

5) Adding 0.1ml of newly formulated 4mg/ml NaBH₄Mixing the solutions, and standing at 4 deg.C for 2 hr.

6) The above solution was put into a dialysis bag, dialyzed against 0.15M PBS (pH7.4), and left overnight at 4 ℃.

7) An equal volume of saturated ammonium sulfate was added dropwise with stirring and left at 4 ℃ for 1 hour.

8) Centrifuge at 3000rpm for half an hour, and discard the supernatant. The precipitate was washed twice with half-saturated ammonium sulfate and finally dissolved in a small amount of 0.15M PBS pH 7.4.

9) Putting the solution into a dialysis bag, dialyzing 0.15M PBS buffer saline with pH7.4, removing ammonium ions, centrifuging at 10,000rpm for 30 minutes to remove precipitates, collecting the supernatant, namely enzyme-labeled (HRP) antibodies 3A2 and 5H7, subpackaging, and freezing for storage.

3.4 potency assay of antibodies

And (3) taking an HCV antigen coated enzyme label plate, blocking by a 5% BSA solution, and detecting the titer of the purified monoclonal antibody by an indirect ELASA method.

1) Samples containing the above antibodies were diluted in duplicate, PBS was used as a negative control, 100. mu.L of each well was added to an ELISA plate, and incubated at 37 ℃ for 1 hour.

2) After TBST washing, HRP-labeled secondary antibody was added at a dilution of 1:4000, and incubated at 37 ℃ for 1 hour.

3) After TBST washing, TMB substrate was added to develop color for 15min, and the reaction was terminated. OD450 values are read by a microplate reader, and the detection results are shown in Table 2.

Table 2: antibody titer detection experiment result

Example 4

4.1 comparative test of genetically engineered antibodies and monoclonal antibodies in detection

1) The engineered antibody 3A2 and the monoclonal antibody 2G7 were diluted to 5. mu.g/mL with a carbonate buffer solution of pH9.6, coated with an enzyme plate (three detection wells for each antibody), and incubated overnight at 4 ℃.

2) Taking out the enzyme-linked immunosorbent assay plate after 24h, washing the enzyme-linked immunosorbent assay plate once by TSBT, and blocking the enzyme-linked immunosorbent assay plate for 2h at 37 ℃ by 5% BSA solution;

3) HCV antibody positive serum was added to each well and incubated at 37 ℃ for 1 hour with a healthy human serum sample negative control. After completion of incubation, the microplate was removed, washed three times with TBST, 100. mu.L (1:4000) of HRP-labeled 5H7 engineered antibody was added to the wells coated with 3A2 antibody, 100. mu.L (1:4000) of HRP-labeled 6A2 monoclonal antibody was added to the wells coated with 2G7 antibody, and incubated at 37 ℃ for 1 hour.

4) TBST was washed five times, TMB substrate was added and color development was carried out at 37 ℃ for 20 min. Taking out, adding stop solution, and measuring OD on enzyme-linked immunosorbent assay (ELISA) instrument₄₅₀The reading and the detection result are shown in the table 3. From the results, it was found that the sensitivity of the engineered antibodies 3A2 and 5H7 in the detection of HCV core antigen was consistent with that of the pair of monoclonal antibodies 2G7 and 6A 2. The results are shown in Table 3.

Table 3: comparison experiment of genetically engineered antibody and monoclonal antibody

4.1 paired antibody sensitivity evaluation

The paired antibodies screened in the experiment, namely the first monoclonal antibody 3A2 (coating antibody) and the second monoclonal antibody 5H7 (enzyme-labeled antibody), carry out gradient dilution detection on the recombinant HCV-cAg, and determine the sensitivity of the paired antibodies 3A2-5H7 to the recombinant HCV-cAg. The results are shown in Table 4.

Table 4: 3A2-5H7 paired antibody sensitivity detection result

The detection sensitivity of the conjugated antibody 3A2-5H7 to recombinant HCV-cAg is 5pg/ml, which is higher than that of a common detection kit.

4.2 evaluation of specificity of paired antibodies

Paired monoclonal antibodies screened in this experiment: the first monoclonal antibody 3A2 (coated antibody) and the second monoclonal antibody 5H7 (enzyme-labeled antibody) were used to detect 90 serum samples of patients without hepatitis C, wherein the detection results of 30 serum samples of hepatitis B patients, 30 serum samples of syphilis patients and 30 serum samples of rheumatoid patients are shown in Table 5.

Table 5: detection result of specificity of A2-5H7 paired antibody

	Rate of cross reaction
		Hepatitis B virus	0
Syphilis	0
		Rheumatoid disease	0

The results show that: the paired monoclonal antibodies 3A2-5H7 have no cross reaction on the serum of all hepatitis B patients, have no cross reaction on the serum of all syphilis patients and have no cross reaction on the serum of all rheumatoid patients, which indicates that the specificity of the antibody pair is higher. The paired monoclonal antibodies 3A2-5H7 have no cross reaction to hepatitis B virus, syphilis virus, rheumatoid factor and the like.

In conclusion, the results of the examples show that a pair of monoclonal antibodies are screened, the detection sensitivity of the invention for detecting HCV-cAg by ELISA reaches 5pg/mL, and the invention has high sensitivity and specificity without cross reaction to hepatitis B, syphilis, rheumatoid factors and the like.

