WO2005084689A1

WO2005084689A1 - Radix astragli extract and production method and use thereof

Info

Publication number: WO2005084689A1
Application number: PCT/CN2005/000216
Authority: WO
Inventors: Zhengzhong Cao; Minzhu Chen; Bin Wang; Weiping Li; Yuan Cao; Yan Yang
Original assignee: Hutchison Medipharma Enterprises Limited
Priority date: 2004-02-23
Filing date: 2005-02-23
Publication date: 2005-09-15
Also published as: CN1660167A; CN100459987C

Abstract

The invention discloses a Radix astragli extract and production method and use thereof. Such Radix astragli extract mainly comprises astragalus saponin, organic acid and astragalus flavonoid glycoside. Such production method consists of the following steps: hot reflux exacting the astragalus raw materials in alcohol, concentrating to obtain the extract; diluting the extract with water, then through the macroporous resin column until the effluent showing negative in saponin reaction, then eluting with water until the eluent showing negative in saccharide reaction, finally eluting with alcohol until the eluent showing negative in saccharide reaction; the alcohol eluent through recoverymg the alcohol, drying and bruising to obtain such Radix astragli extract. The invention also provides the use of such Radix astragli extract for the manufacture of varied medicaments.

Description

Astragalus extract, its preparation method and application in pharmacy

The invention belongs to the field of traditional Chinese medicine pharmacy, in particular to an astragalus extract, a preparation method thereof and application in medicine. Background technique

Yellow (Radix astragli) is the dried root of the legume Mongolian yellow Astragalus membranaceus (Fisch.) Bge. Var. Mongholicus (Bge.) Hsiao or Astragalus membranaceus (Fisch.) Bge. Excavate in autumn, remove roots and roots, and dry. Sweet and warm, return to the lung and spleen. Modern chemical studies have proven that Astragalus medicinal materials contain many types of ingredients, such as saponins, polysaccharides, flavonoids, amino acids, organic acids and trace elements.

At present, the research on the chemical and biological activities of astragalus total extracts and different extracts is very active. Modern research has proved that it has immune regulation and pharmacological effects on the cardiovascular system and digestive system. In recent years, interest in astragalus total saponins has mainly been related to its pharmacological activity on the cardiovascular system and antiviral myocarditis.

Astragalus total saponins are the main extracts of Astragalus, which contains saponins and flavonoid glycosides. Existing methods for preparing astragalus total saponins include water extraction method, alcohol extraction method, water extraction and alcohol precipitation method, resin adsorption and extraction, n-butanol extraction method, etc., but some of these methods are more complicated, and some extract yields Low, poor stability, and some remove many active ingredients, can not effectively play the medicinal value of astragalus. Summary of the invention

The object of the present invention is to avoid the deficiencies in the prior art mentioned above, and to provide an astragalus extract with reliable quality and good stability. The astragalus extract contains the following weight percentages: astragalus total saponins 53-80%, astragalus flavonoids 10-25%. Preferably, the astragalus extract contains the following weight percentages of substances: astragalus total saponins 74-80%, astragalus flavone glycosides 10-20%. The astragalus extract also contains 10-25% organic acids.

The astragalus extract can be prepared by the following steps:

a contact the astragalus raw material with an aqueous ethanol solution to obtain a solution;

b. The solution is concentrated to obtain an extract;

c. passing the extract through a resin column, eluting with a gradient of water and an aqueous ethanol solution;

d. Collecting the elixir obtained from the ethanol aqueous solution to obtain the astragalus extract.

Wherein, the resin in the step c may be selected from D-101, AB-8 or SIP-1300 type resin, and preferably D-101 type resin.

The weight ratio of the amount of the extract to the resin in step c may be 1: 5-10. The concentration of the ethanol aqueous solution in the step a is preferably 65-99%, and more preferably 80-99%. The step a is preferably performed under heating and refluxing conditions.

The concentration of the ethanol aqueous solution in the step c is preferably 70-90%.

Another object of the present invention is to provide a preparation method that is relatively simple, can effectively remove impurities, and retains the astragalus extract as described above. The preparation method includes the following steps:

b. The solution is concentrated to obtain an extract;

c passing the extract through a resin column, eluting with a gradient of water and an aqueous ethanol solution;

d. Collecting the fractions eluted from the ethanol aqueous solution to obtain the astragalus extract.

The weight ratio of the amount of the extract to the resin in step c may be 1: 5-10.

The concentration of the ethanol aqueous solution in the step a is preferably 65-99%, and more preferably 80-99%. The step a is preferably performed under heating and refluxing conditions.

Another object of the present invention is to provide the application of Radix Astragali extract in pharmacy. The use of the astragalus extract in the preparation of a medicament for treating or preventing immune-mediated chronic inflammatory diseases, and the use of the astragalus extract in the preparation of a medicament for treating or preventing rheumatoid arthritis and / or lupus erythematosus Applications. The medicine containing astragalus extract described in the application is made into an oral preparation.

Still another object of the present invention is to provide a method for treating or preventing immune-mediated chronic inflammatory diseases in individuals, and treating or preventing rheumatoid arthritis and / or erythema erythematosus in individuals.

Advantages of the invention:

The content of total saponins in astragalus extract provided by the invention is not less than 53%, up to 80%, of which astragaloside IV can reach 10%, reliable quality, good stability, low toxicity, high anti-inflammatory activity, provided preparation The method is relatively simple, can effectively remove impurities, retain the astragalus extract to the maximum, and the average yield can reach 1.20-2.0%. The provided astragalus extract has a variety of medicinal effects. Brief description of the drawings

Figure 1 shows that astragalus extract inhibits TNFa mRNA expression. detailed description

In order to achieve the above object of the present invention, the present invention provides an astragalus extract, which contains the following weight percentages of substances: astragalus total saponins 53-80%, astragalus flavonoids 10-25%. In a preferred embodiment, an astragalus extract containing the following weight percentage substances is provided: astragalus total saponins 74-80%, Astragalus flavonoids 10-20%. The astragalus extract also contains 10-25% organic acid.

