CN109735560A

CN109735560A - A kind of carrier construction method of the selection reporter gene expression frame containing complete plant origin and application

Info

Publication number: CN109735560A
Application number: CN201910085285.6A
Authority: CN
Inventors: 陈松; 彭琦; 浦惠明; 张洁夫; 胡茂龙; 付三雄; 高建芹; 龙卫华; 陈锋; 王晓东; 张维; 周晓婴; 熊冬琴
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2019-01-29
Filing date: 2019-01-29
Publication date: 2019-05-10

Abstract

The carrier construction method of the present invention relates to a kind of selection reporter gene expression frame containing complete plant origin and application, belong to field of biotechnology.Select reporter gene expression cassette respectively by rapeseed gene group als gene promoter and the anti-ALS with double mutational sites inhibit class herbicide resistance gene-mALS₃The terminator sequence of gene and als gene is constituted.By agrobacterium-mediated transformation genetic transformation tobacco, the grand selective agent for doing regeneration strain of the green sulphur of sulfonylurea herbicide is directly utilized in the conversion process, obtains transgene tobacco.By PCR detection and antiweed identification, show that the transgene tobacco obtained by this approach has the characteristic of a variety of ALS inhibitor class herbicides such as simultaneous anti-tribenuron-methyl, double fluorine sulfonamide and bispyribac-sodium, therefore, it is considered that can be used as selection reporter gene expression frame by the expression cassette that rape als gene promoter, anti-herbicide gene and terminator sequence are constituted, which can be used for the genetic transformation of dicotyledon.

Description

A kind of carrier construction method of the selection reporter gene expression frame containing complete plant origin And application

One, technical field

The carrier construction method of the present invention relates to a kind of selection reporter gene expression frame containing complete plant origin and application, Belong to field of biotechnology.

Two, background technique

Change gene biology technology derived from the invention of the recombinant DNA technology in last century, invented heavy by American scientist in 1973 Group DNA technique, initial transgenic technology is applied to field of medicaments, such as some recombinant vaccines, interferon are transgenic product. Into the eighties, transgenic technology starts to be applied to agricultural breeding field, nineteen eighty-three U.S.'s the first genetically modified plants (tobacco and horse Bell potato) it cultivates successfully.Began from 1996, genetically modified crops include 28, the U.S., Brazil, Argentina, China, India etc. in the whole world National Business application, until 363 of existing 26 kinds of genetically modified crops (not including carnation, rose and petunia) in 2015 turn Change body be approved commercial growth or Environment release, including with antiweed and it is pest-resistant based on corn and soybean, rape and cotton Deng.From 1996~2016 years, global genetically modified crops commercial growth area increased to 1.851 hundred million hectares from 1,700,000 hectares, increased 110 times are grown, peasant income has been more than 150,000,000,000 dollars.But with the swift and violent increase of genetically modified plants type and cultivated area, The biological safety of Selectable Marker Genes in Transgenic Plants has become one of people's question of common concern.

Widely applied marker gene mainly has 2 major class in Genetic Transformation in Higher Plants at present, and one kind is that coding can make antibiosis The protease gene of element inactivation, including neomycin phosphotransferase gene (npt II) (Bevan et al.1983), hygromycin phosphorus Sour transferase gene (hpt) (Ortiz et al.1996) etc..Antibiotics marker gene is only in Genetic Transformation in Higher Plants process In work, once transgenic protocol is completed, antibiotics marker gene just loses its value.

In addition, there are many safety issues for antibiotics marker gene, it mainly include two sides of environment and food safety Face, (1) may be transferred in microorganism, so that pathogen obtains antibiotic resistance, so as to cause the anti-of current clinical use Raw element failure；(2) it may have a negative impact to the mankind and animal health.From a large amount of test data (Bennett et al.2004；Goldstein et al.2005；Ramessar et al.2007) and multiple authoritative institutions and international organization (NZ ERMA 2000；FAO/WHO 2000；OECD 2000；USA FDA 2001；CAC 2003a；EFSA 2007) publication Antibiotic marker genes are transferred to the risk of edaphon or enteric microorganism from genetically modified plants from the point of view of Risk Assessment Report Property it is very small, harm is not also generated to the health of environment or the mankind and animal, but people are also desirable to through some new skills Art means develop some new safe maker genes to further increase the safety of genetically modified plants.

One of the effective means for improving its safety in transgenic plants be exactly cultivate marker-free gene turn base Because of plant, available strategy therein is to adopt a series of measures to remove selectable marker gene after the completion of transformed plant screens. The method for rejecting genetically modified plants selectable marker gene at present mainly has 4 kinds: co-transformation method (Komari et al.1996；Lu Et al.2001), Transposon System (Cotsaftis et al.2002), site-specific recombination system (Woo et Al.2009 recombination system (Zubko et al.2000)) and in chromosome.These methods can completely eliminate the matter to marker gene It doubts, is conducive to polygenes conversion.But there is also disadvantages, the Er Qieshou such as time-consuming, heavy workload, conversion ratio are low for these methods To the limitation of plant propagation mode, it need further research and probe.

Another kind of common marker gene is the gene that coding can be such that herbicide inactivates, including phosphinothricin acetyl transferase Gene (bar, pat) (Thompson et al.1987；Wohlleben et al.1988) and 5- enol pyruvylshikimate- 3- phosphate synthase gene (epsps) (Howe et al.2002) etc..These two types of genes belong to traditional selected marker base Cause, mature technical system and wide applicability, enables transformation more successfully to carry out (Ramessar et al.2007).The selection markers that actually anti-herbicide gene is applied to plant transgene have always been considered as being a choosing well It selects, previous anti-herbicide gene is mostly from microorganism.If the EPSPS gene of antiweed glyphosate is mostly from microorganism Agrobacterium sp.CP4, and the bar gene of anti-double third ammonia phosphorus then comes from Streptomyces hygroscopius.Closely The anti-ALS inhibitor class herbicide resistance gene largely found in some plants or crop over year is plant transgene selection markers base The exploitation of cause provides new selection.

Promoter is also element indispensable in genetic engineering.Currently, cauliflower mosaic virus (CaMV) 35S promoter It is the constitutive promoter being most widely used in plant genetic engineering, widely applied composing type opens in plant genetic engineering Mover is there are also Agrobacterium kermes alkali gene no promoter etc., these promoters usually have very strong expression activity, for selecting The promoter of reporter gene but once completes conversion process, strong promoter is often in spite of Genetic Transformation in Higher Plants process is conducive to Detrimental effect is also brought along, for example causes the waste of energy.And the starting come is cloned from virus or microbial genome Subsequence is applied in plant genetic engineering, or there may be potential biological insecurity therefore to select opening for plant origin Mover is also a kind of selection for reducing GMO bio-safety risk.

The promoter of some plant origins is applied in plant genetic engineering.Naomi^[20]It is cloned from arabidopsis The promoter (PPHYB) of tryptophan synthetase subunit (PTSB1) and phytochrome 1 B gene, substitutes the composing type of CaMV35S Promoter, the activity that the two starts with gus gene amalgamation and expression, active or even high 35S respectively drive II gene expression of NPT, tool There is identical effect, it is believed that PTSB1 the and PPHYB promoter of arabidopsis is strong group of the alternative 35S promoter of plant origin Constitutive promoter.Plant actin promoter is the constitutive promoter of a high efficient expression, and actin protein gene is that plant is thin The basic component of born of the same parents' skeleton, therefore, the promoter may be all active in all organizations.Monocotyledon is often opened with composing type There are also Maize Ubiquitin gene (ubiquitin) promoters for mover.People, which continually develop, studies the base that new promoter is applied to plant Because of engineering, in order to the more efficient expression target gene in plant.Reuse same constitutive promoter driving 2 A or 2 or more exogenous gene expressions may cause gene silencing or co-suppression occurs.

