CN109700836A - A kind of anti-prostatic hyperplasia plateau nettle extract, preparation method and applications - Google Patents
A kind of anti-prostatic hyperplasia plateau nettle extract, preparation method and applications Download PDFInfo
- Publication number
- CN109700836A CN109700836A CN201910163065.0A CN201910163065A CN109700836A CN 109700836 A CN109700836 A CN 109700836A CN 201910163065 A CN201910163065 A CN 201910163065A CN 109700836 A CN109700836 A CN 109700836A
- Authority
- CN
- China
- Prior art keywords
- extract
- alcohol
- extracted
- nettle
- plateau
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Plant Substances (AREA)
Abstract
The present invention proposes a kind of plateau nettle extract of anti-prostatic hyperplasia, preparation method and applications, comprising the following steps: 1) plateau nettle drying and crushing is extracted medicinal extract with being extracted respectively with 95% ethyl alcohol, obtain 95% alcohol-extracted extract, 50% alcohol-extracted extract and water after 50% alcohol extracting；2) after plateau nettle extracting solution being removed ethyl alcohol, petroleum ether degreasing is first used, degreasing extract is obtained；3) degreasing extract is extracted with ethyl acetate, collects ethyl acetate portion, concentrate drying obtains plateau nettle extract.Plateau nettle Ethyl acetate fraction and the molten position of alcohol have preferable therapeutic effect to the prostatic hyperplasia model mouse that testosterone propionate induces.
Description
Technical field
The invention belongs to pharmaceutical technology field, it is a kind of extracted from the nettle of Tibetan medicine plateau have anti-prostatic hyperplasia effect
Active component and the preparation method and application thereof.
Background technique
Hyperplasia of prostate (Benign prostatic hyperplasia, BPH) is the common disease of middle-aging male, and with
Age increases disease incidence and increases therewith, show as urination hesitate, the symptoms such as frequent micturition, urgent urination, enuresis nocturna increase, the retention of urine, and may
Cause lower urinary tract obstruction, or even the symptoms such as damage renal function occur, seriously affects the normal life of patient.It is controlled used in clinic at present
Treating drug mainly has alpha-adrenergic receptor retarding agent and 5α-reductase inhibitor.Slight, moderate hyperplasia of prostate is suffered from
Person mainly uses drug therapy, but the factors such as therapeutic effect, side effect limit its application.Testosterone propionate induction is subcutaneously injected to produce
The modeling method of raw hyperplasia of prostate is most common method.Growth and development, structure and the basic physiological function and property of prostate
Hormone is closely related, and pathogenesis is not yet fully apparent from present, it is generally recognized that related with following factor: sex hormone level is (such as
DHT etc.), growth factor (such as EGF), Apoptosis and gene regulation (such as Bcl-2) etc..
The drying of Tibetan medicine plateau nettle system urticaceae plant plateau nettle Urtica hyperborean Jacq.exWedd.
Aerial part is one of the base of characteristic Tibetan medicine " Sa Zhumu (Sa Zhu) ".In the Tibetanmedicine classics Four-Volume Medical Code, " Jingzhubencao "
On the books in, aerial part, inflorescence, infructescence and seed are used as medicine, and have effects that dispelling wind and relieving convulsion, warm stomach help digestion, are used for
Hot (old heat), stomach cold, indigestion, diabetes, rheumatalgia pain, hypertension, postpartum exhausting, children take out long caused by " dragon " disease
Wind, nettle rash etc..So far, the report in relation to the effect of plateau nettle anti-prostatic hyperplasia is had no.
Summary of the invention
The purpose of the invention is to provide a kind of effective extract part of drug, which has anti-prostatic hyperplasia
Effect, and improve prostatic histomorphology structure, it can be used to the drug for preparing anti-prostatic hyperplasia.
The purpose of the present invention is what is be achieved through the following technical solutions: a kind of effective portion with anti-prostatic hyperplasia effect
Position, the active component are ethyl acetate extract or the molten position of alcohol of plateau nettle.