The genetic engineering antibody pair comprises a first genetic engineering antibody and a second genetic engineering antibody which are independently stored; wherein: the first genetic engineering antibody is named as hepatitis C virus core antigen antibody 3A2 and is secreted by Chinese hamster ovary cell strain CHO/3A2, the amino acid sequence of the light chain is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 2; the second genetic engineering antibody is named as hepatitis C virus core antigen antibody 5H7 and is secreted by Chinese hamster ovary cell strain CHO/5H7, the amino acid sequence of the light chain is shown as SEQ ID NO.3, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 4.

Engineering cell strains stably and efficiently expressing the hepatitis C virus core antigen antibodies 3A2 and 5H 7; wherein: the first engineering cell strain is named as Chinese hamster ovary cell strain CHO/3A2, which can secrete and produce hepatitis C virus core antigen antibody 3A2, and the cell strain is preserved in the China center for type culture Collection 12 months and 12 months in 2018, and the preservation numbers are as follows: CCTCC NO. C2018188; the second engineering cell strain is named as Chinese hamster ovary cell strain CHO/5H7, which can secrete and produce hepatitis C virus core antigen antibody 5H7, and the cell strain is preserved in the China center for type culture Collection 12 months and 12 months in 2018, and the preservation numbers are as follows: CCTCC NO. C2018226. China center for type culture Collection Address: china, wuhan university.

Sequence listing

<110> Shandong Laibo Biotech Ltd

<120> engineering cell strain for stably and efficiently expressing hepatitis C virus core antigen antibody and application thereof

<141> 2018-12-19

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 219

<212> PRT

<213> Artificial sequence

<221> light chain amino acid sequence of genetically engineered antibody 3A2

<400> 1

EIVMTQSPLS LPVSLGDQAS ISCRSSQSLE HNNGNTYLNW YQQKPGKAPK LLIYRASSLQ 60

SGGLDRFSGS GSGTDFTLKI SRVEAEDLGV YFCLQGTHVP FTAGSATKLE IKRADAAKTV 120

SIFPVVSEQL TSGGASVVCF LNNFYPKDIN VKWKIDGSER QNGVLNSWQQ QDSKDSTYSM 180

SSTLTLTKDE CCRHNSYTCE ATHKTSTSPI VKSFYRNEC 219

<210> 2

<211> 479

<212> PRT

<213> Artificial sequence

<221> amino acid sequence of heavy chain of genetically engineered antibody 3A2

<400> 2

MDRLTSSFLL LIVPAYVLSQ ASLETLKESG PGILKPSTTL SLTCSFSGFS LSTSGMGVSS 60

IRQPSGKGLE WLAHIWWDKV YLLLKSALTI SKDQSRNQVC GCGTSLDTAD TATYYCVRRA 120

FSYGTTRDYF DYWCQGTFLT VSSAKTTPPV VYPLAPGCGD TTGSSVTLAC SVKGYFPESV 180

TVTWNSGSLS SSVHTFPALL QSGLYTMSSS VTVPSSTWPS QTVTCSVAHP ASSTTVDKKL 240

EPSGPISTIN PCPPCKECHK CPAPNLEGGP SVFIFPDNIK DVLMISLTPK VTCVVVPVSE 300

DDPDALISWF VNNVEVHTAQ TQTHREDYNS TIRVVSTLPI QHQDWMSGKE FKCKVNNKDL 360

PSPIERTISK IKGLVRAPQV YILPPTAEQL SRKDVSLTCL VVGFNPGDIS VEWTSNGHTE 420

ENYKDTAPVL DSDGSYKIYS KLNMKTSKWE KTDSFSCNVR HEGLKNYYLK KTISRSPGK 479

<210> 3

<211> 219

<212> PRT

<213> Artificial sequence

<221> light chain amino acid sequence of genetically engineered antibody 5H7

<400> 3

EIVMVQSPDS LSASVGTRVT CITCRAGQSI SSYLNLYDQK PGKAPKLLIY AACSLQSGVP 60

SSFSGSVDGT DFALTISSLQ PEDFATYYCQ QSYSFPVTFG QGTKVEIKRE IKRADAAKTV 120

SIFPVVSEQL TSGGASVVCF LNNFYPKDIN VKWKIDGSER QNGVLNSWQQ QDSKDSTYSM 180

SSTLTLTKDE CCRHNSYTCE ATHKTSTSPI VKSFYRNEC 219

<210> 4

<211> 479

<212> PRT

<213> Artificial sequence

<221> genetically engineered antibody 5H7 heavy chain amino acid sequence

<400> 4

MDRLTSSFCG CIVPAYVLSQ ASLETLKESG PGILKPACGL SLTEWEGSFF SLSTSGAPSS 60

SIRQPSGKGL EWLAHIPPDK VCGCKSALTI SKAGSRNQVG GCCTSLDTAD TATWCCVRRA 120

FSYGTTRDYF DYWCQGTFLT VSSAKTTPPV VYPLAPGCGD TTGSSVTLAC SVKGYFPESV 180

TVTWNSGSLS SSVHTFPALL QSGLYTMSSS VTVPSSTWPS QTVTCSVAHP ASSTTVDKKL 240

EPSGPISTIN PCPPCKECHK CPAPNLEGGP SVFIFPDNIK DVLMISLTPK VTCVVVPVSE 300

DDPDALISWF VNNVEVHTAQ TQTHREDYNS TIRVVSTLPI QHQDWMSGKE FKCKVNNKDL 360

PSPIERTISK IKGLVRAPQV YILPPTAEQL SRKDVSLTCL VVGFNPGDIS VEWTSNGHTE 420

ENYKDTAPVL DSDGSYKIYS KLNMKTSKWE KTDSFSCNVR HEGLKNYYLK KTISRSPGK 479

<210> 5

<211> 657

<212> DNA

<213> Artificial sequence

<221> light chain nucleotide sequence of genetically engineered antibody 3A2

<400> 5

gagatcgtga tgacccagag ccccctgagc ctgcccgtga gcctgggcga ccaggccagc 60

atcagctgca ggagcagcca gagcctggag cacaacaacg gcaacaccta cctgaactgg 120

taccagcaga agcccggcaa ggcccccaag ctgctgatct acagggccag cagcctgcag 180

agcggcggcc tggacaggtt cagcggcagc ggcagcggca ccgacttcac cctgaagatc 240

agcagggtgg aggccgagga cctgggcgtg tacttctgcc tgcagggcac ccacgtgccc 300

ttcaccgccg gcagcgccac caagctggag atcaagaggg ccgacgccgc caagaccgtg 360

agcatcttcc ccgtggtgag cgagcagctg accagcggcg gcgccagcgt ggtgtgcttc 420

ctgaacaact tctaccccaa ggacatcaac gtgaagtgga agatcgacgg cagcgagagg 480

cagaacggcg tgctgaacag ctggcagcag caggacagca aggacagcac ctacagcatg 540

agcagcaccc tgaccctgac caaggacgag tgctgcaggc acaacagcta cacctgcgag 600

gccacccaca agaccagcac cagccccatc gtgaagagct tctacaggaa cgagtgc 657

<210> 6

<211> 1437

<212> DNA

<213> Artificial sequence

<221> genetically engineered antibody 3A2 heavy chain nucleotide sequence

<400> 6

atggacaggc tgaccagcag cttcctgctg ctgatcgtgc ccgcctacgt gctgagccag 60

gccagcctgg agaccctgaa ggagagcggc cccggcatcc tgaagcccag caccaccctg 120

agcctgacct gcagcttcag cggcttcagc ctgagcacca gcggcatggg cgtgagcagc 180

atcaggcagc ccagcggcaa gggcctggag tggctggccc acatctggtg ggacaaggtg 240

tacctgctgc tgaagagcgc cctgaccatc agcaaggacc agagcaggaa ccaggtgtgc 300

ggctgcggca ccagcctgga caccgccgac accgccacct actactgcgt gaggagggcc 360

ttcagctacg gcaccaccag ggactacttc gactactggt gccagggcac cttcctgacc 420

gtgagcagcg ccaagaccac cccccccgtg gtgtaccccc tggcccccgg ctgcggcgac 480

accaccggca gcagcgtgac cctggcctgc agcgtgaagg gctacttccc cgagagcgtg 540

accgtgacct ggaacagcgg cagcctgagc agcagcgtgc acaccttccc cgccctgctg 600

cagagcggcc tgtacaccat gagcagcagc gtgaccgtgc ccagcagcac ctggcccagc 660

cagaccgtga cctgcagcgt ggcccacccc gccagcagca ccaccgtgga caagaagctg 720

gagcccagcg gccccatcag caccatcaac ccctgccccc cctgcaagga gtgccacaag 780

tgccccgccc ccaacctgga gggcggcccc agcgtgttca tcttccccga caacatcaag 840

gacgtgctga tgatcagcct gacccccaag gtgacctgcg tggtggtgcc cgtgagcgag 900

gacgaccccg acgccctgat cagctggttc gtgaacaacg tggaggtgca caccgcccag 960