Plant genetic engineering applies antibiotics resistance gene to elect reporter gene more in the prior art, such as anti-kanamycins Gene, hygromycin gene.Anti-herbicide gene also has certain applications.But the application of this gene has the advantages that 2 aspects, one It is that can be used as selection reporter gene substitute antibiotics resistant gene, in addition, assigning Genes For Plant Tolerance Herbicid resistant, it may be said that be at one stroke Two.This selection reporter gene combination also can be applied on other carriers.

Technical problem

2 or 2 or more exogenous gene expressions are driven the present invention be directed to reuse same constitutive promoter It may cause gene silencing or co-suppression problem occurs, and with Herbicide-Resistance Gene in Plant substitute antibiotics resistance base Cause develops a kind of plant expression vector of the selection reporter gene expression frame of complete plant origin.

Technical solution

A kind of plant expression vector construction method of the selection reporter gene expression frame containing complete plant origin of the present invention, It is characterized in that: using the anti-ALS inhibitor class herbicide resistance gene element of cabbage type rape genomic source, building selection report completely Accuse the expression cassette of gene.

Promoter, selection reporter gene and the terminator of the expression cassette of the selection reporter gene are respectively by rapeseed gene group Als gene promoter (SEQ.ID.NO.1), the anti-ALS with double mutational sites inhibit class herbicide resistance gene mALS₃Gene (SEQ.ID.NO.2) and the terminator sequence of als gene (SEQ.ID.NO.3) is constituted.

Method particularly includes:

(1) linearized vector: utilizing pCAMBIA0390 carrier sequence, designs special primer 0390F (SEQ.ID.NO.4) 5- ' TGGC GGGATAACCTAAGAGAAAAGAG-3 ', 0390R (SEQ.ID.NO.5)

5 '-CGTTAACACTAGTCAGATCTAC CATGG-3 ' are lacked in the process by PCR amplification linearized vector The no polyA sequence in the region original vector T-DNA is lost, only praises what biological Co., Ltd produced using promiseMax Super-Fidelity DNA Polymerase kit amplification vector sequence；Pcr amplification reaction system: 2 × Phanta Max Buffer 25 μ l, dNTPs (10mM each) 1 μ l, Plasmid DNA liquid 1 μ l (10ng), primer 0390F 2 μ l, 2 μ of primer 0390R L, Phnata Max Super-Fidenlity DNA Polymerase 1 μ l, ddH₂O18μl；Response procedures: initial denaturation: 95 DEG C 30sec recycles 35 times: 95 DEG C 15sec, and 60 DEG C of 15sec, 72 DEG C of 5min extend 72 DEG C of 5min.Agarose gel electrophoresis inspection Amplified production, the PCR product of glue recovery purifying 6.4Kb are used for carrier recombining reaction；

(2) containing the anti-herbicide gene mALS in double mutational sites₃Clone: with application No. is 201710166233.2 hairs The rape that bright patent " obtain rape based on external rite-directed mutagenesis and resist a variety of ALS inhibitor class herbicide resistance genes and application " obtains is anti- Herbicide resistance gene peasy-mALS₃For template, specificity amplification primer is designed, and is increased in 5 ' ends of upstream primer homologous Recombination sequence, i.e. lowerization line part indicate increased base sequence, the same below, with 3 ' terminal homologous of promoter sequence.Primer pair Sequence is respectively ALSF (SEQ.ID.NO.6) 5 '-CTCTCTCCTCTAACCA TG GCGGCGGC AA CATCGTCTTCTC-3’ With ALSR (SEQ.ID.NO.7) 5'-TCAGTACTTAGTGC GACCAT CC-3'；It is limited using Beijing Quan Shijin biotechnology The high-fidelity DNA polymerase kit that company produces expands mALS₃Gene order；Amplification system: 5 × Trans Start FastPfu Buffer10 μ l, Plasmid DNA 1 μ l, 10 μM of ALSF 1 μ l, 10 μM of 1 μ l, 2.5mM dNTPs of ALSR, 5 μ l, 1 μ l of Trans Start FastPfu archaeal dna polymerase, supplies ddH₂O to 50 μ l；Response procedures: initial denaturation: 95 DEG C of 2min；It follows Circle amplification 35 times: 95 DEG C 15sec, 58 DEG C of 35sec, 72 DEG C of 1.5min extend 72 DEG C of 5min.Agarose gel electrophoresis inspection amplification Primer size about 1.95kb, the PCR product of glue recovery purifying 1.9Kb are used for carrier recombining reaction；

(3) rape als gene promoter sequence is cloned: with number of patent application: 201710701957.2 patent of invention is " sweet The rape als gene promoter sequence that blue type rape als gene promoter and application " obtains is stencil design specific primer, And it is introduced in 5 ' ends of upstream primer and is respectively as follows: PrF with the homologous base sequence of linearized vector left distal end, primer

(SEQ.ID.NO.8)5’-TGACTAGTGTTAACGGTGGAGCTGATCT TACCGACC GAAC-3 ' and PrR

(SEQ.ID.NO.9) 5 '-GGTTAGAGGAGAGAGAGATGATGAA-3 ' have using Beijing Quan Shijin biotechnology The high-fidelity DNA polymerase kit that limit company produces expands als gene promoter sequence: amplification system: 5 × Trans Start FastPfu Buffer10 μ l, genomic DNA (cabbage type rape) 1 μ l, 10 μM of ALSF 1 μ l, 10 μM of 1 μ of ALSR 5 μ l, Trans Start FastPfu archaeal dna polymerase of l, 2.5mM dNTPs, 1 μ l, supplies ddH₂O to 50 μ l；Response procedures: Initial denaturation: 95 DEG C of 3min；Cyclic amplification 35 times: 95 DEG C 30sec, 58 DEG C of 35sec, 72 DEG C of 1min extend 72 DEG C of 5min.Agarose Gel electrophoresis checks amplified production, and the PCR product of glue recovery purifying 1Kb is used for carrier recombining reaction；

(4) rape als gene terminator sequence is cloned: design primer sequence is respectively as follows: AEF (SEQ.ID.NO.10):

5’-ATGGTCGCACTAAGTACTGAGAGATGAA GCTGG TGATCGATCATA-3 ' and 390ER (SEQ.ID.NO.11)

5’-TCTCTTAGGTTTACCCGCCATTATTGACACATACACAAA GTGTGA-3 ', using the full Shi Jinsheng in Beijing The high-fidelity DNA polymerase kit amplification als gene terminator sequence that object Technology Co., Ltd. produces: amplification system: 5 × Trans Start FastPfu Buffer10 μ l, genomic DNA 1 μ l, 10 μM of ALSF 1 μ l, 10 μM of ALSR 1 μ l, 2.5mM 5 μ l, Trans StartFastPfuDNA polymerase of dNTPs, 1 μ l, supplies ddH₂O to 50 μ l；Response procedures: initial denaturation: 95 DEG C 3min, cyclic amplification 35 times: 95 DEG C 30sec, 55 DEG C of 35sec, 72 DEG C of 45sec extend 72 DEG C of 5min, agarose gel electrophoresis inspection Amplified production is looked into, the PCR product of glue recovery purifying 500bp is used for carrier recombining reaction；