A kind of preparation method of the plateau nettle extract for anti-prostatic hyperplasia, comprising the following steps:
1) plateau nettle drying and crushing is concentrated to give with being extracted respectively with 95% ethyl alcohol, after 50% alcohol extracting and water extraction
Medicinal extract is extracted to 95% alcohol-extracted extract, 50% alcohol-extracted extract and water；
2) 95% alcohol-extracted extract, 50% alcohol-extracted extract and water are extracted into medicinal extract, first uses petroleum ether degreasing respectively, obtains 95%
Alcohol-extracted extract degreasing extract and 50% alcohol-extracted extract degreasing extract；
3) the degreasing extract of 95% alcohol-extracted extract and 50% alcohol-extracted extract is extracted with ethyl acetate, collects ethyl acetate
Part, mixes the organic phase at two extraction positions, and is concentrated and dried and obtains plateau nettle extract.
Plateau nettle extracting solution is obtained after being extracted described in step 1) with ethyl alcohol are as follows:
1) coarse powder is made in the drying of plateau nettle, with 95% ethanol wet；
2) it pours into diacolation bucket, 95% alcohol dipping is added and stays overnight；
3) successively with 8-10 times of medicinal material weight 95% ethyl alcohol measured, 50% ethyl alcohol；
4) Fractional Collections percolate is recovered under reduced pressure to no alcohol taste, obtains 95% alcohol-extracted extract, 50% alcohol-extracted extract.
Petroleum ether described in step 2) or gasoline degreasing are as follows:
1) after dispersing 95% alcohol-extracted extract and 50% alcohol-extracted extract with suitable quantity of water, successively with equivalent petroleum ether to 95% alcohol extracting
Medicinal extract and 50% alcohol-extracted extract carry out extraction 5-7 times, until organic phase is colourless, recycles water phase, obtain 95% alcohol-extracted extract degreasing and mention
Take object and 50% alcohol-extracted extract degreasing extract.
Plateau nettle extracting solution is recovered under reduced pressure to no alcohol taste, alcohol-extracted extract is obtained；
2) colourless to organic phase with petroleum ether or gasoline extraction after the suitable water dispersion of alcohol-extracted extract.
What the plateau nettle extract for anti-prostatic hyperplasia was prepared using method described in claim 1
Plateau nettle extract.
The plateau nettle extract for anti-prostatic hyperplasia is in the drug that preparation is used for anti-prostatic hyperplasia
Using.
Inventor has investigated plateau nettle petroleum ether extraction position, ethyl acetate extraction using Proscar as positive control respectively
The prostatic hyperplasia model mouse for taking position, extracting n-butyl alcohol position, the molten position of alcohol and the insoluble position of alcohol to induce testosterone propionate
Therapeutic effect, in Mice Body the experimental results showed that,
Compared with prior art, the invention has the following advantages:
1. the prostatic hyperplasia model that plateau nettle Ethyl acetate fraction and the molten position of alcohol induce testosterone propionate is small
Mouse has preferable therapeutic effect.
2. the present invention is the extract of Tibetan medicine plateau nettle, plateau nettle is that Tibetan area is usually used in preventing and treating digestive system
The special medicinal material of disease and arthralgia disease etc. has good medication basis.
3. the effective extract part of invention drug plateau nettle has no toxic side effect.
4. the effective extract part of invention drug plateau nettle, preparation process is easy, and recovery rate is high, for the industry of the drug
Metaplasia produces, and provides excellent basis.
5. the invention drug Tibetan medicine plateau nettle is conducive to ethnodrug resources development and utilization.
Detailed description of the invention
The finger-print of the plateau Fig. 1 nettle；
The finger-print at the plateau Fig. 2 nettle acetoacetic ester extraction position；
The plateau Fig. 3 nettle acetoacetic ester figure compared with the finger-print of the various medicinal materials of Urtica；
Fig. 4 is influence of the plateau nettle extract to EGF gene expression in hyperplasia of prostate mouse prostate tissue；Figure
In, compared with blank group,##P < 0.01, compared with model group,*P < 0.05,**P<0.01；
Fig. 5 is influence of the plateau nettle extract to Bcl-2 gene expression in hyperplasia of prostate mouse prostate tissue；Figure
In, compared with blank group,##P < 0.01, compared with model group,*P < 0.05,**P<0.01；
Fig. 6 is plateau nettle different parts extract on the morphologic influence of hyperplasia of prostate mouse prostate histopathology
(×100)；Wherein, A- blank group；B- model group；C- positive controls；D- petroleum ether extraction position low dose group；E- petroleum ether
Extract position high dose group；F- Ethyl acetate fraction low dose group；G- Ethyl acetate fraction high dose group；The positive fourth of H-
Alcohol extracts position low dose group；I- extracting n-butyl alcohol position high dose group；The molten position low dose group of J- alcohol；The high agent in the molten position of K- alcohol
Amount group；The insoluble position low dose group of L- alcohol；The insoluble position high dose group of M- alcohol；
Wherein, 1. 5. Herba Urticae triangularis of wide 2. Urtica dioica seed of leaf nettle 3. Urtica fissa, 4. urtica angustifolia, 6. plateau in Fig. 3
11. Yunnan-Tibet nettle of nettle 7. Tibet nettle, 8. sesame slices nettle, 9. Xinjiang Urtica dioica seed, 10. Himalaya nettle, 13. plateau nettle second
Acetoacetic ester position.
Specific embodiment
Technical solution of the present invention is described further with specific embodiment below.
Embodiment 1 is used for the comparison of ingredients of anti-prostatic hyperplasia plateau nettle extract and other Urticas
11 kinds of Urtica medicinal materials are acquired respectively, and precision weighs the dry medicinal powder 1g of 11 kinds of Urtica medicinal plants, is placed in
100mL round-bottomed flask adds methanol 25mL, shakes up, and is placed in ultrasonic extraction 30min in 70 DEG C of water-baths, and standing is let cool, supernatant from
The heart crosses 0.45 μm of miillpore filter, spare.
At room temperature, it weighs plateau nettle and dries coarse powder 9kg, after plateau nettle dries 95% ethanol wet of coarse powder,
Enter in diacolation bucket, 95% ethyl alcohol is added until liquid level is higher than medicinal material surface, steeped overnight is successively measured with 8-10 times of medicinal material weight
95% ethyl alcohol, 50% ethyl alcohol, water step-SHENLU, Fractional Collections percolate are recovered under reduced pressure to no alcohol taste, obtain 95% alcohol extracting leaching
Cream, 50% alcohol-extracted extract and water extract medicinal extract；After dispersing 95% alcohol-extracted extract and 50% alcohol-extracted extract with suitable quantity of water, successively use etc.
It is (extremely organic that amount petroleum ether, ethyl acetate, n-butanol carry out extraction 5-7 times to 95% alcohol-extracted extract and 50% alcohol-extracted extract respectively
It is mutually colourless), merge identical organic phase, organic solvent is recovered under reduced pressure, obtains petroleum ether phase, ethyl acetate phase, n-butanol and mutually extract
Position；Water extract part is recovered under reduced pressure, be concentrated into it is appropriate, it is 2 times heavy (alcohol amount be medical fluid 4-5 times) with 95% ethyl alcohol, pour out
Clear liquid precipitates 95% ethanol washing, merges supernatant and is concentrated into no alcohol taste, obtains the molten position of alcohol and the insoluble position of alcohol.
Instrument are as follows: Shimadzu LC-20A Ultra Performance Liquid Chromatography instrument is equipped with PDA UV detector (Japanese Shimadzu Corporation)；KQ-
5200DB type supersonic cleaning machine (ultrasonic instrument company, city of Kunshan)；AL204 type electronic analytical balance [Mettler Toledo instrument
Device (Shanghai) Co., Ltd.]；Electronic balance (ten a ten thousandths, Sai Duolisi, sarturious BT 124S type)；ORTEX3 rotation
Whirlpool vortex mixer (German IKA company)；BUCHI electronic rotation evaporimeter (BUCHI Labortechnik AG, Switzerland)；Millipore-Simplicity
Ultra-pure-water treatment system (Merck KGaA Millipore Corp.).Reagent are as follows: acetonitrile (chromatographic grade, Tedia company, the U.S.)；Formic acid [color
Spectrum level, Aladdin reagent (Shanghai) Co., Ltd.].Water is ultrapure water, and other reagents are that analysis is pure.Chromatographic process such as 1 institute of table
Show.
1 Urtica medicinal material mobile phase condition of table
Identify by chromatographic qualitative, it was demonstrated that the specific component of plateau nettle ethyl acetate extract and wide leaf nettle, different strain
Nettle, Urtica fissa, urtica angustifolia, Herba Urticae triangularis, Tibet nettle, sesame slices nettle, Xinjiang Urtica dioica seed, Himalaya nettle
There is significant difference with the ingredient of Yunnan-Tibet nettle.It is specific as shown in Figure 1, Figure 2, Figure 3 and Figure 4.
The activity of 2 plateau nettle the different extracted parts of embodiment is investigated
The present invention starts with to related androgen and cell Proliferation angle from plateau nettle extract.Androgen is mainly DHT,
DHT level is excessively high in prostata tissue can lead to hyperplasia of prostate.Androgen can also indirect adjustments and controls peptide growth factor and its
Receptor, to regulate and control the growth of prostatic cell.Inhibit apoptosis factor high expression in prostata tissue, forefront can also be made
Gland hyperplasia.Prostate index and the detection of prostata tissue pathology can intuitively express hyperplasia of prostate degree.Therefore the present invention
To detect, serum DHT, EGF be horizontal, the expression of EGF, Bcl-2mRNA and prostate index and prostata tissue in prostata tissue
Pathologic changes are the effect of Study of indices plateau nettle the different extracted parts anti-prostatic hyperplasia.
The preparation of laboratory sample is the same as embodiment 1.
Testosterone propionate (Shanghai Mike's woods biochemical technology Co., Ltd, 98%, lot number: C10083691)；Proscar (it is non-that
Male amine piece) (Merch Sharp Dohme Limited, United Kingdom, 5mg, lot number: J20150143)；Edible olive
Oily (beneficial Hai Jiali food marketing Co., Ltd, lot number: GB/T23347)；Mouse EGF (EGF) Elisa kit
(Wuhan Sino-American Biotechnology Company), protona (DHT) Elisa kit (the limited public affairs of the magnificent bioengineering in Wuhan
Department)；Trizol extracts reagent (Ambion company, lot number: 152105)；Reverse transcription reagent box (Novoprotein company, lot number:
0511171)；Dimethylbenzene (Sinopharm Chemical Reagent Co., Ltd., lot number: 10023418)；Primer is by Jin Sirui biotechnology
Co., Ltd's synthesis；Other reagents are that analysis is pure.
Instrument
Blade coarse granule pulverizer (Shanghai Chinese traditional medicine machine factory, model: FD200T)；(Wuhan person of outstanding talent's electronics is limited for dewaterer
Company, model: JJ-12J)；Embedding machine (Wuhan person of outstanding talent Electronics Co., Ltd., model: JB-P5)；Freezing platform, (Wuhan person of outstanding talent's electronics has
Limit company, model: JB-L5)；Pathologic section slicer (Shanghai Lai Ka Instrument Ltd., model: RM2016)；Tissue booth piece machine (Zhejiang
The Jinhua Jiang Sheng section enlightening experimental instruments and equipment limited, model: KD-P)；Oven (Tianjin Lai Borui experimental instruments and equipment limited,
Model: GFL-230)；Glass slide (Citotest Labware Manufacturing Co., Ltd., lot number: 10127105P-G)；Ultra low temperature freezer (beauty
ThermoFisher company, state, model: 808964-1601)；Table-type high-speed refrigerated centrifuge (Eppendorf company, the U.S., type
Number: 5430)；All-wave length microplate reader (ThermoFisher company, the U.S., model: 1510-01871)；Fluorescence quantitative PCR instrument (ABI
Company, model: 7500)；DY89-II electric homogenate machine (NingBo XinZhi Biology Science Co., Ltd, model: T10S).
Experimental animal
Mouse, KM kind, 25~28g of weight (offer of Jiangxi University of Traditional Chinese Medicine's Experimental Animal Center), quality certification number: SCXK
(Jiangxi) 2018-0003.Normal diet is raised under the conditions of room temperature (25 ± 2) DEG C, and it is dynamic that this experiment obtains Jiangxi University of Traditional Chinese Medicine's experiment
The approval of object Ethics Committee, meets Chinese Ethical committee guideline.
Experimental method
KM mouse 104 are taken, male is randomly divided into 13 groups, every group 8.Grouping and dosage are shown in Table 2.
When modeling in addition to olive oil is subcutaneously injected in blank group, remaining each group started that 10mgkg is subcutaneously injected in the 1st day-1·
The testosterone propionate (with olive oil ultrasonic dissolution at suspension) of bw, continuous injection 20 days.Modeling simultaneously each experimental group start to
Relative medicine is given, drug 0.5%CMC-Na solution is dissolved, is administered once daily, 10mLkg-1Bw stomach-filling, successive administration 30
It.Blank group and model group are not administered, the isometric physiological saline of stomach-filling.Last day is deprived of food but not water.
The 1h after last time is administered, weighing after eye socket takes blood, put to death mouse with cervical dislocation, open abdominal cavity immediately,
Prostate surrounding tissue is removed, prostate is won and weighs rapidly, calculating prostate index (prostatic mass of every 1g weight,
mg·g-1).Prostata tissue is divided into two after weighing, half is fixed with 10% formalin, specimens paraffin embedding slices, conventional H E
Make histology om observation after dyeing；The other half freezes detects for qPCR.
The grouping of 2 mouse experiment of table and dosage
Prostata tissue pathological examination
With 10% formalin solution tissue fixation is taken out afterwards for 24 hours, is dehydrated, paraffin embedding, slice, conventional H E dyeing,
Its histomorphological changes of microscopically observation.
Elisa method surveys EGF and DHT content in serum
Experimental procedure is operated in strict accordance with kit specification.
QPCR method detects EGF and Bcl-2 gene expression in mouse prostate tissue
Take it is fresh freeze prostata tissue, Trizol method, which is extracted, detects RNA purity and concentration after total serum IgE in tissue.It carries out
Reverse transcription reaction (20 μ L of reaction system), obtains cDNA template.It takes 1 μ L of cDNA template to be reacted, reacts 20 μ L of total volume, instead
Answering system includes 2 × SYBR GreenMaster Mix, 10 μ L, 1 μ L of upstream primer, 1 μ L, DEPC water of downstream primer, 7 μ L, is mixed
It is even.Amplification condition is 95 DEG C of initial denaturation 2min (95 DEG C of denaturation 15s, 57 DEG C of annealing 15s, 72 DEG C of extension 60s are recycled 40 times), is drawn
Object is shown in Table 3.
3 primer information table of table
| Gene Name | Primer sequence |
| EGF | query_L1 TGGACAGACAGTGGGAAGTC forward |
| query_R1 AAGGGAAGCGCTTTCAATCC reverse | |
| Bcl-2 | query_L1 TTCTTTGAGTTCGGTGGGGTC forward |
| query_R1 TGCATATTTGTTTGGGGCAGG reverse | |
| β-actin | query_L1 GTCACCAGGGTGTCATGGTA forward |
| query_R1 GTCCCAGTTGGTGATGATGC reverse |
Experimental result
4 each group prostate index of table
| Group | Mouse crude drug dosage (gkg-1) | Prostate index (mgg-1) |
| Blank group | - | 0.85±0.17 |
| Model group | - | 1.63±0.17## |
| Proscar group | - | 1.35±0.08 |
| Petroleum ether extraction position low dose group | 0.78 | 1.38±0.28 |
| Petroleum ether extraction position high dose group | 2.34 | 1.61±0.18 |
| Ethyl acetate fraction low dose group | 0.78 | 1.22±0.15* |
| Ethyl acetate fraction high dose group | 2.34 | 1.22±0.28* |
| Extracting n-butyl alcohol position low dose group | 0.78 | 1.31±0.20 |
| Extracting n-butyl alcohol position high dose group | 2.34 | 1.30±0.20* |
| The molten position low dose group of alcohol | 0.78 | 1.29±0.25* |
| The molten position high dose group of alcohol | 2.34 | 1.27±0.34* |
| The insoluble position low dose group of alcohol | 0.78 | 1.45±0.31 |
| The insoluble position high dose group of alcohol | 2.34 | 1.40±0.23 |
Note: compared with blank group,##P<0.01；Compared with model group: P < 0.05 *.
From table 4, it can be seen that compared with blank group, model group mouse prostate index be significantly higher than naive mice (P <
0.01), show continuously to inject the obvious hyperplasia of mouse prostate tissue after testosterone propionate, modeling success.Compared with model group, each reality
The prostate index numerical value for testing group is below model group, wherein Ethyl acetate fraction is low, high dose group and the molten position of alcohol
Low, high dose group and extracting n-butyl alcohol position high dose group can significantly reduce prostate index (P < 0.05), prostate index
Also below positive drug control group, but not statistically significant (P > 0.05), show Ethyl acetate fraction and the molten position of alcohol and just
Butanol, before immunoassay position can obviously inhibit mouse prostate hyperblastosis.
As can be seen from Figure 4 and Figure 5, compared with blank group, Serum EGF concentration and the DHT concentration of model group mouse are significantly increased
(P<0.01).Compared with model group, in addition to petroleum ether extract group, other each experimental groups can significantly reduce the dense of Serum EGF concentration
It spends (P < 0.05), Ethyl acetate fraction, extracting n-butyl alcohol position, the molten position of alcohol, the insoluble position high dose group of alcohol and the positive
Medicine Proscar group can extremely significant reduction Serum EGF concentration concentration (P < 0.01).Compared with model group, Ethyl acetate fraction is low, high
Dosage group can be substantially reduced the concentration (P < 0.05) of DHT in serum, and the molten position high dose group of positive drug Proscar group, alcohol can be significant
The concentration (P<0.01) of DHT in serum is reduced, and there was no significant difference (P>0.05) between this two groups.Show ethyl acetate extraction portion
The low, high dose group in position and the molten position high dose group of alcohol can reduce Serum EGF concentration and the concentration of DHT simultaneously.
Such as Fig. 6, prostate pathological section microscopic examination result is shown, the arrangement of blank group prostate gland is clear, and lumen of gland has no expansion
It opens, no secretion, glandular epithelium marshalling, nucleus is centrally located.
Model group prostate gland is disorganized, and lumen of gland expansion forms big acinus, and surrounding body of gland is squeezed and deformed, and secretes function
It can enhance, the obvious hyperplasia of galandular epithelium, cell arrangement disorder, cell is in high column, and partial region is in cladding or false cladding.
Proscar group, Ethyl acetate fraction and the low of the molten position of alcohol, the most of body of gland of high dose group and gland cell are not
See hyperplasia, marshalling, hyperplasia occur in a small number of bodies of gland and cell, and secretion is less.Generally hyperplasia of prostate degree obviously subtracts
Gently.
The visible Glandular Dilatation of extracting n-butyl alcohol position low dose group, forms bulla, glandular epithelium hyperplasia, and arrangement is not advised
Then, it is seen that more secretion.The extracting n-butyl alcohol position high dose group and insoluble position of alcohol is low, high dose group part body of gland lumen of gland expands
, primitive rule is arranged, a small number of body of gland galandular epitheliums are in papillary to intracavitary prominent, it is seen that a small amount of secretion.
Petroleum ether extraction position is low, high dose group prostata tissue major part body of gland and epithelial cell visible hyperplasia, body of gland
With cell arrangement disorder, cell is in high column, and lumen of gland is obviously expanded, and big acinus is formed, and makes body of gland extrusion deformation around, secretion
Increase, partial region is in cladding or false cladding.
To sum up illustrate, plateau nettle Ethyl acetate fraction, the molten position of alcohol have the function of anti-prostatic hyperplasia, and change
The effect of kind prostatic histomorphology structure can be used to prepare the drug of anti-prostatic hyperplasia.
Claims (5)
1. a kind of preparation method of the plateau nettle extract of anti-prostatic hyperplasia, it is characterised in that: the following steps are included:
1) plateau nettle drying and crushing is concentrated to get with being extracted respectively with 95% ethyl alcohol, after 50% alcohol extracting and water extraction
95% alcohol-extracted extract, 50% alcohol-extracted extract and water extract medicinal extract；
2) 95% alcohol-extracted extract, 50% alcohol-extracted extract and water are extracted into medicinal extract, first uses petroleum ether degreasing respectively, obtains 95% alcohol extracting
Medicinal extract degreasing extract and 50% alcohol-extracted extract degreasing extract；
3) the degreasing extract of 95% alcohol-extracted extract and 50% alcohol-extracted extract is extracted with ethyl acetate, collects ethyl acetate portion
Point, the organic phase at two extraction positions is mixed, and be concentrated and dried and obtain plateau nettle extract.
2. the preparation method of the plateau nettle extract of anti-prostatic hyperplasia according to claim 1, it is characterised in that: step
It is rapid 1) described in extracted with ethyl alcohol after obtain plateau nettle extracting solution are as follows:
1) coarse powder is made in the drying of plateau nettle, with 95% ethanol wet；
2) it pours into diacolation bucket, 95% alcohol dipping is added and stays overnight；
3) successively with 8-10 times of medicinal material weight 95% ethyl alcohol measured, 50% ethyl alcohol；
4) Fractional Collections percolate is recovered under reduced pressure to no alcohol taste, obtains 95% alcohol-extracted extract, 50% alcohol-extracted extract.
3. the preparation method of the plateau nettle extract of anti-prostatic hyperplasia according to claim 1, it is characterised in that: step
It is rapid 2) described in petroleum ether or gasoline degreasing are as follows:
1) after dispersing 95% alcohol-extracted extract and 50% alcohol-extracted extract with suitable quantity of water, successively with equivalent petroleum ether to 95% alcohol-extracted extract
Extraction 5-7 times is carried out with 50% alcohol-extracted extract, until organic phase is colourless, water phase is recycled, obtains 95% alcohol-extracted extract degreasing extract
With 50% alcohol-extracted extract degreasing extract.
Plateau nettle extracting solution is recovered under reduced pressure to no alcohol taste, alcohol-extracted extract is obtained；
2) colourless to organic phase with petroleum ether or gasoline extraction after the suitable water dispersion of alcohol-extracted extract.
4. a kind of plateau nettle extract of anti-prostatic hyperplasia, it is characterised in that: the plateau nettle of the anti-prostatic hyperplasia
The plateau nettle extract that extract uses method described in claim 1 to be prepared.
5. the plateau nettle extract of anti-prostatic hyperplasia described in claim 4 is in the drug that preparation is used for anti-prostatic hyperplasia
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910163065.0A CN109700836B (en) | 2019-03-05 | 2019-03-05 | Plateau nettle extract for resisting prostatic hyperplasia as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910163065.0A CN109700836B (en) | 2019-03-05 | 2019-03-05 | Plateau nettle extract for resisting prostatic hyperplasia as well as preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109700836A true CN109700836A (en) | 2019-05-03 |
| CN109700836B CN109700836B (en) | 2021-08-24 |
Family
ID=66266294
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910163065.0A Expired - Fee Related CN109700836B (en) | 2019-03-05 | 2019-03-05 | Plateau nettle extract for resisting prostatic hyperplasia as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109700836B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102512463A (en) * | 2012-01-06 | 2012-06-27 | 吉林省宏久生物科技股份有限公司 | Extraction method of nettle extract |
| CN106349304A (en) * | 2016-08-23 | 2017-01-25 | 上海交通大学 | Method for preparing high-purity Urticaside and Urticalignans |
-
2019
- 2019-03-05 CN CN201910163065.0A patent/CN109700836B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102512463A (en) * | 2012-01-06 | 2012-06-27 | 吉林省宏久生物科技股份有限公司 | Extraction method of nettle extract |
| CN106349304A (en) * | 2016-08-23 | 2017-01-25 | 上海交通大学 | Method for preparing high-purity Urticaside and Urticalignans |
Non-Patent Citations (3)
| Title |
|---|
| 冀保全等: "荨麻提取物对5α-还原酶抑制活性的研究", 《时珍国医国药》 * |
| 苏日娜等: "荨麻属药用植物研究进展", 《中草药》 * |
| 钱华等: "大荨麻根提取物对前列腺增生小鼠的治疗作用", 《中国药学杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109700836B (en) | 2021-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Oh et al. | Antidiabetic effects of extracts from Psidium guajava | |
| Kumarasamy et al. | Bioactivity of gentiopicroside from the aerial parts of Centaurium erythraea | |
| Lu et al. | A polysaccharide fraction of adlay seed (Coix lachryma-jobi L.) induces apoptosis in human non-small cell lung cancer A549 cells | |
| Han et al. | Formula PSORI-CM01 inhibits the inflammatory cytokine and chemokine release in keratinocytes via NF-κB expression | |
| CN106860500B (en) | Low-toxicity tripterygium glycosides, preparation method and application thereof | |
| CN101474193A (en) | Application of ginseng saponin IH901 in preparing angiogenesis inhibitor | |
| Lin et al. | Intervention of TLR4 signal pathway cytokines in severe liver injury with obstructive jaundice in rats | |
| Wu et al. | Combination of molecular docking and liver transcription sequencing analysis for the evaluation of salt-processed psoraleae fructus-induced hepatotoxicity in ovariectomized mice | |
| CN102716380B (en) | Compound acne-removal cream and production method thereof | |
| CN109700836A (en) | A kind of anti-prostatic hyperplasia plateau nettle extract, preparation method and applications | |
| CN110898102A (en) | Cinnamon extract and traditional Chinese medicine compound for preventing and treating cold injury and application thereof | |
| CN105030763A (en) | Application of wedelolactone in preparing drug for resisting ulcerative colitis | |
| CN101485721A (en) | Chinese medicinal composition for resisting allergic rhinitis | |
| Chen et al. | Hibiscus manihot L improves obesity in mice induced by a high-fat diet | |
| Huang et al. | Effect of fucoidan on kidney injury in type 2 diabetic rats based on PI3K/AKT/Nrf2 | |
| NL2030464A (en) | Aralia armata (wall.) seem-derived total saponin and use thereof in preparation of drug for treating post-vascular injury restenosis | |
| WO2005084689A1 (en) | Radix astragli extract and production method and use thereof | |
| CN102198120A (en) | Medicinal use of lithospermi naphthoquinone compounds | |
| CN108164574B (en) | Compound in caulis Sinomenii, and preparation method and application thereof | |
| CN101658647B (en) | Preparation method of traditional Chinese medicine women inflammation recovery preparation and detection method thereof | |
| CN105663150B (en) | A kind of application of phenylpropanoids and its pharmaceutically acceptable salt in the drug for preparing treatment diseases associated with inflammation | |
| CN114053283B (en) | Application of 3 beta, 23-O-isopropylidene hydroxyl betulinic acid in preparing medicine for treating non-alcoholic steatohepatitis | |
| Xu et al. | Mechanisms of action underlying the effect of Tongsaimai on wound healing based on experimental and network pharmacology | |
| Kasmadi et al. | Effect of giving ekor naga leaf extract gel (Rhaphidophora pinnata) on differential rat leukocytes induced by carrageenan air pouch | |
| CN114948977B (en) | Application of dihydroflavonoid glycoside derivative in preparation of medicines for preventing and treating colonitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210824 |