acccagaccc acagggagga ctacaacagc accatcaggg tggtgagcac cctgcccatc 1020

cagcaccagg actggatgag cggcaaggag ttcaagtgca aggtgaacaa caaggacctg 1080

cccagcccca tcgagaggac catcagcaag atcaagggcc tggtgagggc cccccaggtg 1140

tacatcctgc cccccaccgc cgagcagctg agcaggaagg acgtgagcct gacctgcctg 1200

gtggtgggct tcaaccccgg cgacatcagc gtggagtgga ccagcaacgg ccacaccgag 1260

gagaactaca aggacaccgc ccccgtgctg gacagcgacg gcagctacaa gatctacagc 1320

aagctgaaca tgaagaccag caagtgggag aagaccgaca gcttcagctg caacgtgagg 1380

cacgagggcc tgaagaacta ctacctgaag aagaccatca gcaggagccc cggcaag 1437

<210> 7

<211> 657

<212> DNA

<213> Artificial sequence

<221> light chain nucleotide sequence of genetically engineered antibody 5H7

<400> 7

gagatcgtga tggtgcagag ccccgacagc ctgagcgcca gcgtgggcac cagggtgacc 60

tgcatcacct gcagggccgg ccagagcatc agcagctacc tgaacctgta cgaccagaag 120

cccggcaagg cccccaagct gctgatctac gccgcctgca gcctgcagag cggcgtgccc 180

agcagcttca gcggcagcgt ggacggcacc gacttcgccc tgaccatcag cagcctgcag 240

cccgaggact tcgccaccta ctactgccag cagagctaca gcttccccgt gaccttcggc 300

cagggcacca aggtggagat caagagggag atcaagaggg ccgacgccgc caagaccgtg 360

agcatcttcc ccgtggtgag cgagcagctg accagcggcg gcgccagcgt ggtgtgcttc 420

ctgaacaact tctaccccaa ggacatcaac gtgaagtgga agatcgacgg cagcgagagg 480

cagaacggcg tgctgaacag ctggcagcag caggacagca aggacagcac ctacagcatg 540

agcagcaccc tgaccctgac caaggacgag tgctgcaggc acaacagcta cacctgcgag 600

gccacccaca agaccagcac cagccccatc gtgaagagct tctacaggaa cgagtgc 657

<210> 8

<211> 1437

<212> DNA

<213> Artificial sequence

<221> genetically engineered antibody 5H7 heavy chain nucleotide sequence

<400> 8

atggacaggc tgaccagcag cttctgcggc tgcatcgtgc ccgcctacgt gctgagccag 60

gccagcctgg agaccctgaa ggagagcggc cccggcatcc tgaagcccgc ctgcggcctg 120

agcctgaccg agtgggaggg cagcttcttc agcctgagca ccagcggcgc ccccagcagc 180

agcatcaggc agcccagcgg caagggcctg gagtggctgg cccacatccc ccccgacaag 240

gtgtgcggct gcaagagcgc cctgaccatc agcaaggccg gcagcaggaa ccaggtgggc 300

ggctgctgca ccagcctgga caccgccgac accgccacct ggtgctgcgt gaggagggcc 360

ttcagctacg gcaccaccag ggactacttc gactactggt gccagggcac cttcctgacc 420

gtgagcagcg ccaagaccac cccccccgtg gtgtaccccc tggcccccgg ctgcggcgac 480

accaccggca gcagcgtgac cctggcctgc agcgtgaagg gctacttccc cgagagcgtg 540

accgtgacct ggaacagcgg cagcctgagc agcagcgtgc acaccttccc cgccctgctg 600

cagagcggcc tgtacaccat gagcagcagc gtgaccgtgc ccagcagcac ctggcccagc 660

cagaccgtga cctgcagcgt ggcccacccc gccagcagca ccaccgtgga caagaagctg 720

gagcccagcg gccccatcag caccatcaac ccctgccccc cctgcaagga gtgccacaag 780

tgccccgccc ccaacctgga gggcggcccc agcgtgttca tcttccccga caacatcaag 840

gacgtgctga tgatcagcct gacccccaag gtgacctgcg tggtggtgcc cgtgagcgag 900

gacgaccccg acgccctgat cagctggttc gtgaacaacg tggaggtgca caccgcccag 960

acccagaccc acagggagga ctacaacagc accatcaggg tggtgagcac cctgcccatc 1020

cagcaccagg actggatgag cggcaaggag ttcaagtgca aggtgaacaa caaggacctg 1080

cccagcccca tcgagaggac catcagcaag atcaagggcc tggtgagggc cccccaggtg 1140

tacatcctgc cccccaccgc cgagcagctg agcaggaagg acgtgagcct gacctgcctg 1200

gtggtgggct tcaaccccgg cgacatcagc gtggagtgga ccagcaacgg ccacaccgag 1260

gagaactaca aggacaccgc ccccgtgctg gacagcgacg gcagctacaa gatctacagc 1320

aagctgaaca tgaagaccag caagtgggag aagaccgaca gcttcagctg caacgtgagg 1380

cacgagggcc tgaagaacta ctacctgaag aagaccatca gcaggagccc cggcaag 1437

<210> 9

<211> 6110

<212> DNA

<213> Artificial sequence

<221> pBudCE4.1-3A2 vector nucleotide sequence

<400> 9

gcgcgcgttg acattgatta ttgactagtt attaatagta atcaattacg gggtcattag 60

ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 120

gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc 180

caatagggac tttccattga cgtcaatggg tggactattt acggtaaact gcccacttgg 240

cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 300

ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 360

tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 420

gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 480

gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 540

tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctctggc 600

taactagaga acccactgct tactggctta tcgaaattaa tacgactcac tatagggaga 660

cccaagctat ggacaggctg accagcagct tcctgctgct gatcgtgccc gcctacgtgc 720

tgagccaggc cagcctggag accctgaagg agagcggccc cggcatcctg aagcccagca 780

ccaccctgag cctgacctgc agcttcagcg gcttcagcct gagcaccagc ggcatgggcg 840

tgagcagcat caggcagccc agcggcaagg gcctggagtg gctggcccac atctggtggg 900

acaaggtgta cctgctgctg aagagcgccc tgaccatcag caaggaccag agcaggaacc 960

aggtgtgcgg ctgcggcacc agcctggaca ccgccgacac cgccacctac tactgcgtga 1020

ggagggcctt cagctacggc accaccaggg actacttcga ctactggtgc cagggcacct 1080

tcctgaccgt gagcagcgcc aagaccaccc cccccgtggt gtaccccctg gcccccggct 1140

gcggcgacac caccggcagc agcgtgaccc tggcctgcag cgtgaagggc tacttccccg 1200

agagcgtgac cgtgacctgg aacagcggca gcctgagcag cagcgtgcac accttccccg 1260

ccctgctgca gagcggcctg tacaccatga gcagcagcgt gaccgtgccc agcagcacct 1320

ggcccagcca gaccgtgacc tgcagcgtgg cccaccccgc cagcagcacc accgtggaca 1380

agaagctgga gcccagcggc cccatcagca ccatcaaccc ctgccccccc tgcaaggagt 1440

gccacaagtg ccccgccccc aacctggagg gcggccccag cgtgttcatc ttccccgaca 1500

acatcaagga cgtgctgatg atcagcctga cccccaaggt gacctgcgtg gtggtgcccg 1560

tgagcgagga cgaccccgac gccctgatca gctggttcgt gaacaacgtg gaggtgcaca 1620

ccgcccagac ccagacccac agggaggact acaacagcac catcagggtg gtgagcaccc 1680

tgcccatcca gcaccaggac tggatgagcg gcaaggagtt caagtgcaag gtgaacaaca 1740

aggacctgcc cagccccatc gagaggacca tcagcaagat caagggcctg gtgagggccc 1800

cccaggtgta catcctgccc cccaccgccg agcagctgag caggaaggac gtgagcctga 1860

cctgcctggt ggtgggcttc aaccccggcg acatcagcgt ggagtggacc agcaacggcc 1920

acaccgagga gaactacaag gacaccgccc ccgtgctgga cagcgacggc agctacaaga 1980

tctacagcaa gctgaacatg aagaccagca agtgggagaa gaccgacagc ttcagctgca 2040

acgtgaggca cgagggcctg aagaactact acctgaagaa gaccatcagc aggagccccg 2100

gcaagggatc cgaacaaaaa ctcatctcag aagaggatct gaatatgcat accggtcatc 2160

atcaccatca ccattgagtt tgatccccgg gaattcagac atgataagat acattgatga 2220

gtttggacaa accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga 2280

tgctattgct ttatttgtaa ccattataag ctgcaataaa caagttgggg tgggcgaaga 2340

actccagcat gagatccccg cgctggagga tcatccagcc ggcgtcccgg aaaacgattc 2400

cgaagcccaa cctttcatag aaggcggcgg tggaatcgaa atctcgtagc acgtgtcagt 2460

cctgctcctc ggccacgaag tgcacgcagt tgccggccgg gtcgcgcagg gcgaactccc 2520

gcccccacgg ctgctcgccg atctcggtca tggccggccc ggaggcgtcc cggaagttcg 2580

tggacacgac ctccgaccac tcggcgtaca gctcgtccag gccgcgcacc cacacccagg 2640

ccagggtgtt gtccggcacc acctggtcct ggaccgcgct gatgaacagg gtcacgtcgt 2700

cccggaccac accggcgaag tcgtcctcca cgaagtcccg ggagaacccg agccggtcgg 2760

tccagaactc gaccgctccg gcgacgtcgc gcgcggtgag caccggaacg gcactggtca 2820

acttggccat ggtttagttc ctcaccttgt cgtattatac tatgccgata tactatgccg 2880

atgattaatt gtcaacacgt gctgatcaga tccgaaaatg gatatacaag ctcccgggag 2940

ctttttgcaa aagcctaggc ctccaaaaaa gcctcctcac tacttctgga atagctcaga 3000

ggcagaggcg gcctcggcct ctgcataaat aaaaaaaatt agtcagccat ggggcggaga 3060

atgggcggaa ctgggcggag ttaggggcgg gatgggcgga gttaggggcg ggactatggt 3120

tgctgactaa ttgagatgca tgctttgcat acttctgcct gctggggagc ctggggactt 3180

tccacacctg gttgctgact aattgagatg catgctttgc atacttctgc ctgctgggga 3240

gcctggggac tttccacacc ctcgtcgagc tagcttcgtg aggctccggt gcccgtcagt 3300

gggcagagcg cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgaa 3360

ccggtgccta gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc 3420

gcctttttcc cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc 3480

tttttcgcaa cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 3540

ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacc tggctccagt 3600

acgtgattct tgatcccgag ctggagccag gggcgggcct tgcgctttag gagccccttc 3660

gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 3720

gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa atttttgatg 3780

acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc aggatctgca 3840

cactggtatt tcggtttttg ggcccgcggc cggcgacggg gcccgtgcgt cccagcgcac 3900

atgttcggcg aggcggggcc tgcgagcgcg gccgagatcg tgatgaccca gagccccctg 3960

agcctgcccg tgagcctggg cgaccaggcc agcatcagct gcaggagcag ccagagcctg 4020

gagcacaaca acggcaacac ctacctgaac tggtaccagc agaagcccgg caaggccccc 4080

aagctgctga tctacagggc cagcagcctg cagagcggcg gcctggacag gttcagcggc 4140

agcggcagcg gcaccgactt caccctgaag atcagcaggg tggaggccga ggacctgggc 4200

gtgtacttct gcctgcaggg cacccacgtg cccttcaccg ccggcagcgc caccaagctg 4260

gagatcaaga gggccgacgc cgccaagacc gtgagcatct tccccgtggt gagcgagcag 4320

ctgaccagcg gcggcgccag cgtggtgtgc ttcctgaaca acttctaccc caaggacatc 4380

aacgtgaagt ggaagatcga cggcagcgag aggcagaacg gcgtgctgaa cagctggcag 4440

cagcaggaca gcaaggacag cacctacagc atgagcagca ccctgaccct gaccaaggac 4500

gagtgctgca ggcacaacag ctacacctgc gaggccaccc acaagaccag caccagcccc 4560

atcgtgaaga gcttctacag gaacgagtgc ggtaccagca cagtggactc gagagatctg 4620

gccggctggg cccgtttcga aggtaagcct atccctaacc ctctcctcgg tctcgattct 4680

acgcgtaccg gtcatcatca ccatcaccat tgagtttaaa cccgctgatc agcctcgact 4740

gtgccttcta gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg 4800

gaaggtgcca ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg 4860

agtaggtgtc attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg 4920

gaagacaata gcaggcatgc tggggatgcg gtgggctcta tggcttctga ggcggaaaga 4980

accagtggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 5040

agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 5100

taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 5160

cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 5220

tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 5280

gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 5340

gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 5400

tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 5460

gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 5520

cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 5580

aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 5640

tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 5700

ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgac 5760

attaacctat aaaaataggc gtatcacgag gccctttcgt ctcgcgcgtt tcggtgatga 5820

cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 5880

tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggctg 5940

gcttaactat gcggcatcag agcagattgt actgagagtg caccatatat gcggtgtgaa 6000

ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gccattcgcc attcaggctg 6060

cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc tattacgcca 6110

<210> 10

<211> 6767

<212> DNA

<213> Artificial sequence

<221> pBudCE4.1-5H7 vector nucleotide sequence

<400> 10

gcgcgcgttg acattgatta ttgactagtt attaatagta atcaattacg gggtcattag 60

ttcatagccc atatatggag ttccgcgtta cataacttac ggtaaatggc ccgcctggct 120

gaccgcccaa cgacccccgc ccattgacgt caataatgac gtatgttccc atagtaacgc 180

caatagggac tttccattga cgtcaatggg tggactattt acggtaaact gcccacttgg 240

cagtacatca agtgtatcat atgccaagta cgccccctat tgacgtcaat gacggtaaat 300

ggcccgcctg gcattatgcc cagtacatga ccttatggga ctttcctact tggcagtaca 360

tctacgtatt agtcatcgct attaccatgg tgatgcggtt ttggcagtac atcaatgggc 420

gtggatagcg gtttgactca cggggatttc caagtctcca ccccattgac gtcaatggga 480

gtttgttttg gcaccaaaat caacgggact ttccaaaatg tcgtaacaac tccgccccat 540

tgacgcaaat gggcggtagg cgtgtacggt gggaggtcta tataagcaga gctctctggc 600

taactagaga acccactgct tactggctta tcgaaattaa tacgactcac tatagggaga 660

cccaagctat ggacaggctg accagcagct tctgcggctg catcgtgccc gcctacgtgc 720

tgagccaggc cagcctggag accctgaagg agagcggccc cggcatcctg aagcccgcct 780

gcggcctgag cctgaccgag tgggagggca gcttcttcag cctgagcacc agcggcgccc 840

ccagcagcag catcaggcag cccagcggca agggcctgga gtggctggcc cacatccccc 900

ccgacaaggt gtgcggctgc aagagcgccc tgaccatcag caaggccggc agcaggaacc 960

aggtgggcgg ctgctgcacc agcctggaca ccgccgacac cgccacctgg tgctgcgtga 1020

ggagggcctt cagctacggc accaccaggg actacttcga ctactggtgc cagggcacct 1080

tcctgaccgt gagcagcgcc aagaccaccc cccccgtggt gtaccccctg gcccccggct 1140

gcggcgacac caccggcagc agcgtgaccc tggcctgcag cgtgaagggc tacttccccg 1200

agagcgtgac cgtgacctgg aacagcggca gcctgagcag cagcgtgcac accttccccg 1260

ccctgctgca gagcggcctg tacaccatga gcagcagcgt gaccgtgccc agcagcacct 1320

ggcccagcca gaccgtgacc tgcagcgtgg cccaccccgc cagcagcacc accgtggaca 1380

agaagctgga gcccagcggc cccatcagca ccatcaaccc ctgccccccc tgcaaggagt 1440

gccacaagtg ccccgccccc aacctggagg gcggccccag cgtgttcatc ttccccgaca 1500

acatcaagga cgtgctgatg atcagcctga cccccaaggt gacctgcgtg gtggtgcccg 1560

tgagcgagga cgaccccgac gccctgatca gctggttcgt gaacaacgtg gaggtgcaca 1620

ccgcccagac ccagacccac agggaggact acaacagcac catcagggtg gtgagcaccc 1680

tgcccatcca gcaccaggac tggatgagcg gcaaggagtt caagtgcaag gtgaacaaca 1740

aggacctgcc cagccccatc gagaggacca tcagcaagat caagggcctg gtgagggccc 1800

cccaggtgta catcctgccc cccaccgccg agcagctgag caggaaggac gtgagcctga 1860

cctgcctggt ggtgggcttc aaccccggcg acatcagcgt ggagtggacc agcaacggcc 1920

acaccgagga gaactacaag gacaccgccc ccgtgctgga cagcgacggc agctacaaga 1980

tctacagcaa gctgaacatg aagaccagca agtgggagaa gaccgacagc ttcagctgca 2040

acgtgaggca cgagggcctg aagaactact acctgaagaa gaccatcagc aggagccccg 2100

gcaagggatc cgaacaaaaa ctcatctcag aagaggatct gaatatgcat accggtcatc 2160

atcaccatca ccattgagtt tgatccccgg gaattcagac atgataagat acattgatga 2220

gtttggacaa accacaacta gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga 2280

tgctattgct ttatttgtaa ccattataag ctgcaataaa caagttgggg tgggcgaaga 2340

actccagcat gagatccccg cgctggagga tcatccagcc ggcgtcccgg aaaacgattc 2400

cgaagcccaa cctttcatag aaggcggcgg tggaatcgaa atctcgtagc acgtgtcagt 2460

cctgctcctc ggccacgaag tgcacgcagt tgccggccgg gtcgcgcagg gcgaactccc 2520

gcccccacgg ctgctcgccg atctcggtca tggccggccc ggaggcgtcc cggaagttcg 2580

tggacacgac ctccgaccac tcggcgtaca gctcgtccag gccgcgcacc cacacccagg 2640

ccagggtgtt gtccggcacc acctggtcct ggaccgcgct gatgaacagg gtcacgtcgt 2700

cccggaccac accggcgaag tcgtcctcca cgaagtcccg ggagaacccg agccggtcgg 2760

tccagaactc gaccgctccg gcgacgtcgc gcgcggtgag caccggaacg gcactggtca 2820

acttggccat ggtttagttc ctcaccttgt cgtattatac tatgccgata tactatgccg 2880

atgattaatt gtcaacacgt gctgatcaga tccgaaaatg gatatacaag ctcccgggag 2940

ctttttgcaa aagcctaggc ctccaaaaaa gcctcctcac tacttctgga atagctcaga 3000

ggcagaggcg gcctcggcct ctgcataaat aaaaaaaatt agtcagccat ggggcggaga 3060

atgggcggaa ctgggcggag ttaggggcgg gatgggcgga gttaggggcg ggactatggt 3120

tgctgactaa ttgagatgca tgctttgcat acttctgcct gctggggagc ctggggactt 3180

tccacacctg gttgctgact aattgagatg catgctttgc atacttctgc ctgctgggga 3240

gcctggggac tttccacacc ctcgtcgagc tagcttcgtg aggctccggt gcccgtcagt 3300

gggcagagcg cacatcgccc acagtccccg agaagttggg gggaggggtc ggcaattgaa 3360

ccggtgccta gagaaggtgg cgcggggtaa actgggaaag tgatgtcgtg tactggctcc 3420

gcctttttcc cgagggtggg ggagaaccgt atataagtgc agtagtcgcc gtgaacgttc 3480

tttttcgcaa cgggtttgcc gccagaacac aggtaagtgc cgtgtgtggt tcccgcgggc 3540

ctggcctctt tacgggttat ggcccttgcg tgccttgaat tacttccacc tggctccagt 3600

acgtgattct tgatcccgag ctggagccag gggcgggcct tgcgctttag gagccccttc 3660

gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 3720

gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa atttttgatg 3780

acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc aggatctgca 3840

cactggtatt tcggtttttg ggcccgcggc cggcgacggg gcccgtgcgt cccagcgcac 3900

atgttcggcg aggcggggcc tgcgagcgcg gccgagatcg tgatggtgca gagccccgac 3960

agcctgagcg ccagcgtggg caccagggtg acctgcatca cctgcagggc cggccagagc 4020

atcagcagct acctgaacct gtacgaccag aagcccggca aggcccccaa gctgctgatc 4080

tacgccgcct gcagcctgca gagcggcgtg cccagcagct tcagcggcag cgtggacggc 4140

accgacttcg ccctgaccat cagcagcctg cagcccgagg acttcgccac ctactactgc 4200

cagcagagct acagcttccc cgtgaccttc ggccagggca ccaaggtgga gatcaagagg 4260

gagatcaaga gggccgacgc cgccaagacc gtgagcatct tccccgtggt gagcgagcag 4320

ctgaccagcg gcggcgccag cgtggtgtgc ttcctgaaca acttctaccc caaggacatc 4380

aacgtgaagt ggaagatcga cggcagcgag aggcagaacg gcgtgctgaa cagctggcag 4440

cagcaggaca gcaaggacag cacctacagc atgagcagca ccctgaccct gaccaaggac 4500

gagtgctgca ggcacaacag ctacacctgc gaggccaccc acaagaccag caccagcccc 4560

atcgtgaaga gcttctacag gaacgagtgc gagatcgtga tggtgcagag ccccgacagc 4620

ctgagcgcca gcgtgggcac cagggtgacc tgcatcacct gcagggccgg ccagagcatc 4680

agcagctacc tgaacctgta cgaccagaag cccggcaagg cccccaagct gctgatctac 4740

gccgcctgca gcctgcagag cggcgtgccc agcagcttca gcggcagcgt ggacggcacc 4800

gacttcgccc tgaccatcag cagcctgcag cccgaggact tcgccaccta ctactgccag 4860

cagagctaca gcttccccgt gaccttcggc cagggcacca aggtggagat caagagggag 4920

atcaagaggg ccgacgccgc caagaccgtg agcatcttcc ccgtggtgag cgagcagctg 4980

accagcggcg gcgccagcgt ggtgtgcttc ctgaacaact tctaccccaa ggacatcaac 5040

gtgaagtgga agatcgacgg cagcgagagg cagaacggcg tgctgaacag ctggcagcag 5100

caggacagca aggacagcac ctacagcatg agcagcaccc tgaccctgac caaggacgag 5160

tgctgcaggc acaacagcta cacctgcgag gccacccaca agaccagcac cagccccatc 5220

gtgaagagct tctacaggaa cgagtgcggt accagcacag tggactcgag agatctggcc 5280

ggctgggccc gtttcgaagg taagcctatc cctaaccctc tcctcggtct cgattctacg 5340

cgtaccggtc atcatcacca tcaccattga gtttaaaccc gctgatcagc ctcgactgtg 5400

ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt gaccctggaa 5460

ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt 5520

aggtgtcatt ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa 5580

gacaatagca ggcatgctgg ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc 5640

agtggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 5700

aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 5760

gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 5820

gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 5880

tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 5940

ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 6000

ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 6060

tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 6120

tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 6180

ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 6240

aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 6300

ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 6360

tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgacatt 6420

aacctataaa aataggcgta tcacgaggcc ctttcgtctc gcgcgtttcg gtgatgacgg 6480

tgaaaacctc tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc 6540

cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc ggggctggct 6600

taactatgcg gcatcagagc agattgtact gagagtgcac catatatgcg gtgtgaaata 6660

ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc attcgccatt caggctgcgc 6720

aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgcca 6767

Claims (8)

1. The engineering cell strain is obtained by taking Chinese hamster ovary Cells (CHO) as host cells, transfecting expression plasmids containing HCV-cAg monoclonal antibody genes and screening; the method is characterized in that: the first engineering cell strain is named as Chinese hamster ovary cell strain CHO/3A2, which can secrete and produce hepatitis C virus core antigen antibody 3A2, and the cell strain is preserved in the China center for type culture Collection 12 months and 12 days in 2018 with the preservation numbers of: CCTCC number C2018188; the second engineering cell strain is named as Chinese hamster ovary cell strain CHO/5H7, which can secrete and produce hepatitis C virus core antigen antibody 5H7, and the cell strain is preserved in the China center for type culture Collection 12 months and 12 days in 2018 with the preservation numbers of: CCTCC NO. C2018226.

2. An eukaryotic cell exogenous gene expression system for constructing an engineering cell strain, which comprises an eukaryotic expression vector and an HCV-cAg antibody gene or a nucleic acid molecule for coding an HCV-cAg amino acid sequence or an antigen binding fragment thereof;

the method is characterized in that:

the eukaryotic expression vector selects an expression vector pBUDCE4.1-H1-L1, is named as pBUDCE4.1-3A2 and an expression vector pBUDCE4.1-H2-L2, and is named as pBUDCE4.1-5H 7; wherein the nucleotide sequence of pBudCE4.1-3A2 is shown in SEQ NO.9, and the nucleotide sequence of pBudCE4.1-5H7 is shown in SEQ NO. 10;

the HCV-cAg antibody genes are respectively nucleic acid molecules which are coded and named as monoclonal antibodies 2G7 and are also nucleic acid molecules which are coded and named as a genetically engineered antibody hepatitis C virus core antigen antibody 3A2, the nucleotide sequence of the light chain of the HCV-cAg antibody is shown as SEQ ID No.5, the nucleotide sequence of the heavy chain of the HCV-cAg antibody is shown as SEQ ID No.6, wherein the monoclonal antibodies 2G7 are generated in hybridoma cell strains of CCTCC No. C2018229; the nucleic acid molecule is coded and named as a monoclonal antibody 6A2, and is also a nucleic acid molecule coded and used for a genetically engineered antibody hepatitis C virus core antigen antibody 5H7, the nucleotide sequence of a light chain of the nucleic acid molecule is shown as SEQ ID No.7, and the nucleotide sequence of a heavy chain of the nucleic acid molecule is shown as SEQ ID number 8, wherein the monoclonal antibody 6A2 is generated in a hybridoma cell strain with CCTCC number C2018230; two hybridoma cell lines have been deposited with the China center for type culture Collection in 2018, 12 months and 12 days.

3. The use of a pair of engineered cell lines stably and efficiently expressing an antibody against hepatitis C virus core antigen according to claim 1 for preparing an antibody against hepatitis C virus core antigen.

4. Use according to claim 3, characterized in that: the formula of the special culture medium capable of obviously improving the antibody yield during the engineering cell culture is as follows: 10g/L CHO-S-SFM II dry powder culture medium, NaHCO₃2.40-2.45 g/L, 7-8 mM glutamine, 2 + -0.2 mM ferric citrate, and a final pH of 7.0-7.2; the medium was named CHO-Med-01; the material supplementing mode adopted when the engineering cells are cultured is as follows: feeding FeedA with final concentration of 7ml/L, 8ml/L, 9ml/L, 10ml/L, 9ml/L and 8ml/L respectively on days 1, 3, 5, 7, 9 or 11.

5. Use according to claim 4, characterized in that: the formula of the special culture medium capable of obviously improving the antibody yield during the engineering cell culture is as follows: 10g/L CHO-S-SFM II dry powder culture medium, NaHCO₃2.45g/L, 8mM glutamine, 2mM ferric citrate, final pH 7.1.

6. The pair of engineered cell lines of claim 1 secretly producing a pair of hepatitis c virus core antigen antibodies comprising a first engineered antibody and a second engineered antibody deposited separately; the method is characterized in that: the first genetic engineering antibody is named as hepatitis C virus core antigen antibody 3A2 and is secreted by Chinese hamster ovary cell strain CHO/3A2, the amino acid sequence of the light chain is shown as SEQ ID number 1, and the amino acid sequence of the heavy chain is shown as SEQ ID number 2; the second genetic engineering antibody is named as hepatitis C virus core antigen antibody 5H7 and is secreted by Chinese hamster ovary cell strain CHO/5H7, the amino acid sequence of the light chain is shown as SEQ ID number 3, and the amino acid sequence of the heavy chain is shown as SEQ ID number 4.

7. The hepatitis C virus core antigen antibody pair of claim 6, which is used as a pair of a coating antibody and a detection antibody in preparation of an ELISA detection reagent or a kit of HCV-cAg.

8. The use of claim 7, wherein: the coating antibody is selected from a first genetic engineering antibody 3A2, and the detection antibody is selected from a second genetic engineering antibody 5H 7; when the kit is applied, a first genetic engineering antibody 3A2 is coated on an ELISA detection plate, a second genetic engineering antibody 5H7 which is diluted by 1:4000 and is marked with HRP is added during detection, and the first genetic engineering antibody and the second genetic engineering antibody are used in a matched mode.

Images