The astragalus extract can be prepared by the following steps:

b. The solution is concentrated to obtain an extract;

Wherein, the amount of the ethanol aqueous solution in the step a is preferably 6-10 times the weight of the astragalus raw material.

The weight ratio of the amount of the extract to the resin in step c may be 1: 5-10, and in some preferred embodiments of the present invention, the weight ratio is 1: 8-10.

The extract is at 50 ° C. The relative specific gravity of C heat measurement is 1.10-1.45.

The invention also provides a method for preparing astragalus extract, comprising the following steps:

b. The solution is concentrated to obtain an extract;

Wherein, the amount of the ethanol aqueous solution used in the step a is 6-10 times the weight of the astragalus raw material.

The preparation steps and preparation methods of the astragalus extract may specifically include, but are not limited to, the following operations: a. Astragalus raw material is extracted by heating and refluxing for 1-3 times with 6-10 times the amount of 65-99% ethanol for 1-2 hours each time;

b. Filter off the drug residue, combine the extracts, recover ethanol and concentrate to 50. The specific gravity of C is 1.10-1.45, the extract is obtained;

c The extract is diluted with an equal volume of water and passed through a macroporous resin column. The weight ratio of the amount of the extract to the resin is 1: 5-10. The effluent should be negative for saponin, and then elute with water until the sugar is negative for the eluent. ; Finally elute with 70-90% ethanol, until the eluate is negative for sugar;

d. After recovering the alcohol, drying, and pulverizing the ethanol eluent, the astragalus extract is obtained with a yield of 1.20-2.0%.

The astragalus extract of the present invention can be used for preparing a medicament for treating or preventing an immune-mediated chronic inflammatory disease. The medicament can be made into an oral preparation.

The astragalus extract of the present invention can be used for preparing a medicament for treating or preventing rheumatoid arthritis and / or lupus erythematosus. The medicament can be made into an oral preparation. The present invention provides a method for treating or preventing an immune-mediated chronic inflammatory disease, the method comprising administering to an individual an effective amount of the astragalus extract of the present invention. The effective amount refers to a dose capable of achieving the desired effect of treating or preventing immune-mediated chronic inflammatory diseases. The method comprises administering an effective amount of the yellow extract of the present invention. The effective amount refers to a dose capable of achieving the desired effect of treating or preventing immune-mediated chronic inflammatory diseases. The present invention is further described below through examples. Example 1:

The astragalus raw material was extracted by heating and refluxing 8 times the amount of 75% ethanol twice for 1 hour each time. The residue was filtered off, the extracts were combined, and the ethanol was recovered and concentrated to 50. The specific gravity of C measured by Hunan is 1.15. The extract is obtained. The extract is added with an equal volume of water. After dilution, it passes through a macroporous resin column. The weight ratio of the extract to the resin is 1: 5. The effluent saponin reaction is negative. The water elutes until the sugar reaction of the eluent is negative, and finally the sugar reaction of the 80% ethanol eluent is negative; the ethanol eluate is recovered by alcohol, dried, and ground to obtain the astragalus extract with a yield of 1.61%. Astragalus extract contains 53% of astragalus saponins, 20% of organic acids, and 10% of astragalus flavones. Example 2:

The astragalus raw materials were extracted by heating and refluxing twice with 10 times the amount of 90% ethanol for 2 hours each time. The residue was filtered off, the extracts were combined, and the ethanol was recovered and concentrated to 50%. The relative specific gravity of C was 1.35 to obtain an extract. The extract was diluted with an equal volume of water and passed through a macroporous resin column. The weight ratio of the extract to the resin was 1: 10, and the saponin reaction in the effluent was negative. Then washed with water. After removing the eluent, the sugar reaction was negative, and finally the 90% ethanol eluent was used for the sugar reaction. The ethanol eluate was recovered by alcohol, dried, and ground to obtain the astragalus extract with a yield of 1.33%. Astragalus extract contains 60% of astragalus saponins, 15% of organic acids, and 15% of astragalus flavonoids. Example 3:

Astragalus raw materials are extracted by heating and refluxing 3 times with 10 times the amount of 85% ethanol for 2 hours each time. The residue is filtered off, the extracts are combined, and the ethanol is recovered and concentrated to 50. The relative specific gravity of C was 1.45, and the extract was obtained. The extract was diluted with an equal volume of water and passed through a macroporous resin column. The weight ratio of the amount of the extract to the resin was 1: 10, and the saponin reaction in the effluent was negative. Then washed with water. After removing the eluent, the sugar reaction was negative. Finally, the 80% ethanol eluent was used to recover the sugar reaction. The ethanol eluate was recovered, dried, and ground to obtain the astragalus extract with a yield of 2.0%. Astragalus extract contains 65% of astragalus total saponins, 13% of organic acids, and 20% of astragalus flavonoids. Example 4

The astragalus raw material was extracted by heating and refluxing three times with 70% ethanol for 6 times, each time for 1.5 hours. The residue was filtered, the extracts were combined, and the ethanol was recovered and concentrated to 50 ° C. The specific gravity of the heat was 1.25 to obtain a flow extract. The extract was diluted with an equal volume of water and passed through the D101 column. The weight ratio of the flow extract to the resin was 1: 7, and the saponin reaction in the effluent was negative. Then the column was washed with water until the sugar reaction was negative. Finally, 70% ethanol was used to elute The sugar reaction was negative; the ethanol eluate was recovered, dried, and ground to obtain the astragalus extract with a yield of 2.0%. Astragalus extract contains 53.2% of total astragaloside saponins, 20% of organic acids, and 17% of astragaloside flavonoids. Example 5

The astragalus raw material was extracted by heating and refluxing 8 times with 75% ethanol 3 times. At 2 'each time, the drug residue was filtered and the extracts were combined. After recovering the ethanol, it was concentrated to 50 ° C and the specific gravity was 1.35. The flow extract is diluted with an equal volume of water and passed through the D101 column. The weight ratio of the flow extract to the resin is 1: 5; the effluent has a negative saponin reaction; the column is washed with water until the sugar reaction is negative, and finally 90 ° / o ethanol is used. The sugar reaction of the eluent was negative; the ethanol eluent was recovered, dried, and ground to obtain the yellow extract, and the yield was 1.9%. Astragalus extract contains 63.3% of astragalus saponins, 15% of organic acids, and 15% of flavonoids. Example 6

Astragalus raw materials are extracted by heating and refluxing 3 times with 6 times the amount of 80% ethanol. At 2 'j, each time, the residue is filtered, the extracts are combined, and the ethanol is recovered and concentrated to 50 ° C. The specific gravity of the heat is 1.40. The flow extract is diluted with an equal volume of water and passed through the D101 column. The weight ratio of the flow extract to the resin is 1: 10, and the effluent is soapy or the reaction is negative. Then the column is washed with water until the sugar reaction is negative, and finally 80 ethanol is used to The eluent had a negative sugar reaction; the ethanol eluent was recovered, dried, and ground to obtain the astragalus extract (1123), with a yield of 1.85%. Astragalus extract (1123) contains 74.9% of astragalus total saponins, 15% of organic acids, and 10% of astragalus flavonoids. Example 7

Astragalus raw material was extracted by heating and refluxing three times with 10 times the amount of 95% ethanol for 1.5 hours each time. The residue was filtered and the extracts were combined. The ethanol was recovered and concentrated to 50 ° C. The specific gravity was 1.30, and the flow extract was obtained. The flow extract is diluted with an equal volume of water and passed through the D101 column. The weight ratio of the flow extract to the resin is 1: 8; the effluent saponin reaction is negative; then the column is washed with water until the sugar reaction is negative, and finally 90% ethanol is used to wash. The dehydration sugar reaction was negative; the ethanol eluent was recovered, dried, and ground to obtain the astragalus extract with a yield of 1.75%. Astragalus extract contains 79.1% of astragalus total saponins, 10% of organic acids, and 10% of astragalus flavonoids. Example 8 Preparation of Astragalus Extract according to literature method (Han Lujia, Yan Qiaojuan, etc .: Journal of Agricultural Engineering, 16 (5), 118, 2000)

The astragalus raw material was extracted by heating and refluxing 6 times with 60% ethanol 3 times for 2 hours each time. The residue was filtered and the extracts were combined. After the ethanol was recovered, it was concentrated to 50 ° C and the specific gravity was 1.30. The extract was diluted with an equal volume of water and passed through the AB-8 column. The weight ratio of the flow extract to the resin was 1: 10, and the effluent solution had a negative saponin reaction. Then the column was washed with double the column volume of water and finally washed with 95% ethanol. The dehydration sugar reaction was negative; the ethanol eluent was recovered, dried, and ground to obtain the astragalus extract (15803), with a yield of 2.3%. Astragalus extract (15803) contains 49.2% of total astragaloside, 8.3% of organic acid, and 7.1% of astragaloside. Example 9 According to the inhibitory activity of astragalus extract on the expression of precursor inflammatory factor TNF cx mRNA, the anti-inflammatory activity of extracts from different processes was compared.

Experimental Materials:

Astragalus membranaceus extract: commercially available astragalus medicinal materials, respectively prepared according to the method of Example 6 (extract 1123) and the method of Example 8 (extract 15803); dissolved by adding 10% dimethylsulfite (DMSO), The storage solution concentration was 10 mg / ml.

Normal human peripheral blood mononuclear cells: take healthy human peripheral blood, heparin (62.5 U / ml) anticoagulated, Ficoll isolates blood cells, and resuspend the cells in IMDM medium containing 10% fetal bovine serum.

bDNA Nucleic Acid Quantification Kit: GenoSpectra, USA, trade name is QuantiGene Kits. ProbeDesigner Software (Bayer, Germany) was used to design the nucleic acid probe against the TNF a mRNA sequence. The probe sequence is as follows: Table A TNF a mRNA bDNA nucleic acid probe

Probe target location function probe sequence

hTNFaOl 395-417 CE gttcgagaagatgatctgactgcTTTTTctcttggaaagaaagt hTNPa02 457-474 CE agctgcccctcagcttgaTTTTTctcttggaaagaaagt hTKFa03 585-605 CE ggcagccttggcccttgaTTTTTctcttggaaagaaagt hTNFa04 647-667 CE cttggtctggtaggagacggcTTTTTctcttggaaagaaagt hTNFa05 763-784 CE acccttctccagctggaagaccTTTTTctcttggaaagaaagt TNFa06 888-905. CE ggaggcgtttgggaaggtTTTTTctcttggaaagaaagt hTNFa07 946-967 CE tttttgagccagaagaggttgaTTTTTctcttggaaagaaagt hTNFa08 988-1007 CE agttctaagcttgggttccgTTTTTctcttggaaagaaagt hTNPa09 418-436 LE tacaggcttgtcactcgggTTTTTaggcataggacccgtgtct hTNFalO 437-457 LE gggtttgctacaacatgggcTTTTTaggcataggacccgtgtct hTNFal l 475-491 LE ggcggttcagccactggTTTTTaggcataggacccgtgtct hTNFal2 492-509 LE ccaggagggcattggcccTTTTTaggcataggacccgtgtct hTNFal3 510-527 LE tcagctccacgccattggTTTTTaggcataggacccgtgtct hTNPal4 548-566 LE ggtacaggccctctgatggTTTTTaggcataggacccgtgtct hTNFal5 567-587 LE agaggacctgggagtagatgaTTTTTaggcataggacccgtgtct TNFal6 606-626 LE tgaggagcacatgggtggaggTTTTTaggcataggacccgtgtct hTNFal7 627-646 LE gatgcggctgatggtgtgggTTTTTaggcataggacccgtgtct hTNFal8 668-687 LE atggcagagaggaggttgacTTTTTaggcataggacccgtgtct hTNFal9 740-762 LE cctcccagatagatgggctcataTTTTTaggcataggacccgtgtct TNFa20 785-805 LE gatctcagcgctgagtcggtcTTTTTaggcataggacccgtgtct hTNFa21 806-825 LE tcgagatagtcgggccgattTTTTTaggcataggacccgtgtct hTNFa22 8826-843 LE tgcccagactcggcaaagTTTTTaggcataggacccgtgtct TNFa23 866-887 LE tggatgttcgtcctcctcacagTTTTTaggcataggacccgtgtct hTNFa24 968-987 LE accctaagcccccaattctcTTTTTaggcataggacccgtgtct hTNFa25 1032-1053 LE cacattcctgaatcccaggtttTTTTTaggcataggacccgtgtct hTNFa26 1054-1073 LE gcaattcactgtgcaggc caTTTTTaggcataggacccgtgtct hTNPa27 528-547 BL caccaccagctggttatctc

hTNFa28 688-704 BL tctggcaggggctcttg

hTNPa29 705-721 BL cccctctggggtctccc

hTNFa30 722-739 BL ccagggcttggcctcagc

hTNFa31 844-865 BL ggcaatgatcccaaagtagacc

TNFa32 906-925 BL aataaagggattggggcagg

TNFa33 926-945 BL gggtgtctgaaggagggggt

hTNFa34 1008-1031 BL cgaagtggtggtcttgttccttaa Other reagents: Cell culture medium and fetal bovine serum Gibco's products; Endotoxin (LPS), dexamethasone (DEX) and DMSO are products of Sigma, USA Real method:

1. According to the design rules provided by the manufacturer of the bDNA nucleic acid quantification kit, design and synthesize specific probes and non-specific blocking probes for tumor necrosis factor (TNF-α) mRNA, and dissolve them in ribozyme-free water.

2. Freshly extracted human peripheral blood mononuclear cells were suspended in IMDM medium containing 10% fetal bovine serum, counted by placental blue staining exclusion method, and adjusted the cell suspension density to 3 X 10 ³ cells / ml. In a round bottom 96-well culture plate, add 100 μl of cell suspension to each well, and the total number of cells in each cell is 2 × 10 ⁴ .

Dilute the sample solution with 10% dimethyl sulfoxide (DMSO) solution. According to the total saponin content of astragalus in two samples, dilute 1123 by 1.522 times with the medium to make the total glycoside content consistent. Add 10 microliters of astragalus extract sample diluted with culture medium to each well to make the final concentration of yellow saponin in the culture medium 16.40; 5.47; 1.8 ug / ml. The negative control was dexamethasone with a final concentration of 5 uM. Repeat three wells for each concentration.

Incubate the medicated cells in a 37 ° C, 5% CO2 cell incubator for 15 minutes.

In addition to the blank control, add 10 microliters of diluted endotoxin (LPS) to each well to a final concentration of 100ng / ml in the medium, and continue to incubate in the incubator for 60 minutes.

Add 5.5 microliters of buffer for TNF-a mRNA-specific probes and other non-specific blocking probes to 5.5 ml of the cell lysate provided in the nucleic acid quantification kit.

8. Remove the cell culture plate from the incubator, add 50 μl of the above-mentioned cell lysate containing the probe to each well, mix and lyse at 53 ° C for 20 minutes.

Quantitatively pipette 100 μl of the cell lysate from step 8 into the nucleic acid quantification assay in the capture culture plate provided in the box and incubate in a 53 ° C incubator for 16-18 hours.

10. Wash the plate with a washing solution containing 10% SSC buffer solution, and immediately add 100 μl of the diluted signal amplification probe provided in the kit, and incubate at 49 ° C for 60 minutes.

11. Wash the plate with a washing solution containing 10% SSC buffer solution, and immediately add 100 μl of the diluted enzyme-labeled dendritic nucleic acid probe provided in the kit and incubate at 49 ° C for 60 minutes.

12. Wash the plate with a washing solution containing 10% SSC buffer solution, and immediately add 100 μl of the diluted chemiluminescent substrate provided in the kit, and incubate at 46 ° C for 30 minutes in the dark.

13. Measure the luminous intensity of each well in a 40Ό constant temperature multi-label measuring instrument, and calculate the inhibitory effect of the drug on the overexpression of inflammatory factors caused by endotoxin in combination with the concentration of the drug.

Astragalus extract treatment group-blank control group

Relative inhibition rate (%) = (1-) X 10O

Endotoxin treatment group-blank control group

Real-face results:

Astragalus extract's inhibitory effect on endotoxin-induced inflammatory factor TNF-a mRNA was dose-dependent, and the different intensity of astragalus extract on inflammatory factor TNF-a mRNA was different. The results are shown in Figure 1. Table B

The above test results show that the anti-inflammatory activities of the two astragalus extracts are significantly different. Pharmacodynamic experiments:

In the experiment, the medicine of the present invention (hereinafter referred to as astragalus total soap ring) was prepared according to Example 6, and was used in vivo, and was formulated with 1% sodium carboxymethyl cellulose (CMC-Na). It was used in vitro, dissolved in dilute ethanol, and then used for nutrition. Dilute the solution to the required concentration (final ethanol concentration is less than 1%.).

Data are expressed as mean ± S. The t-test was used to compare the sample mean between the measurement data groups; the X ² test was used to compare the count data.

Animals: Wistar rats, both male and female, 2-3 months old, weighing 1.60 ± 10s; BALB / C mice, both male and female, 6-8 weeks of age, weighing 18 ± 2s: C ₅₇ BL / 6J mice, Male, 6-8 weeks old, weighing 18 ± 2s: Kunming mice, 7-8 weeks old, weighing 20 ± 2s.

Dose setting, administration method and experimental control:

The real face is generally divided into three control groups (normal control, model control, positive control, and test drug) (some exceptions). The overall experimental dose range is 5-100mg'kg, divided into low, medium and high dose groups according to 1: 2-1: 4 dose intervals, administered intragastrically (ig), normal and model control group ig 1% CMC -Na, equal capacity. The choice of dosage and administration time depends on different models. Positive control drugs were indomethacin (Indo); dexamethasone (Dex). Astragaloside (ASI); Tripterygium glycoside (TS); Gynostemma pentaphyllum (GPS); Ginsenoside (GS), etc. The choice depends on different models.

In the following experimental data, do is the day of creation, d-n ~ n or d-i! ~ + N Among -n is n days before modeling, and n or + n is 11 days after modeling.

Experiment 1: Anti-inflammatory effect of astragalus total saponins on rats

experimental method:

1.1 Preparation of rat adjuvant arthritis (AA) model

Place BCG 80. C lh was inactivated, and sterilized liquid paraffin was used to prepare lOmg'mr ¹ . Mix thoroughly into Freund's Complete Adjuvant (FCA). Inflammation was induced by intradermal injection of 0.1 ml into the left hind plantar of each mouse. Measure the hind paw volume on the injection and non-injection sides. Changes in volume before and after inflammation represent primary and secondary inflammatory responses, respectively.

1.2 Preparation of rat collagen arthritis (CIA),

Dissolve chicken type II collagen (CC II) with 0.1 mol-L- ¹ acetic acid a little, then prepare with 0.1 mol-L " ¹ PBS, according to 1: 1 (V: V) and Freund's incomplete adjuvant (GIBCO product) Mix so that the final concentration of CC II is S mg-mr ^. Intramuscular injection of 0.1ml in the left hind plantar of each rat causes inflammation, and it will be strengthened once a week. The score criteria for rat multiple arthritis is as follows: 0 = normal, 1 = red only, 2 = red + light swelling, 3 = severe swelling, 4 = joint deformity, rigidity; the joint score of each animal is the sum of the limb scores.

1.3 Carrageenan Induced Foot Swelling in Rats

Each mouse was injected subcutaneously with 1% carrageenan (prepared by NS) in the left hindfoot plantar to induce inflammation. Paw pits were detected before and 3, 5 and 7 h after inflammation, and the difference between the volume before and after inflammation was taken as the swelling.

1.4 Rat croton oil and gas scab granuloma hyperplasia model

Subcutaneously (sc) 20ml of air was injected subcutaneously (sc) into the back of the rat to form air sacrifice, and then 1% croton oil 1ml was mainly injected into the air sacrum, and the rat was immediately turned down to make it evenly touch the wall of the sacral wall. After 24 hours, the air in the iliac crest was evacuated. The rats were sacrificed on day ₈ and the granuloma in the iliac wall was peeled off, weighed wet, rinsed with NS and placed at 80. C oven 6h, weigh the dry weight, express the result in g / 100g body weight.

1.5 Detection of serum type II collagen antibodies

The plate was coated with 20 / zg'mr ¹ type II collagen (C II) at 100 / d per well. ⁴ . C overnight, washed 3 times with 2% BSA 37. Incubate for 1 h at C, wash 3 times, add 1:40 dilution of the test solution, incubate at 37 ° C for 1 h, wash 3 times; add 1: 200 diluted # sheep anti-rat IgG-HRP 100 μ, 37 ° Incubate for ¹ h at C, wash 3 times; add substrate solution, protect from light at room temperature for 20 min, and stop the reaction with 2mol·L— ¹ H ₂ S0 ₄ . The measurement was performed at a wavelength of 492 nm in a microplate reader, and the results were expressed as the average A value of three complex wells.

1.6 Detection of OX19, W3 / 35 and OX8 subpopulations in peripheral blood lymphocytes

The anticoagulated tail vein blood of each mouse was divided into 4 tubes of 0.1 ml each. Add 0.1ml OX2 1 (anti-human C3b, blank control), OX19 (CD3), W3 / 25 (CD4) and OX8 (CD8) monoclonal antibodies (blessed by Professor Puklavec, University of Oxford, UK) with 2% FCS-RPMI 1640 Make 1: 5 dilution, 4. C Warm for 40 min, add cell wash solution (2% FCS-RPMI 1640 medium). Each tube was 3ml, mixed well, centrifuged (1500rpm, 5min), and washed 3 times. Add 0.1ml goat anti-mouse IgG-FITC (diluted 1: 2 with 2% FCS-PBS) to each tube, 4. C incubate for 40 min. Wash with the above cell washing solution. After centrifugation once, add erythrocyte lysate to destroy the red blood cells. After washing in the same way, resuspend the cells with 1 ml of the washing solution to detect the activity (> 96%). In a FACS 420 flow cytometer (US BD) Company). The software program provided by BD was used for fluorescence intensity analysis, and the results were expressed as the percentage of positive cells.

1.7 Isolation and culture of synovial cells The synovial membranes of the bilateral knee joints of the rats were aseptically removed, and the individual cells were broken down with type II collagenase and trypsin. With 5

LPS in DMEM culture medium formulated synovial cell suspension (5xl0 ^5. Mr ^1), added to 24-well culture plate, lml of each well, 37. C and 5% CO _{2 were} cultured for 48 h. Cell culture supernatants were collected and tested for IL-I activity and No ₂ -content.

1.8 Determination of NO ₂ -in synovial cell culture supernatant

Griess reagent (containing 1% p-aminobenzenesulfonic acid, 0.1% naphthylene diamine hydrochloride, and 2.5% phosphoric acid) was used to detect NO ₂ -levels (as a measure of NO content).

Experimental results:

(1) Effect on carrageenan-induced foot swelling in rats

Grouped and administered according to Table 1. Lh ig drugs or solvents before inflammation. The results showed that all three dose groups of astragalus total glucoside (human ST) could significantly inhibit swelling of carrageenan in rats. The strength of the medium dose group was similar to that of triptolide (Ts). Table 1 Effects of Astragalus Total Saponin (AST) on carrageenan-induced foot swelling in rats Group Dose Amount of foot swelling caused by inflammation (Δπύ)

(ng. kg " ¹ ) 1 3 5 7 (h) Control-0.51 ± 0.12 0.82 ± 0 · 18 1.06 ± 0.24 0 · 76 ± 0.17

AST 20 0.47 ± 0.10 067 ± 0.15 0.73 ± 0.18 ** 0.53 ± 0.15 **

40

0.43 ± 0.11 0.59 ± 0.14 ** 0.69 ± 0.16 ** 0.44 ± 0.10 ** 80

0.37 ± 0.11 * 0.56 ± 0 · 13 ** 0 · 68 ± 0.15 ** 0.46 ± 0.14 **

TS 15

0.45 ± 0.11 0 · 58 ± 0 · 12 ** 0.70 ± 0.17 ** 0.47 ± 0 · 13 **

TS: Tripterygium glycosides. Lhig drug or volume before carrageenan-induced inflammation, c ± S, n = 10, * p <0.05, ** p <0.01, compared with the control group

(2) Effect on adjuvant (FCA) -induced primary inflammatory response in rats

Grouped and administered according to Table 2. After inflammation induced (¾_ ₅ proinflammatory side measuring paw volume results show, AST (30 and 90mg · kg) significantly inhibited primary acute inflammatory reaction caused by FCA. Table 2 Effect of AST on primary inflammation in adjuvant arthritis (AA) rats

Group dosage Amount of swelling caused by inflammation of the feet (Δηύ)

(mg-kg " ¹ ) dl d3 d5

AA control-0.86 ± 0.23 1.02 ± 0.25 0.67 ± 0 · 17

AST 30 0.81 ± 0.24 0.73 ± 0.22 * 0.42 soil 0.18 **

90

0.70 ± 0.28 0.59 ± 0.24 ** 0.33 ± 0.15 **

Indo 2

0.55 ± 0.21 * 0.44 ± 0.18 ** 0.25 ± 0.13 **

Indo: indomethacin. Do use FCA to cause inflammation, do ~ 4ig solvent or drug.

± S, n = 10, * p <0.05, ** p <0.01, compared with AA control

(3) Effect on croton oil and gas scab granuloma proliferation in rats

Grouped according to Table 3 with ig administration, once a day, continuous cd ^ d ^ The results show that the AST doses (20, 40, and 80 mg · kg) group and TS have an increase in airborne granuloma in rats caused by croton oil Significant inhibition. Table 3 Effects of Croton Oil Balloon Granuloma Hyperplasia in Rats

Group dosage Amount of granuloma (g / 100g body weight)

(mg · kg " ¹ ) Wet and dry weight control 2.40 ± 0.59 0.53 ± 0.14

AST 20 1.34 ± 0.34 ** 0.30 ± 0.06 **

40

0.98 ± 0.48 ** 0.23 ± 0.12 **

80

TS 15 1.73 ± 0.73 ** 0.30 ± 0.10 **

1.33 ± 0.66 ** 0.26 ± 0.12 **

do with 1 ° /. Croton oil causes inflammation, d-1 ~ d5 ig drugs or solvents. ; C ± S, n = 10 ~ 12, * p <0.05, ** p <0.01, compared with the control group

(4) The therapeutic administration of AA rats therapeutic effect of secondary inflammatory reaction and immune function will polyarthritis murine Table 4 Grouping and administration (d ₁₂ ~ d ₁₉₎ by, starting from d ₁₂ measured inactivated The volume of the paw on the inflamed side was observed every 4 days for 12 consecutive days. d ₂₄ Simultaneously test the following indicators: (1) Peritoneal macrophages (Μφ) produce IL-1, (2) ConA proliferation response of splenic lymphocytes, (3) synovial cell secretion function (IL-1, NO content ), (4) Histopathological examination of bilateral knee and ankle joints in rats. Table 4 shows that the three doses of AST (20, 40, and 80 mg 'kg— ^) can significantly inhibit AA. Swelling of non-inflammatory side feet in rats, which works better in large doses. Histopathological reports show that compared with normal rats, AA rats have severe synovitis (hyperemia of synovial tissue, edema and inflammatory cell proliferation, and hyperplasia of synovial tissue) on both knee and ankle joints, articular cartilage Damage (atrophy, thinning, or disappearance), and osteomyelitis (inflammation of inflammatory cells in the bone marrow cavity). AST can significantly alleviate the above pathological changes. Although Dex has a stronger effect on inhibiting secondary inflammatory reactions in AA rats than AST, the degree of lesion reduction is not as good as the latter. The result of failure 5 showed that after the administration of AST, it could restore the thymus coefficient of AA rats, but had no significant effect on the spleen coefficient. The results in Table 6 show that AST can reduce the proliferation of ConA in spleen cells of AA rats and restore normal levels of IL-1 secretion from excessive IL-1; Dex reduced both indicators. The results in Table 7 show that AST can significantly reduce the excessive secretion of IL-I and NO by synovial cells of AA rats, while Dex reduces both to below normal levels.

Effect of AST treatment administration on secondary inflammatory response in AA rats Group dose Amount of swelling of the foot (Ami)

(mg · kg " ¹ ) dl2 dl6 d20 d24

AA control-0.48 ± 0.14 0.70 ± 0.22 0.83 ± 0.25 0.88 ± 0.29

AST 20 0.50 ± 0 · 16 0.57 ± 0 · 17 0.61 ± 0.19 * 0.70 ± 0.20

40

0.49 ± 0.15 0.53 ± 0.15 0.55 ± 0.17 ** 0.61 ± 0.18 *

80

0 · 50 ± 0.16 0.48 ± 0.13 * 0.51 ± 0 · 15 ** 0.49 ± 0.14 **

Dex 0.5

0.50 ± 0.14 0.15 ± 0.12 ** 0.12 ± 0.09 ** 0.18 ± 0.12 ** do FCA causes inflammation, dl2 ~ 19 ig solvent or drug. x ± S, n = 10, * p <0.05, ** p <0.01, compared with AA control Table 5 Effect of AST treatment administration on the weight of immune organs in AA rats Group dose Quantity Thymus coefficient Spleen coefficient ^

(mg-kg " ¹ ) (%) (%)

Normal control-0.16 ± 0.05 0.31 ± 0.04

AA control-0.11 ± 0.04 * 0.28 ± 0.03 *

AST 80

0.15 ± 0.04 0.29 ± 0.08

Dex 0.5

^{0.08 ± 0.02 ** ## 0.20 + 0.03} ** "" ^NOTE: ώ organ coefficient was: g weight AOOg organ weight, d ₀ with FCA-induced inflammation, d ₁₂ -i ₉ ig solvent or medicament, d ₂₄ taken out of each group The thymus and spleen of each rat were weighed. X ± S, n = 10. * p <0.05, ** p <0.01, compared with the normal control group; "" p <0.01 compared with the AA control. AST treatment and administration to ConA proliferation response and peritoneal macrophages of splenocytes of AA rats

Effect of secreting IL-1 activity

Group Dose ConA Proliferation response IL-1 activity

(mg. kg " ¹ ) (cpm 10" ³ ) (cpm 10 " ³ )

Normal control-27.4 ± 3.7 7 · 1.2

AA control-14.2 ± 2.8 ** 15.4 ± 2.9 **

AS 80

25.3 ± 3.5 ^## 8.0 ± 2.2 ^##

Dex 0.5

7.8 ± 0.8 ** ^## 4.2 ± 0.8 ** ^## do use FAC to cause inflammation, dl2-19 ig solvent or drug, d24 in vitro to detect ConA proliferation response of spleen lymphocytes and produce IL-1 by intraperitoneal MΦ. ± S, n = 4. ** p <0.01, compared with normal control; ** p <0.01, compared with AA control.

Effect of AST on the secretory function of synovial cells in AA rats

Group dose IL-1 activity NO, "

(mg ■ kg " ¹ ) (cpm 10" ³ ) (nmol / 10 ^-6 )

Normal control-8.9 ± 1.3 16 ± 4

AA control ― 17.8 ± 2.9 ** 91 ± 10 **

AST 80

9 · 1 ± 1.4 ^# 42+ 6 *** *

Dex 0.5

5 · 1 ± 0.7 ** ^# "12 ± 3 ^##

d0 was induced by FCA, dl2 ~ 19 ig solvent or drug, and d24 was used to detect the content of IL-1 and NO secreted by synovial cells in vitro. Soil S, n = 4, ** p <0.01, compared with normal control; ^# p <0.05, p <0.01, compared with AA control. (5) Effect of prophylactic administration on secondary inflammatory response in adjuvant arthritis (AA) rats

Grouped and administered according to Table 8 (d _Q ~ d ₁₂ ). From ₁₅ days, the volume of the non-inflammatory side paw was measured, every 3 days, and the observation was continued for 12 days. The results showed that AST (30 and 90 mg · kg) prophylaxis significantly inhibited foot swelling on the non-inflammatory side of AA rats. Table 8 Effect of AST prophylaxis on secondary inflammatory response in AA rats

(mg kg ¹ ) dl5 dl8 d21 d24

AA control-0.05 ± 0.15 0.73 ± 0.17 0.81 ± 0.22 0.84 ± 0.24

AST 30 0.30 ± 0.11 ** 0.51 ± 0.15 * 0.557 ± 0.13 * 0.64 ± 0.15

90

0.27 ± 0.10 ** 0.47 ± 0 · 15 ** 0.51 ± 0.15 ** 0.59 ± 0 · 17 *

Indo 2

0.26 ± 0.11 ** 0.49 ± 0.14 ** 0 · 54 ± 0.15 * 0 · 62 ± 0 · 18 * Do inflammation with FCA, d0 ~ 12 ig solvent or drug. x soil S, n = 8-9, * p <0.05, ** p <0.01, compared with AA control

(6) Effect on the therapeutic effect and immune function of collagen arthritis (CIA) in rats

On day ₁₈ after inflammation, rats with arthritis were randomly divided into groups and administered with ig according to Table 9 once a day for 8 consecutive days. The results showed that AST (medium and high-dose groups) had a significant effect on the treatment of tadpoles, and could significantly inhibit the production of type II collagen antibodies (Table 10) and restore the imbalance of peripheral blood lymphocyte subsets in CIA rats (Table 13- 11). Table 9 Arthritis scores of AST in the treatment of collagen arthritis (CIA) in rats ^#

Group (mg kg ¹ ) dl8 d24 d30 d36 d42

CIA control 0 dl8- -25 5 · 4 ± 1 · 5 5.9+ 1.4 6.4 ± 1.4 6.4 ± 1.8 6.2 ± 1.2

TS 20 dl8- -25 5.6 ± 1.7 4.7 ± 1.2 ^Δ 4.8 ± 1 · 6 ^Δ 4 · 5 ± 1 · 6 ^Δ 4.2 ± 1.0 ^ΔΔ

AST 5 dl8 '-25 5.0+ 1.5 5.6+ 1.7 5.8 ± 1.6 5.8 ± 1.6 5.7 ± 1.5

20 dl8- -25 5.2 ± 1.3 4 · 9 ± 1 · 2 ^Δ 4.7 ± 1.4 ^Δ 4.3 ± 1.2 ^ΔΔ 4.1 ± 1 · 4 ^ΔΔ

80 dl8- -25 5.7 soil 1.8 4 · 7 ± 1.5 ^Δ 4 · 5 ± 1.1 ^FREE ^Δ 4.0 · 1.4 ^{Δ FREE} 4.0 ± 1.0 ^ΔΔ

#Highest score is 16

Shi ^{S, η = 6, Δ ρ} <0.05, ΔΔ ρ <0.01, compared to the arthritic controls. Table 10 Effect of AST on serum type I collagen antibodies in CIA rats

'' Group dose (mg-kg " ¹ ) A value (492nm, d30)

CLA control 0 0.686 ± 0.047

TS 20 0.412 ± 0.051 ^ΔΔ

AST 5 0.607 ± 0.065

20 0.544 ± 0.039 ^Δ

80 0.437 ± 0.041 "

ρ <0.05, ^ΔΔ ρ <0.01, compared with the arthritis control group. Table 11 Effects of AST on peripheral blood lymphocyte subsets in CLA rats Group dose lymphocyte subsets (%, d28)

(mgkg) OX19 ⁺ W3 / 25 ⁺ 0X8 + normal control 0 63.20 ± 6.58 47.64 ± 3.14 25.47 ± 7.53

CLA control 0 61.47 ± 7.29 37.03 ± 5.67 44.20 ± 7.40

TS 20

60.59 ± 6.48 39.86 ± 6.72 32.18 ± 6 · 97 ^ΔΔ

AST 5

62.93 ± 7.18 38.44 ± 6.81 40.52 ± 6.08

20

64.38 ± 8.22 39.16 ± 7.23 34.46 ± 7.02 ^Δ

80 62.47 ± 5.93 42.67 ± 5.28 ^ΔΔ 31 · 34 ± 5 · 65 ^ΔΔ

; c ± S, n = 6, ^Δ ρ <0.05, ^ΔΔ ρ <0.01, compared with the arthritis control group Experiment 2: Immunomodulatory effects of astragalus total saponins on mice

Practical method:

2.1 Establishment of delayed hypersensitivity (DTH) in mice

The mice were sensitized with a 1% dinitrofluorobenzene (DNFB) acetone solution in 25μ1 and intensified once the next day. d _{4 The} right ear was coated with 1% DNFB 10 μl and challenged. After 24 hours, the mice were sacrificed. Each of the left and right ear pieces with a diameter of 8 mm was weighed. The difference between the weights of the two ear pieces was taken as the swelling degree. Immediately after the mice were sensitized ip, cyclophosphamide (Cy, 180mg · kg- ^ 3 days (d ₃₎ prior to or sensitized ip Cy (250mg · kg), the mice can induce DTH responses were lower and higher.

2.2 Induction and detection of hemolysin antibodies (IgM) in immunocompromised mice

BALB / ip C mice 10% SRBC suspension 0.2ml (4xl0 ⁸ cells / mouse) sensitization, each mouse simultaneously sc Cy 80 mg · kg in mice induced immune function. d ₅ According to the modified Simpson method, the IgM production of spleen cells was measured with a spectrophotometer (in = 413 nm), and the scab was expressed as absorbance A.

2.3 Mouse spleen lymphocyte mitogen response

A spleen cell suspension (K mr ¹ cells) was prepared routinely. On a 96-well culture plate, add 100 μl of cell suspension (final concentration 5 × ^{10 6} · mr ¹ ), 50 μ \ ConA (final concentration · ml) or LPS (final concentration 6 / xg-ml ^-1 ) to each well, and different Concentration AST or nutrient solution, at 37. C, 5% C0 ₂ and saturated humidity for 48h, 6h before termination, add [ ³ H] TdR (1.4xl0 ⁴ Bq) to each well. After the culture was completed, cells were harvested, and the radioactivity was measured with a FJ-2107 liquid scintillation counter (produced by Xi'an 262 Factory), and the results were expressed as the average value of cpm of 3 multiple holes.

2.4 Induction and detection of IL-1

Rat peritoneal cell suspension (2 × 10 ^δ · ιηΓ ¹ ) was routinely prepared with RPMI 1640 medium »added 24 In a well culture plate, set 1 ml / well at 37. C and 5% CO _{2 were} cultured for 2 h to obtain monolayer macrophages (Mφ), and 0.8 ml of RPMI 1640 culture solution, 100 μL of LPS (final concentration. Mr ¹ ), and AST or nutrient solution of 100 μl in different concentrations were added, and set at 37. C, 5% CO _{2 for} 6 h, discard the nutrient solution containing the drug and LPS, and wash the cells twice with the pre-warmed nutrient solution. Add the nutrient solution to the original amount, continue to cultivate for 48h, collect the supernatant, -20. CSave the test. The mouse thymocyte proliferation method was used to express the activity of IL-1 in terms of [ ³ H] TdR incorporation.

2.5 Induction and detection of IL-2

Routine preparation of rat spleen cell suspension (ΙχΙΟ ⁷ · ηιΓ ¹ ) »On a 24-well culture plate, add 0.5 ml of cell suspension, 0.25 ml of ConA (final concentration · ml — ¹ ), and different concentrations of drugs or nutrition Solution (final volume 1 ml).向 37。 Set 37. C, 5% CO _{2 for} 6 h. Wash the cells twice with Hank's solution containing 5% calf serum to remove the drug and ConA, reconstitute the cell suspension, 1ml per well, and continue to culture for 48h. After the incubation, collect the supernatant at -20. CSave the test. The activated mouse spleen cell method was used to express the activity of IL-2 in terms of [ ³ H] TdR incorporation.

Experimental results:

(1) Effect on mitogen response of splenic lymphocytes in normal mice

Group 12 and ig were administered according to Table 12 for 7 consecutive days, and the proliferation and response of ConA and LPS of spleen lymphocytes of each group were measured in vitro at d ₈ . The results showed that the three doses of AST had no significant effect on the proliferation response of ConA and LPS in splenocytes of normal mice. Table 12 Effects of AST on mitogen response of splenic lymphocytes in normal mice [ ³ H] TdR incorporation (cpmx 10- "

Solvent-13.8 ± 1.3 8.9 ± 1.0

AST 10 13.1 ± 1.1 * 8.7 ± 0 · 8 *

30

13.9 + 1.4 * 8.3 ± 0.7 *

90

13 · 3 ± 1 · 1 * 8.5 ± 0.7 *

; ± S, n = 8, * p <0.05, compared with the solvent control group

(2) Effect on cyclophosphamide (Cy) to reduce DTH response in mice

Grouped and administered according to Table 13 (d _G ~ d ₄ ), d _{5 was used to} detect the degree of ear swelling of mice in each group. The results showed that the three doses of AST had different degrees of antagonism on the DTH response of Cy reduction, and returned to normal levels as the dose of AST increased. Table 13 Effects of AST on Cytically Reduced Delayed Hypersensitivity (DTH) in Mice

Number of animals

(mg · kg) (Amg) Solvent ― 10 22.6 ± 2.0

Cy a 10 15.2 ± 3.0 **

Cy + AST 10 9 17.5 ± 3.0 **

30 10 20.8 ± 3.6 ^##

90 '10 22.2 ± 3.2 ^##

Cy soil ASl 50 10 21.1 ± 2.5 ^##

AS1: Astragalus saponin tincture, dO ip Cy 180mg · kg ^-1 ; d0 ~ 4ig solvent or medicine.

Soil S, ** p <0.01, compared with the solvent group; ^## p <0.01, compared with the Cy group. (3) Effect on DTH response in mice with increased Cy

Table 14 Grouping and administration (d_ ₃ -d ₊₄₎ Press, d ