CN109735543B

CN109735543B - GLI2-shRNA and application thereof

Info

Publication number: CN109735543B
Application number: CN201910084299.6A
Authority: CN
Inventors: 靳曙光
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2019-01-29
Filing date: 2019-01-29
Publication date: 2020-02-07
Anticipated expiration: 2039-01-29
Also published as: CN109735543A

Abstract

The invention discloses GLI2-shRNA and application thereof, wherein the nucleotide sequence of the GLI2-shRNA is GATCCGTGTGGAGGACTGCCTACATA TTTCAAGAATATGTAGGCAGTCCTCCACATTTTTATGTTTTA.

Description

GLI2-shRNA and application thereof

Technical Field

The invention relates to the field of biomedicine, and in particular relates to GLI2-shRNA and application thereof.

Background

Biliary atresia is an inflammatory sclerosing biliary tract disease, which is a major disease causing liver transplantation in children, and Epithelial Mesenchymal Transition (EMT) of bile duct is one of the major pathological processes causing liver fibrosis. Research has shown that EMT plays an important role in embryonic development, tissue regeneration and repair, organ fibrosis, and metastasis of cancer cells. After a plurality of tissues and organs are damaged, fibrous tissues and scar tissues are formed through an EMT mechanism to achieve wound repair, but the continuous process can cause fibrosis and hardening of the tissues and organs, such as pulmonary fibrosis, renal fibrosis and the like. The Shh signaling pathway plays an important role in embryonic development, signaling between epithelial-mesenchymal and epithelial-epithelial, cell differentiation and tissue repair, while being in an inactivated state in normal mature tissues. The study finds that the abnormal activation of the Shh signaling pathway is closely related to epithelial mesenchymal transition in biliary atresia. Glis is the terminal transcription factor of the pathway, and Gli2 as the main effector of the pathway can directly reflect the active state of the pathway to participate in the occurrence and development of biliary tract atresia. Therefore, the specific silencing of Gli2 is important for the research of the action mechanism of the Gli2 in diseases, and provides an application basis for the treatment of related diseases. There is no relevant literature on silencing Gli2mRNA and protein expressed genes.

Disclosure of Invention

The invention aims to provide a gene sequence for silencing Gli2, wherein the gene for silencing Gli2 can effectively reduce the expression of GLI2mRNA and protein, can up-regulate the expression of E-cadherin of intrahepatic bile duct epithelial cells, and can down-regulate the protein expression level of Vim and α -SMA so as to reverse the epithelial mesenchymal transition of the bile duct epithelial cells.

The invention is realized by the following technical scheme:

GLI2-shRNA and application thereof, wherein the nucleotide sequence is represented by SEQ ID NO: 1 is shown. Wherein SEQ ID NO: 1 is:

GATCCGTGTGGAGGACTGCCTACATATTTCAAGAGAATATGTAGGCAGTCCTCCACATTTTTTATGTTTTTTA。

a vector containing the GLI2-shRNA gene.

A host comprising a vector as described above.

Further, the host is a recombinant lentivirus capable of silencing Gli2, and the recombinant lentivirus is obtained by constructing a gene sequence capable of silencing Gli2 as defined in claim 1 on a vector and packaging the vector by a lentivirus.

Further, the construction method of the recombinant lentivirus for silencing Gli2 comprises the following steps:

1) connecting the gene sequence of silent Gli2 to a vector after enzyme digestion, transforming and selecting positive clones, and performing sequencing identification to obtain correct clones;

2) and extracting recombinant plasmids after correct clone PCR amplification, transfecting the recombinant plasmids and auxiliary plasmids into host cells together with plasmids, and packaging the lentiviruses to obtain the recombinant lentiviruses. The vector may be pLent-U6-Puro vector, the helper plasmid may be pMDLg-pRRE, pMD2.G, pRSV-Rev virus packaging helper plasmid, etc., and the host cell may be 293T cell, etc., as described above. The vectors, helper plasmids and host cells of the present invention are not limited to those mentioned above, as long as the vectors, lentiviruses, etc., designed based on the silent gene sequences of the present invention are within the scope of the present invention.

To better illustrate the invention, a GLI2-shRNA and a construction method of the application thereof are disclosed, wherein a silencing sequence for specifically recognizing GLI2 is designed on an Invitrogen company homepage by corresponding software according to a GLI2CDS sequence, such as SEQ ID NO: 1 and synthesized by the prior art.

The application of the gene in preparing the medicine for treating biliary tract atresia.

Further, the application is the application in preparing the medicine for reversing the epithelial-mesenchymal transition of the bile duct epithelial cells.

Furthermore, the application is the application for preparing the medicine for reducing GLI2mRNA and protein expression, simultaneously up-regulating the expression of intrahepatic bile duct epithelial cells E-cadherin and down-regulating the protein expression level of Vim and α -SMA.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the invention can effectively reduce the expression of GLI2mRNA and protein, can up-regulate the expression of E-cadherin of intrahepatic bile duct epithelial cells, and can down-regulate the protein expression level of Vim and α -SMA so as to reverse the epithelial mesenchymal transition of the bile duct epithelial cells.

Drawings

The accompanying drawings, which are included to provide a further understanding of the embodiments of the invention and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the invention and together with the description serve to explain the principles of the invention. In the drawings:

FIG. 1 is a diagram of RT-PCR detection of Gli2 gene.

FIG. 2 is a Western blot detection Gli2 protein expression level diagram.

FIG. 3 is a diagram of the expression of EMT-associated protein detected by Western blot.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples and accompanying drawings, and the exemplary embodiments and descriptions thereof are only used for explaining the present invention and are not meant to limit the present invention.

Example 1

1 Gene Synthesis and construction of viral vectors

The method comprises the following steps:

first step, sequence design

The silencing sequence of GLI2 was specifically identified on the Invitrogen company homepage based on the GLI2CDS sequence with the corresponding software design and synthesized by prior art.

Secondly, double enzyme digestion is carried out on the target sequence and the expression vector

And carrying out double enzyme digestion on the synthesized target sequence and the pLent-U6-Puro vector, and recovering the target sequence and the linear vector by using a gel recovery kit.

Thirdly, the target sequence is ligated to the vector

And connecting the two products in the last step under the action of T4DNA ligase, transforming, extracting and the like to obtain the silencing vector GLI 2-shRNA.

Fourthly, packaging of lentiviruses

And (3) transfecting the silencing vector obtained in the last step and a helper plasmid into 293T cells, culturing, and collecting GLI2-shRNA lentivirus by PEG precipitation.

Fifth step, efficiency test of silencing target protein

Transfecting the obtained GLI2-shRNA lentivirus into mIBEC cells, detecting the silencing efficiency by means of QPCR, Western blot and the like, and detecting the protein expression levels of epithelial mesenchymal transition related proteins E-cadherin, Vim and α -SMA.

The specific implementation process is as follows:

1.1.1 Gene Synthesis of shRNA gene of Gli 2.

On the basis of the CDS sequence of GLI2 (mouse NM-010296), the shRNA of GLI2 was designed on-line on the homepage of invitrogen, the design rule: the GC content of the 19bp sequence specifically binding to GLI2 is 45% -55%, meanwhile, the selected fragments are subjected to BLAST comparison, and the sequence specifically identifying GLI2 is selected, wherein the nucleotide sequence is represented by SEQ ID NO: 1, shRNA is prepared by adopting the existing gene synthesis method, such as a PCR method, the annealing temperature is 45-65 ℃, and the shRNA can also be consigned to relevant professional companies for synthesis.

1.1.2 recovery of vector and target Gene by digestion

TABLE 1.1 enzyme digestion System

Electrophoresis is carried out for 30min under the condition of 100v in 1 percent agarose gel, and the gel is used for recovering the carrier and the target gene tablet

1.1.3 connection of target gene fragment and carrier, the connection system is as follows:

TABLE 1.2 connection systems

Incubating for 0.5-1h at 16 ℃.

1.2 transformation and validation

1.2.1 the DNA fragment to be transformed was added to a tube containing TOP10 competent cells (25 ng of DNA for 50. mu.l of competent cells) in a volume not exceeding 5% of the competent cells, the contents were mixed by gentle rotation several times and ice-cooled for 30 min.

1.2.2 Place the tube mixture in a 42 ℃ water bath, heat shock for 90s without shaking the tube. The tube was quickly transferred to an ice bath and allowed to stand for 2 min.

1.2.3 Add 200. mu.L of SOC broth per tube, warm the media to 37 ℃ with a water bath, then transfer the tube to a shaker set at 37 ℃ and incubate for 45min at 220rpm, resuscitate the cells and express the plasmid-encoded resistance marker gene.

1.2.4 transfer of transformed competent cells to LB medium containing the corresponding antibiotic.

1.2.5 plates were inverted and incubated at 37 ℃ and plaques appeared after 12-16 hours.

1.2.6 colonies were randomly picked and sequence verified

1.3 Lentiviral/Adenoviral packaging

1.3.1 DMEM + 10% FBS was used to plate 293T cells in 6 well plates at 2 mL/well and cell densities of 70% -80% were used for transfection. The density and state of cells greatly affect virus packaging, and thus it is necessary to ensure a small number of passages and a good cell state.

1.3.2 cells were transferred to serum-free medium before transfection. Mu.l serum-free medium dilution 2. mu.g expression plasmid + 1.5. mu.g pMDLg-pRRE + 1.5. mu.g pMD2.G + 1.5. mu.g pRSV-Rev viral packaging helper plasmid.

1.3.3 dilution of 15. mu.L of Lip2000 with 500. mu.L of serum-free medium. After 5min, the DNA solution and the liposome solution were mixed and allowed to stand at room temperature for 20 min.

1.3.4 aspirate 1mL of serum free media from 6-well plates and then add 1mL of plasmid and liposome mixture dropwise.

1.3.56-10 h later, the medium containing the DNA-liposome complexes was removed and replaced with normal medium DMEM + 10% FBS.

1.4 harvesting of Virus solution

1.4.1 collect cell supernatant 48h after transfection (counting 0h after transfection), and supplement culture medium for continuous culture. At this time, the harvest contains virus particles, and the centrifuge tube is wrapped with a preservative film and stored at 4 ℃.

1.4.2 the venom was centrifuged at 5000rpm for 10min at 4 ℃ to remove cell debris.

1.4.3 with 0.45 u m filter supernatant in 50mL ultracentrifuge tube, adding 5X PEG8000 at 4 degrees C precipitation overnight, 10000rpm centrifugation and discard supernatant, 10mL PBS redissolution precipitation.

1.4.4 Add 2mL of 20% sucrose solution to a 15mL centrifuge tube, carefully add 10mL of virus solution to the upper layer, and centrifuge at 25000rpm at 4 ℃ for 2 h.

1.4.5 resuspend the pellet with 1mL PBS, filter sterilized on a 0.22 μm filter.

1.4.6 the pooled virus suspension was aliquoted into 50. mu.L aliquots and stored in production tubes at-80 ℃.

To further illustrate the beneficial effects of the Gli2-shRNA of the present invention, the following comparative experiments were performed:

1.5 Gli2-shRNA lentivirus infection of mIBEC

1.5.1 taking mIBEC, digesting with 0.125 percent of pancreatin for 30s-1min, blowing down the cells, centrifuging for 5min at 1000rpm, abandoning the supernatant, resuspending the precipitate with a special culture medium for mouse intrahepatic bile duct endothelial cells, and counting.

1.5.2 taking a 24-hole plate and a 6-hole plate, wherein the plating density of the 24-hole plate is 1 × 10E5 plates/hole and the plating density of the 6-hole plate is 5 × 10E5 plates/hole, adding a reptile into the 24-hole plate in advance, and culturing overnight at 37 ℃ under the condition of 5% CO 2.

1.5.3 days later, the virus is diluted in a gradient way to ensure that the MOI is 40, the diluted virus is respectively added into a 24-pore plate and a 250 mu L/pore, the adding amount of a 6-pore plate is 1 ml/pore, culture media are added into each pore after 5h, the cells are observed after 24h without pathological changes and are not changed, RNA is respectively extracted after 48h, QPCR and Western blot are used for detecting the expression conditions of Gli2 and Gli2, Snail and Slug and EMT characteristic cytokines E-cadherin, Vimentin and α -SMA.

1.5.4 taking out 24-well plate, discarding culture supernatant, washing with PBS 3 times, and fixing with 4% paraformaldehyde for 20 min.

1.5.5 discard the fixative and wash 3 times with PBS for 5min each time.

1.5.6 sealing: add 500. mu.l of blocking solution (5% fetal bovine serum + 0.3% Trion, PBS) to each well and block for 30min at room temperature.

1.5.7 CK19 (diluted with blocking solution 1: 50) and α -SMA (diluted with blocking solution 1: 400) were added, and incubated overnight at 4 deg.C

1.5.8 washed 3 times with PBS, added with secondary antibody (1:400 diluted) of corresponding nature for 5min each time, and incubated for 2h at room temperature in the absence of light.

1.5.9 PBS washing 3 times, adding DAPI working solution to stain for 10min, adding anti-fluorescence quencher to seal after PBS rinsing 3 times, and taking pictures.

The results shown in the figures 1, 2 and 3 are obtained through the content of the comparative experiments, and it is obvious from the figures 1, 2 and 3 that the Gli2-shRNA can effectively reduce the expression of Gli2, can up-regulate the E-cadherin of intrahepatic bile duct epithelial cells, and can down-regulate the protein expression levels of Vim and α -SMA so as to reverse the epithelial mesenchymal transformation of intrahepatic bile duct epithelial cells.

The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are merely exemplary embodiments of the present invention, and are not intended to limit the scope of the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the scope of the present invention.

The gene sequence table is SEQ ID NO: 1 the following is a description of the following,

SEQUENCE LISTING

<110> Sichuan university

<120> GLI2-shRNA and application thereof

<130>2019.1.25

<160>1

<170>PatentIn version 3.3

<210>1

<211>73

<212>DNA

<213> Artificial Synthesis

<400>1

gatccgtgtg gaggactgcc tacatatttc aagagaatat gtaggcagtc ctccacattt 60

tttatgtttt tta 73

Claims

1. A GLI2-shRNA, the corresponding DNA sequence of which is SEQ ID NO: 1 is shown.

2. Use of the GLI2-shRNA of claim 1 for the preparation of a medicament for the treatment of biliary atresia.