(5) it recombination method plant expression vector construction: is tried using the recombinant clone that Nuo Weizan Bioisystech Co., Ltd produces Agent boxAbove-mentioned (1), (2), (3) and (4) PCR product that respectively step obtains is passed through recombinase reaction structure by Multis Destination carrier is built, reaction system is as follows: 5 × CE Multis buffer 4 μ l, mALS₃2 μ l, ALS promoter PCR of PCR product Product 2 μ l, ALS terminate PCR product 2 μ l, Exnase^TM2 μ l, linearized vector 4 μ l, ddH₂2 μ l of O, reacts at 37 DEG C 30min, after take 5-10 μ l reaction solution by heat shock method transformed competence colibacillus bacillus coli DH 5 alpha, cultivated in LB containing kanamycin On base, 37 DEG C of overnight incubations, picked clones carry out PCR identification, then picking PCR positive colony continues Liquid Culture, extracts plasmid, Digestion identification is carried out with HindIII restriction enzyme, carrier contains als gene sequence after recombination, and positive colony is further After sequencing determines, it is the selection reporter gene table containing complete plant origin that thus obtained plasmid, which is named as p0390-PdmAP, Up to the carrier of frame；And destination carrier p0390-PdmAP is transferred to Agrobacterium EHA105 by electric shocking method, it will be positive after PCR identification It is saved backup after clone's culture in -80 DEG C.

The plant expression vector p0390- of the selection reporter gene expression frame containing complete plant origin of the method building PdmAP can be applied in terms of the genetic transformation of dicotyledon.

Beneficial effect

Mentality of designing of the present invention is the anti-herbicide gene in proposed adoption rape source, including downstream sequence constructs one thereon Completely by the selection reporter gene expression frame of plant origin, in plant gene expression vector.Therefore cabbage type rape is selected The anti-ALS inhibitor class herbicide resistance gene element of genomic source, the expression cassette of building selection reporter gene.

The promoter of the expression cassette, selection reporter gene and terminator are respectively by the rapeseed gene that this research department is cloned into Group als gene promoter (application number of invention patent: 201710701957.2, cabbage type rape als gene promoter and application), With the anti-ALS inhibition class herbicide resistance gene-mALS with double mutational sites₃(gene is in Atrazine resistant Brassica napus M342 to gene ALS₃A new mutational site is introduced in gene order, which is located at ALS₃The 560th of gene, is originally C base, 187 alanine are encoded, then becomes valine at 187 after the mutated base at T, is detailed in patent: application number: 201710166233.2 " based on external rite-directed mutagenesis obtain rape resist a variety of ALS inhibitor class herbicide resistance genes and application "), with And the terminator sequence of als gene is constituted.

Using rape anti-herbicide gene, alternatively reporter gene constructs a plant expression vector, the load to the present invention Body all is from the expression cassette of rapeseed gene group sequence in the region T-DNA containing one, and that includes the als genes of rape to open Mover and the simultaneous als gene and ALS terminator sequence for resisting a variety of ALS inhibitor class herbicides with double mutational sites, this table Genetic elements without any non-plant object source in up to frame.

Present invention application chlorsulfuron does selective agent, passes through agrobacterium-mediated transformation genetic transformation tobacco leaf explant Body successfully obtains transgene tobacco, identifies by Herbicid resistant, turns rape anti-herbicide gene tobacco as the result is shown with simultaneous The characteristic of a variety of ALS inhibitor class herbicides such as anti-tribenuron-methyl, double fluorine sulfonamide and bispyribac-sodium shows the selection that the present invention constructs The expression of reporter gene expression frame energy normal driving functional gene.

The present invention is by transgene tobacco experiments have shown that can be realized plant using the plant expression vector that this method constructs The genetic transformation of gene, in the genetic engineering that other dicotyledonous crops can be further applied.

Detailed description of the invention

Fig. 1 destination carrier constructs schematic diagram

Fig. 2 is PCR amplification carrier pCAMBIA0390 gel electrophoresis figure, and left column is DNA molecular amount 2K plus marker, Size is according to this are as follows: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 300bp, 100bp, right column are linearisation Carrier, size about 6800bp.

Fig. 3 is the gel electrophoresis figure for the mALS3 gene that PCR amplification rite-directed mutagenesis obtains, and left column is DNA molecular amount 2K Plus marker, size is according to this are as follows: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 300bp, 100bp, it is right Column is PCR product, size about 1.95kb.

Fig. 4 .PCR expands the gel electrophoresis figure of rape ALS3 gene promoter, and left column is DNA molecular amount 2K plus Marker, size is according to this are as follows: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 300bp, 100bp, right column are PCR product, size about 1kb.

Fig. 5 .PCR expands the gel electrophoresis figure of rape ALS3 gene terminator, and left column is DNA molecular amount 2K plus Marker, size is according to this are as follows: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 300bp, 100bp, right column are PCR product, size about 500kb.

Carrier is through restriction enzyme HindIII restriction enzyme mapping after Fig. 6 recombination.A left side 1 is DNA molecular amount 2K plus Marker, size is according to this are as follows: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 300bp, 100bp, a left side 2 are matter Grain DNA, a left side 3 are Hind III digestion map.

Under Fig. 7, difference CHL screening concentration, tobacco leaf explant callus or adventitious bud inducing situation

Fig. 8, handled through Agrobacterium-mediated Transformation, on 20nm CLS bud inducement cultivation base the green calli of Fiber differentiation and Adventitious bud；

Fig. 9, the adventitious bud culture of rootage on root media.

The transgene tobacco that Figure 10, potting survive

Figure 11, transgene tobacco regeneration plant PCR qualification result.M be DNA molecular amount 2K plus marker, size according to It is secondary are as follows: 5000bp, 3000bp, 2000bp, 1000bp, 750bp, 500bp, 300bp, 100bp, 1-6 are respectively transgene tobacco, 7 be Plasmid DNA positive control, and 8 be non-transgenic tobacco negative control.

In Figure 12, T0 generation, spray the grand herbicide performance of stupid sulphur, and it is simultaneously dead that control shows growth retardation.

Figure 13, T1 are showed after spraying tribenuron-methyl for transgene tobacco seedling, and control growth is obviously inhibited；

Figure 14, T1 are showed after spraying bispyribac-sodium for transgene tobacco seedling, and control growth is obviously inhibited；

Figure 15, T1 spray the performance after double fluorine sulfonamide for transgene tobacco

Embodiment

Mentality of designing of the present invention is proposed adoption completely by the anti-herbicide gene of plant origin, including downstream sequence structure thereon A reporter gene expression frame is built, in plant gene expression vector.Therefore the anti-of cabbage type rape genomic source is selected ALS inhibitor class herbicide resistance gene element, the expression cassette of building selection reporter gene.

It is directly grand using the green sulphur of sulfonylurea herbicide in the conversion process by agrobacterium-mediated transformation genetic transformation tobacco The selective agent of regeneration strain is done, transgene tobacco is obtained.By PCR detection and antiweed identification, show through this approach The transgene tobacco of acquisition has the spy of a variety of ALS inhibitor class herbicides such as simultaneous anti-tribenuron-methyl, double fluorine sulfonamide and bispyribac-sodium Property, it is therefore believed that can be used by the expression cassette that rape als gene promoter, anti-herbicide gene and terminator sequence are constituted Selection reporter gene expression frame is made, which can be used for the genetic transformation of dicotyledon.

1. transgene carrier constructs:

1.1 vector construction gene sources explanation and line map:

Initial vector is pCAMBIA0390 (Australian CAMBIA company).Promoter is cabbage type rape als gene Promoter sequence, having already passed through experiment confirms there is composition type expression promoter activity, is detailed in patent of invention " cabbage type rape Als gene promoter and application " (application number of invention patent: 201710701957.2).Anti-herbicide gene is anti-from rape Herbicide strain M342, but that passes through that external rite-directed mutagenesis obtains has double mutational sites, simultaneous a variety of ALS inhibitor classes is resisted to remove The characteristics of careless agent.Be detailed in patent of invention " based on external rite-directed mutagenesis obtain rape resist a variety of ALS inhibitor class herbicide resistance genes and Using " (application No. is: 201710166233.2).Terminator sequence derives from cabbage type rape als gene, passes through PCR amplification It obtains.Carrier is constructed by recombinant clone technology, as shown in Figure 1.

1.2 linearized vectors: utilizing pCAMBIA0390 carrier sequence, designs special primer 0390F 5- ' TGGC 5 '-CGTTAACACTAGTCAGATCT AC CATGG-3 ' of GGGATAA CCTA AGAG AAAAGAG-3 ', 0390R.Pass through PCR amplification linearized vector misses out the no polyA sequence in the region original vector T-DNA in the process.It is only praised using promise What biological Co., Ltd producedMax Super-Fidelity DNA Polymerase kit amplification vector sequence. Pcr amplification reaction system: 2 × Phanta Max Buffer 25 μ l, dNTPs (10mM each) 1 μ l, 1 μ l of Plasmid DNA liquid (10ng), 2 μ l, Phnata Max Super-Fidenlity DNA Polymerase of primer 0390F 2 μ l, primer 0390R 1 μ l, ddH₂O18μl.Response procedures: initial denaturation: 95 DEG C of 30sec, recycle 35 times: 95 DEG C 15sec, 60 DEG C of 15sec, 72 DEG C 5min extends 72 DEG C of 5min.Agarose gel electrophoresis checks amplified production, as shown in Fig. 2, the PCR of glue recovery purifying 6.4Kb is produced Object.For carrier recombining reaction.

The 1.3 anti-herbicide gene mALS containing double mutational sites₃Clone: with patent of invention " be based on external rite-directed mutagenesis Obtain rape and resist a variety of ALS inhibitor class herbicide resistance genes and application " (application No. is: the 201710166233.2) rape obtained Anti-herbicide gene peasy-mALS₃For template, specificity amplification primer is designed, and is increased together in 5 ' ends of upstream primer Source recombination sequence (lowerization line part indicates increased base sequence, the same below), with 3 ' terminal homologous of promoter sequence.Primer pair Sequence is respectively ALSF 5 '-CTCTCTCCTCTAACCA TG GCGGCGGCAACATCGTCTTCTC-3 ' and ALSR 5'- TCAGTACTTAGTGC GACCAT CC-3'.The high-fidelity DNA polymerization produced using Beijing Quanshijin Biotechnology Co., Ltd Enzyme reagent kit expands mALS₃Gene order；Amplification system: 5 × Trans Start FastPfu Buffer10 μ l, Plasmid DNA 1 μ l, 10 μM of 1 μ l of ALSF, 10 μM of 1 μ l, 2.5mM dNTPs of ALSR, 5 μ l, Trans Start FastPfu archaeal dna polymerases 1 μ l, supplies ddH₂O to 50 μ l；Response procedures: initial denaturation: 95 DEG C of 2min；Cyclic amplification 35 times: 95 DEG C 15sec, 58 DEG C of 35sec, 72 DEG C of 1.5min extend 72 DEG C of 5min.Agarose gel electrophoresis checks amplified production size about 1.95kb.As shown in Figure 3.Glue returns Receive the PCR product of purifying 1.9Kb.For carrier recombining reaction.

Antiweed als gene sequence (SEQ.ID.NO.2)

ATGGCGGCGGCAACATCGTCTTCTCCGATCTCCTTAACCGCTAAACCTTCTTCCAAATCCCCTCTACCC ATTTCCAGATTCTCCCTTCCCTTCTCCTTAACCCCACAGAAACCCTCCTCCCGTCTCCACCGTCCACTCGCCATCTC CGCCGTTCTCAACTCACCCGTCAATGTCGCACCTGAAAAAACCGACAAGATCAAGACTTTCATCTCCCGCTACGCTC CCGACGAGCCCCGCAAGGGTGCTGATATCCTCGTGGAAGCCCTCGAGCGTCAAGGCGTCGAAACCGTCTTCGCTTAT CCCGGAGGTGCCTCCATGGAGATCCACCAAGCCTTGACTCGCTCCTCCACCATCCGTAACGTCCTCCCCCGTCACGA ACAAGGAGGAGTCTTCGCCGCCGAGGGTTACGCTCGTTCCTCCGGCAAGCCGGGAATCTGCATAGCCACTTCGGGTC CCGGAGCTACCAACCTCGTCAGCGGGTTAGCCGACGCGATGCTTGACAGTGTTCCTCTCGTCGCCATCACAGGACAG GTCCCTCGCCGGATGATCGGTACTGACGTGTTCCAAGAGACGCCAATCGTTGAGGTAACGAGGTCTATTACGAAACA TAACTATCTGGTGATGGATGTTGATGACATACCTAGGATCGTTCAAGAAGCATTCTTTCTAGCTACTTCCGGTAGAC CCGGACCGGTTTTGGTTGATGTTCCTAAGGATATTCAGCAGCAGCTTGCGATTCCTAACTGGGATCAACCTATGCGC TTGCCTGGCTACATGTCTAGGCTGCCTCAGCCGCCGGAAGTTTCTCAGTTAGGCCAGATCGTTAGGTTGATCTCGGA GTCTAAGAGGCCTGTTTTGTACGTTGGTGGTGGAAGCTTGAACTCGAGTGAAGAACTGGGGAGATTTGTCGAGCTTA CTGGGATCCCTGTTGCGAGTACGTTGATGGGGCTTGGCTCTTATCCTTGTAACGATGAGTTGTCCCTGCAGATGCTT GGCATGCACGGGACTGTGTATGCTAACTACGCTGTGGAGCATAGTGATTTGTTGCTGGCGTTTGGTGTTAGGTTTGA TGACCGTGTCACGGGAAAGCTCGAGGCGTTTGCGAGCAGGGCTAAGATTGTGCACATAGACATTGATTCTGCTGAGA TTGGGAAGAATAAGACACCTCACGTGTCTGTGTGTGGTGATGTAAAGCTGGCTTTGCAAGGGATGAACAAGGTTCTT GAGAACCGGGCGGAGGAGCTCAAGCTTGATTTCGGTGTTTGGAGGAGTGAGTTGAGCGAGCAGAAACAGAAGTTCCC GTTGAGCTTCAAAACGTTTGGAGAAGCCATTCCTCCGCAGTACGCGATTCAGGTCCTAGACGAGCTAACCCAAGGGA AGGCAATTATCAGTACTGGTGTTGGACAGCATCAGATGTGGGCGGCGCAGTTTTACAAGTACAGGAAGCCGAGGCAG TGGCTGTCGTCCTCAGGACTCGGAGCTATGGGTTTCGGACTTCCTGCTGCGATTGGAGCGTCTGTGGCGAACCCTGA TGCGATTGTTGTGGACATTGACGGTGATGGAAGCTTCATAATGAACGTTCAAGAGCTGGCCACAATCCGTGTAGAGA ATCTTCCTGTGAAGATACTCTTGTTAAACAACCAGCATCTTGGGATGGTCATGCAATTGGAAGATCGGTTCTACAAA GCTAACAGAGCTCACACTTATCTCGGGGACCCGGCAAGGGAGAACGAGATCTTCCCTAACATGCTGCAGTTTGCAGG AGCTTGCGGGATTCCAGCTGCGAGAGTGACGAAGAAAGAAGAACTCCGAGAAGCTATTCAGACAATGCTGGATACAC CTGGACCGTACCTGTTGGATGTCATCTGTCCGCACCAAGAACATGTGTTACCGATGATCCCAAGTGGTGGCACTTTC AAAGATGTAATAACCGAAGGGGATGGTCGCACTAAGTACTGA

1.4 rape als gene promoter sequences clone: it " cabbage type rape als gene promoter and is answered with patent of invention With " (application number of invention patent: 201710701957.2) rape als gene promoter sequence for obtaining is that stencil design is special Property primer, and 5 ' ends of upstream primer introduce with the homologous base sequence of linearized vector left distal end, primer is respectively as follows: PrF

5’-TGACTAGTGTTAACGGTGGAGCTGATCT TACCGACC GAAC-3 ' and

PrR5'-GGTTAGAGGAGAGAGAGATGATGAA-3'.It produces using Beijing Quanshijin Biotechnology Co., Ltd High-fidelity DNA polymerase kit expand als gene promoter sequence: amplification system: 5 × Trans Start FastPfu Buffer10 μ l, genomic DNA 1 μ l, 10 μM of ALSF 1 μ l, 10 μM of 1 μ l, 2.5mM dNTPs of ALSR, 5 μ l, Trans Start 1 μ l of FastPfu archaeal dna polymerase, supplies ddH₂O to 50 μ l；Response procedures: initial denaturation: 95 DEG C of 3min；Cyclic amplification 35 times: 95 DEG C 30sec, 58 DEG C of 35sec, 72 DEG C of 1min extend 72 DEG C of 5min.Agarose gel electrophoresis checks amplified production, glue recovery purifying The PCR product of 1Kb, as shown in Figure 4.For carrier recombining reaction.

Rape als gene promoter sequence (SEQ.ID.NO.1)

GTGGAGCTGATCTTACCGACCGAACCTCTTCGCCATCTCCTGAGATTTTTAGAAAATGGAAAGAAGGGA AGCAAAAGAGAATAATCATGGATTTGAATAACTGGAAACAATAAAGTAATAAAAGATTCAAGGAATCGCTTAATCAG AAATCAAAGTGTAAAAAAAAATTAGAAACCATAAAGTAATAATAGGAAATCTCCAATTAATTTGCCAAGACATATCA CCTGCGATGTATTCATACACATTCCGAGTGATAGAGAAGGAACCGTTTCCGTTGATAGAAGAGAAGGCAAAACGTCA AGATTGATGATCTACAAAGGAAATCATCACGTGAATTGAAAATCTCGAAGTTCCATAGCTGGTTACAGAGATCGAAG GAGAAGCCTTTTCGATTCAGTGTGGAAGAAGAACAGGAACTCTAAAGTTTGTGCTTTGGTCTTGCTGGCCAAACTCA GAGCCCAACGTAATAACCAACGGAAGCCCATCAACATTTGCGTTTAATGAAACCATGAGTTTCGTTCCTGAATGACA TGTGTCAGCACGGGGGAAATCCACTTATCTATATAAAGTTTCACGCTCAAGTTGAACGACTTAGTAACATGGAAGCT GAGGTAGATAGTCTAAGAGTGAAGAAAATTCTTCTTTATAATAATAGATATTGTAGCCTAAACGTTCTTAGTGCACA TTTTTAAATGCAAATATATTACGGATTTGGTCCTAATTTCTGTAAAATAAAACTACTTCATTGTTTTATATAAATAA CTCTATTGCTGCAGTTTCCCAACTTTGTTGCTTAGATTCAGGTCTCACAATCAAGAAATCAAGAACAGTTAGATCCA CAAATTCTACATTTTATTTAATAAGTGAAGTGACAAAAAACGAGATTAGATTCGTTTCTATTCATCCATAATTAATA AAAAAAAAAGACCAAACAAACAAAAATCATATTCCAAGGGTATTTTCGTAAACAAACAAAACCCTCACAAGTCTCGT TTTATAAAACGATTCACGTTCACAAACTCATTCATCATCTCTCTCTCCTCTAACC

1.5 rape als gene terminator sequences clone: according to rape ALS3 gene order, sequence is carried out on the website NCBI Column compare analysis, find the rape als gene sequence of very high homology, obtain corresponding gene number.Using this gene number into The retrieval of row gene, finds corresponding gene order, and the base sequence of 518bp is extracted outside 3 ' end of gene order code area, and (http://molbiol-tools.ca/Promoters.htm) is pre- to sequence progress gene regulatory elements using software online It surveys, which has polyA signal at 158 bases.Using this sequence as terminator.And specific primer is designed accordingly, wherein Upstream primer increases by the base sequence of 18 with 3 ' terminal homologous of mALS3 gene in 5 ' ends, and downstream primer increases in 5 ' ends Add 18 base sequences homologous with linearized vector right end, will pass through recombination method carrier construction.Primer sequence point Not are as follows: AEF:

5’-ATGGTCGCACTAAGTACTGAGAGATGAA GCTGG TGATCGATCATA-3 ' and 390ER

5’-TCTCTTAGGTTTACCCGCCATTATTGACACATACACAAA GTGTGA-3'.Using the full Shi Jinsheng in Beijing The high-fidelity DNA polymerase kit amplification als gene terminator sequence that object Technology Co., Ltd. produces: amplification system: 5 × Trans Start FastPfu Buffer10 μ l, genomic DNA 1 μ l, 10 μM of ALSF 1 μ l, 10 μM of ALSR 1 μ l, 2.5mM 5 μ l, Trans Start FastPfu archaeal dna polymerase of dNTPs, 1 μ l, supplies ddH₂O to 50 μ l；Response procedures: initial denaturation: 95 DEG C 3min, cyclic amplification 35 times: 95 DEG C 30sec, 55 DEG C of 35sec, 72 DEG C of 45sec extend 72 DEG C of 5min.Agarose gel electrophoresis Check amplified production, the PCR product of glue recovery purifying 500bp or so.For carrier recombining reaction.

Rape als gene terminator sequence (SEQ.ID.NO.3), overall length 518bp:

GAGATGAAGCTGGTGATCGATCATATGGTAAAAGACTTAGTTTCAGTTTCCAGTTTCTTTTGTGTGGTA ATTTGGGTTTGTCAGTTGTTGTACTACTTTTGGTTGTTCCCAGACGTACTCGCTGTTGTTGTTTTGTTTCCTTTTTC TTTTATATATAAATAAACTGCTTGGGTTTTTTTTCATATGTTTGGGACTCAATGCAAGGAATGCTACTAGACTGCGA TTATCTACTAATCTTGCTAGGAAATGGCACTTTACATTGGGTGTGATTGTCATATTTTCAGTTTTTTAGCTACGAGA ACGATGAAAGTTCAGATTTCACACACTATATATATGTTTGATCGATGTTGTATGCTCTTAAACATTTCTATCTTTCC TTTTCTCATATTATCCATCACACTCTTTAATATGATGTAAATTGCTTCTTCTCTAAGCTACACCAGTCGTAAGCAAC ATACGAAGAAGCTTTTTGAAAACATCTTTTATTCTCTCATCACACTTTGTGTATGTGTCAATAA

1.6 recombination method plant expression vector constructions: it is tried using the recombinant clone that Nuo Weizan Bioisystech Co., Ltd produces Agent boxThe PCR product that respectively step obtains of above-mentioned 1.2,1.3,1.4 and 1.5 is passed through recombinase reaction structure by Multis Build destination carrier.Reaction system is as follows: 5 × CE Multis buffer 4 μ l, mALS₃2 μ l, ALS promoter PCR of PCR product Product 2 μ l, ALS terminate PCR product 2 μ l, Exnase^TM2 μ l, linearized vector 4 μ l, ddH₂2 μ l of O, reacts at 37 DEG C 30min, after take 5-10 μ l reaction solution pass through heat shock method transformed competence colibacillus bacillus coli DH 5 alpha.It is cultivated in LB containing kanamycin On base, 37 DEG C of overnight incubations.Picked clones carry out PCR identification, then picking PCR positive colony continues Liquid Culture, extracts plasmid, Digestion identification is carried out with HindIII restriction enzyme.Carrier contains als gene sequence after recombination, wherein there is HindIII digestion Site can produce multiple segments (see Fig. 6).Positive colony be further sequenced determine after, thus obtained plasmid name for p0390-PdmAP；And destination carrier p0390-PdmAP is transferred to Agrobacterium EHA105 by electric shocking method.It will be positive after PCR identification It is saved backup after clone's culture in -80 DEG C.

2. the genetic transformation of tobacco

2.1. tobacco Aseptic seedling culture: transgenic acceptor system Ben's tobacco (Nicotiana benthamiana).It takes Tobacco seed is a little, on superclean bench, after carrying out surface sterilization within 10 minutes with " 84 " medicining liquid dipping, then it is clear with sterile water It washes 6-8 times.Sowing is containing 1/2MS culture medium, in the solid culture bottle of 1% agar, is placed in 25 DEG C of temperature, illumination 16h, dark It is cultivated under the conditions of 8h.

2.2. tissue culture selective agent concentration selects: present invention application chlorsulfuron (CLS) regenerates for transgene tobacco to be trained Feeding selective agent is equipped with the bud induction containing 0,2,4,8,10,20nm various concentration CLS for the suitable screening concentration of determination Culture medium determines minimum screening concentration.It is found by experiment, with the increasing of CLS concentration, tobacco leaf explant green callus Tissue and adventitious bud induction frequency gradually decrease, and when its concentration reaches 4nm, the inductivity of explant adventitious bud is close to zero.But It is, it has been found that with the extension of explant subculture interval time, adventitious bud induction frequency can be in increased trend, this may be culture Because of the extension of time, CLS's CLS can degrade in base, to lose the activity for inhibiting plant cell growth.Given this, this hair The clear and decided concentration that CLS is improved in bud inducement cultivation base that is scheduled on is to 20nm, to keep higher screening pressure, and it is feeding continuing to be commissioned to train When then suitably reduce screening concentration to 10nm.Lower group picture is the tobacco leaf disc explant adventitious bud inducing under the screening concentration of part Performance.

2.3. Agrobacterium prepares: in plating trans Agrobacterium EHA105 on LB culture medium containing kanamycin, in 28 DEG C After insulating box culture 48-72 hours, monoclonal is chosen, continues culture 24 hours in 5ml LB liquid medium, then take 1ml bacterium solution Amplify overnight incubation in 50ml LB liquid medium, collect bacterium solution, supernatant is abandoned in 6000rpm centrifugation, with the MS for containing 3% sucrose Solution suspension Agrobacterium makes its OD600nm value about in 0.3-0.5 or so.

2.4. seedling age about 40-60 days or so tobacco aseptic seedlings, sterile item the tobacco genetic transformation of mediated by agriculture bacillus: are chosen Tobacco leaf is taken with scalpel under part, the blade of size about 0.8cm square is explant, puts into the Agrobacterium bacterium solution being ready for In, oscillation infect 2 minutes after, the raffinate for being attached to blade surface is blotted in taking-up with filter paper, be then placed on containing co-culture base (1 × MS, sucrose 3%, agar powder 1%, pH 5.8) culture dish in, the temperature under the conditions of 25 DEG C, be protected from light co-cultivation 48 hours.

2.5. bud inducement cultivation base (1 × MS, sucrose 3%, BA the induction and regeneration of transgene tobacco adventitious bud: are gone to 2.0mg/L, IAA 0.5mg/L, carbenicillin 500mg/L, 20CLS, agar powder 1%, pH 5.8) on carry out bud on culture medium Fiber differentiation, primary every 2-3 weeks subculture, culture medium is the same as bud inducement cultivation base when subculture.

2.5 root induction cultures: after grow adventitious bud in resistant buds induced medium after squamous subculture for several times, When adventitious bud, organic centre is built up, and when length is greater than 2.5cm or so, can cut adventitious bud in taking root on root media Culture.Root media (1 × MS, sucrose 3%, IAA 0.5mg/L, carbenicillin 500mg/L, 20-50nm CLS, agar Powder 1%, pH 5.8) on root induction, this process along with bud growth and take root, see Fig. 9.Condition of culture: 25 DEG C of temperature, light According to the illumination of 16 hours periods, 8 hours dark.This process was for about 4-6 weeks or so.Transgene tobacco is containing higher concentration It is grown on the culture medium of herbicide, normally can take root and grow up；And it false positive Miao Ze growth retardation or cannot take root.

2.6. it takes root the potting and herbicide preliminary screening of regrowth: having given birth to the indefinite of root for what is acquired in 2.5 steps Bud is transplanted in the basin alms bowl for filling the nutrient matrix that aseptic process is crossed.The agar block being gently caught broken around root with tweezers, uses flowing water Seedling root is rinsed, the agar of root is eliminated as much as.Then seedling is planted in basin alms bowl.It is watered with water, and with transparent plastic cup Seedling is covered, until seedling living.It, therefore, can be with because transgene tobacco has the function of resisting a variety of ALS inhibitor class herbicides Preliminary screening identification is carried out for plant to T0 with certain density herbicide.This test is 30 μ using concentration for Potted orchard in T0 G/ml herbicide tribenuron-methyl transgene tobacco is identified.Qualification result is shown in Figure 10.Transgene tobacco shows tribenuron-methyl Strong resistance, control then grow suppressed and dead.

2.7. the PCR identification of transgene tobacco seedling:

It takes the blade of antiweed transgenic tobacco plant to extract genomic DNA with CTAB method, carries out PCR and identify PCR Identification.Specific primer sequence is: JDF5 (SEQ.ID.NO.12) '-CTTAACCGCTAAACCTTC-3 ' and JDR5 (SEQ.ID.NO.13) '-AATAGACCTCGTTACCTCAA-3 ', the expected size of amplified production is 568bp.The amplification system of PCR It is: 2 × PCR Mix 10 μ l, each 1l of primer JDF and JDR, 7 μ l of deionized water, 1 μ l of DNA profiling.Temperature program(me): 95 DEG C, 3min, 95 DEG C, 30sec, 58 DEG C, 30sec, 72 DEG C of 35sec, after 35 recycle, 72 DEG C, 5min.The inspection of 1% agarose gel electrophoresis Amplified production is looked into, as shown in figure 11, transgene tobacco can amplify a specific band between 750bp and 500bp, and Non-transgenic tobacco is then without a characteristic bands.

3. the identification that transgenic tobacco plant resists a variety of ALS inhibitor class herbicides: transgene tobacco T0 is received for plant The seed received is seeded in small basin alms bowl, when growing 3-4 piece true leaf, uses tribenuron-methyl (sulfonylurea), double fluorine sulfonamide respectively (triazolopyrimidine class) and bispyribac-sodium (pyrimidine bigcatkin willow acids) spray.Herbicide is respectively as follows: 30 μ g/ml, 4.5 using concentration μg/ml,10μg/ml.It is compared with non-transgenic tobacco seedling.As the result is shown: transgenosis tissue-cultured seedling mostly shows very strong anti- Herbicide resistance shows to grow normal；And the growth compareed is obviously inhibited, and tends to be dead.

4. full text brief summary:

Sequence table

<110>Jiangsu Province Agriculture Science Institute

<120>a kind of carrier construction method of selection reporter gene expression frame containing complete plant origin and application

<141> 2019-01-29

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1048

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 1

gtggagctga tcttaccgac cgaacctctt cgccatctcc tgagattttt agaaaatgga 60

aagaagggaa gcaaaagaga ataatcatgg atttgaataa ctggaaacaa taaagtaata 120

aaagattcaa ggaatcgctt aatcagaaat caaagtgtaa aaaaaaatta gaaaccataa 180

agtaataata ggaaatctcc aattaatttg ccaagacata tcacctgcga tgtattcata 240

cacattccga gtgatagaga aggaaccgtt tccgttgata gaagagaagg caaaacgtca 300

agattgatga tctacaaagg aaatcatcac gtgaattgaa aatctcgaag ttccatagct 360

ggttacagag atcgaaggag aagccttttc gattcagtgt ggaagaagaa caggaactct 420

aaagtttgtg ctttggtctt gctggccaaa ctcagagccc aacgtaataa ccaacggaag 480

cccatcaaca tttgcgttta atgaaaccat gagtttcgtt cctgaatgac atgtgtcagc 540

acgggggaaa tccacttatc tatataaagt ttcacgctca agttgaacga cttagtaaca 600

tggaagctga ggtagatagt ctaagagtga agaaaattct tctttataat aatagatatt 660

gtagcctaaa cgttcttagt gcacattttt aaatgcaaat atattacgga tttggtccta 720

atttctgtaa aataaaacta cttcattgtt ttatataaat aactctattg ctgcagtttc 780

ccaactttgt tgcttagatt caggtctcac aatcaagaaa tcaagaacag ttagatccac 840

aaattctaca ttttatttaa taagtgaagt gacaaaaaac gagattagat tcgtttctat 900

tcatccataa ttaataaaaa aaaaagacca aacaaacaaa aatcatattc caagggtatt 960

ttcgtaaaca aacaaaaccc tcacaagtct cgttttataa aacgattcac gttcacaaac 1020

tcattcatca tctctctctc ctctaacc 1048

<210> 2

<211> 1959

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 2

atggcggcgg caacatcgtc ttctccgatc tccttaaccg ctaaaccttc ttccaaatcc 60

cctctaccca tttccagatt ctcccttccc ttctccttaa ccccacagaa accctcctcc 120

cgtctccacc gtccactcgc catctccgcc gttctcaact cacccgtcaa tgtcgcacct 180

gaaaaaaccg acaagatcaa gactttcatc tcccgctacg ctcccgacga gccccgcaag 240

ggtgctgata tcctcgtgga agccctcgag cgtcaaggcg tcgaaaccgt cttcgcttat 300

cccggaggtg cctccatgga gatccaccaa gccttgactc gctcctccac catccgtaac 360

gtcctccccc gtcacgaaca aggaggagtc ttcgccgccg agggttacgc tcgttcctcc 420

ggcaagccgg gaatctgcat agccacttcg ggtcccggag ctaccaacct cgtcagcggg 480

ttagccgacg cgatgcttga cagtgttcct ctcgtcgcca tcacaggaca ggtccctcgc 540

cggatgatcg gtactgacgt gttccaagag acgccaatcg ttgaggtaac gaggtctatt 600

acgaaacata actatctggt gatggatgtt gatgacatac ctaggatcgt tcaagaagca 660

ttctttctag ctacttccgg tagacccgga ccggttttgg ttgatgttcc taaggatatt 720

cagcagcagc ttgcgattcc taactgggat caacctatgc gcttgcctgg ctacatgtct 780

aggctgcctc agccgccgga agtttctcag ttaggccaga tcgttaggtt gatctcggag 840

tctaagaggc ctgttttgta cgttggtggt ggaagcttga actcgagtga agaactgggg 900

agatttgtcg agcttactgg gatccctgtt gcgagtacgt tgatggggct tggctcttat 960

ccttgtaacg atgagttgtc cctgcagatg cttggcatgc acgggactgt gtatgctaac 1020

tacgctgtgg agcatagtga tttgttgctg gcgtttggtg ttaggtttga tgaccgtgtc 1080

acgggaaagc tcgaggcgtt tgcgagcagg gctaagattg tgcacataga cattgattct 1140

gctgagattg ggaagaataa gacacctcac gtgtctgtgt gtggtgatgt aaagctggct 1200

ttgcaaggga tgaacaaggt tcttgagaac cgggcggagg agctcaagct tgatttcggt 1260

gtttggagga gtgagttgag cgagcagaaa cagaagttcc cgttgagctt caaaacgttt 1320

ggagaagcca ttcctccgca gtacgcgatt caggtcctag acgagctaac ccaagggaag 1380

gcaattatca gtactggtgt tggacagcat cagatgtggg cggcgcagtt ttacaagtac 1440

aggaagccga ggcagtggct gtcgtcctca ggactcggag ctatgggttt cggacttcct 1500

gctgcgattg gagcgtctgt ggcgaaccct gatgcgattg ttgtggacat tgacggtgat 1560

ggaagcttca taatgaacgt tcaagagctg gccacaatcc gtgtagagaa tcttcctgtg 1620

aagatactct tgttaaacaa ccagcatctt gggatggtca tgcaattgga agatcggttc 1680

tacaaagcta acagagctca cacttatctc ggggacccgg caagggagaa cgagatcttc 1740

cctaacatgc tgcagtttgc aggagcttgc gggattccag ctgcgagagt gacgaagaaa 1800

gaagaactcc gagaagctat tcagacaatg ctggatacac ctggaccgta cctgttggat 1860

gtcatctgtc cgcaccaaga acatgtgtta ccgatgatcc caagtggtgg cactttcaaa 1920

gatgtaataa ccgaagggga tggtcgcact aagtactga 1959

<210> 3

<211> 518

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 3

gagatgaagc tggtgatcga tcatatggta aaagacttag tttcagtttc cagtttcttt 60

tgtgtggtaa tttgggtttg tcagttgttg tactactttt ggttgttccc agacgtactc 120

gctgttgttg ttttgtttcc tttttctttt atatataaat aaactgcttg ggtttttttt 180

catatgtttg ggactcaatg caaggaatgc tactagactg cgattatcta ctaatcttgc 240

taggaaatgg cactttacat tgggtgtgat tgtcatattt tcagtttttt agctacgaga 300

acgatgaaag ttcagatttc acacactata tatatgtttg atcgatgttg tatgctctta 360

aacatttcta tctttccttt tctcatatta tccatcacac tctttaatat gatgtaaatt 420

gcttcttctc taagctacac cagtcgtaag caacatacga agaagctttt tgaaaacatc 480

ttttattctc tcatcacact ttgtgtatgt gtcaataa 518

<210> 4

<211> 26

<212> DNA

<213>carrier (Binary vector pCAMBIA0390)

<400> 4

tggcgggata acctaagaga aaagag 26

<210> 5

<211> 27

<212> DNA

<213>carrier (Binary vector pCAMBIA0390)

<400> 5

cgttaacact agtcagatct accatgg 27

<210> 6

<211> 40

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 6

ctctctcctc taaccatggc ggcggcaaca tcgtcttctc 40

<210> 7

<211> 22

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 7

tcagtactta gtgcgaccat cc 22

<210> 8

<211> 40

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 8

tgactagtgt taacggtgga gctgatctta ccgaccgaac 40

<210> 9

<211> 25

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 9

ggttagagga gagagagatg atgaa 25

<210> 10

<211> 45

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 10

atggtcgcac taagtactga gagatgaagc tggtgatcga tcata 45

<210> 11

<211> 45

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 11

tctcttaggt ttacccgcca ttattgacac atacacaaag tgtga 45

<210> 12

<211> 18

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 12

cttaaccgct aaaccttc 18

<210> 13

<211> 20

<212> DNA

<213>cabbage type rape (Brassica napus)

<400> 13

aatagacctc gttacctcaa 20

Claims

1. a kind of construction method of the carrier of the selection reporter gene expression frame containing complete plant origin, it is characterised in that: completely Using the anti-ALS inhibitor class herbicide resistance gene element of cabbage type rape genomic source, the expression of building selection reporter gene Frame.

2. a kind of vector construction side of selection reporter gene expression frame containing complete plant origin according to claim 1 Method, it is characterised in that: promoter, selection reporter gene and the terminator of the expression cassette of the selection reporter gene are respectively by rape Genome als gene promoter SEQ.ID.NO.1, the anti-ALS with double mutational sites inhibit class herbicide resistance gene mALS₃Gene The terminator sequence SEQ.ID.NO.3 of SEQ.ID.NO.2 and als gene is constituted.

3. a kind of plant expression vector structure of selection reporter gene containing complete plant origin according to claim 1 or 2 Construction method, it is characterised in that:

1) linearized vector: utilizing pCAMBIA0390 carrier sequence, designs special primer 0390F (SEQ.ID.NO.4) 5- ' TGGCGGGATAA CCTAAGAG AAAAGAG-3 ', 0390R (SEQ.ID.NO.5) 5 '-CGTTAACACTAGTCAGATCTAC CATGG-3 ' misses out the no polyA sequence in the region original vector T-DNA by PCR amplification linearized vector in the process Column, the PCR product of glue recovery purifying 6.4Kb are used for carrier recombining reaction；

2) containing the anti-herbicide gene mALS in double mutational sites₃Clone: with application No. is 201710166233.2 patents of invention The rape antiweed that " obtain rape based on external rite-directed mutagenesis and resist a variety of ALS inhibitor class herbicide resistance genes and application " obtains Gene peasy-mALS₃For template, specificity amplification primer is designed, and increases homologous recombination sequence in 5 ' ends of upstream primer Column, i.e. lowerization line part indicate increased base sequence, the same below, with 3 ' terminal homologous of promoter sequence, primer pair sequence point It Wei not ALSF (SEQ.ID.NO.6) 5 '-CTCTCTCCTCTAACCA TG GCGGCGGC AA CATCGTCTTCTC-3 ' and ALSR (SEQ.ID.NO.7)5'-TCAGTACTTAGTGC GACCAT CC-3'；Go out using Beijing Quanshijin Biotechnology Co., Ltd The high-fidelity DNA polymerase kit of product expands mALS₃Gene order；The PCR product of glue recovery purifying 1.9Kb is used for carrier Recombining reaction；

3) rape als gene promoter sequence is cloned: with number of patent application: 201710701957.2 patent of invention " Wild cabbage type The rape als gene promoter sequence that rape als gene promoter and application " obtains is stencil design specific primer, and 5 ' ends of upstream primer, which are introduced, is respectively as follows: PrF with the homologous base sequence of linearized vector left distal end, primer (SEQ.ID.NO.8)5’-TGACTAGTGTTAACGGTGGAGCTGATCT TACCGACC GAAC-3 ' and PrR (SEQ.ID.NO.9) 5 '-GGTTAGAGGAGAGAGAGATGATGAA-3 ' go out using Beijing Quanshijin Biotechnology Co., Ltd The high-fidelity DNA polymerase kit of product expands als gene promoter sequence, the PCR product of glue recovery purifying 1Kb, for carrying Body recombining reaction；

4) rape als gene terminator sequence is cloned: design primer sequence is respectively as follows: AEF (SEQ.ID.NO.10): 5 '-ATGGTCGCACTAAGTACTGAGAGATGAA GCTGG TGATCGATCATA-3 ' and 390ER (SEQ.ID.NO.11) 5 '-TC TCTTAGGTTTACCCGCCATTATTGACACATACACAAA GTGTGA-3 ', using the limited public affairs of Beijing Quan Shijin biotechnology The high-fidelity DNA polymerase kit amplification als gene terminator sequence that department produces, the PCR product of glue recovery purifying 500bp, For carrier recombining reaction；

5) recombination method plant expression vector construction: the recombinant clone kit produced using Nuo Weizan Bioisystech Co., LtdMultis, by above-mentioned steps 1), 2) PCR product that, 3) He 4) each step obtains pass through recombinase reaction building Destination carrier, reaction system are as follows: 5 × CE Multis buffer 4 μ l, mALS₃2 μ l, ALS promoter PCR of PCR product is produced Object 2 μ l, ALS terminate PCR product 2 μ l, Exnase^TM2 μ l, linearized vector 4 μ l, ddH₂2 μ l of O, reacts at 37 DEG C 30min, after take 5-10 μ l reaction solution by heat shock method transformed competence colibacillus bacillus coli DH 5 alpha, cultivated in LB containing kanamycin On base, 37 DEG C of overnight incubations, picked clones carry out PCR identification, then picking PCR positive colony continues Liquid Culture, extracts plasmid, Digestion identification is carried out with HindIII restriction enzyme, carrier contains als gene sequence after recombination, and positive colony is further After sequencing determines, it is the selection reporter gene table containing complete plant origin that thus obtained plasmid, which is named as p0390-PdmAP, Agrobacterium EHA105 is transferred to by electric shocking method up to the carrier of frame, and by destination carrier p0390-PdmAP, it will be positive after PCR identification It is saved backup after clone's culture in -80 DEG C.

4. the plant expression vector of the selection reporter gene of the plant origin of one of claim 1-3 the method building.

5. the plant expression vector of the selection reporter gene of the plant origin of one of claim 1-3 the method building is answered With.

6. the plant expression vector p0390-PdmAP of claim 3 the method building.

7. the application of the plant expression vector p0390-PdmAP of claim 3 the method building.

8. the plant expression vector p0390-PdmAP of claim 3 the method building is in the genetic transformation side of dicotyledon The application in face.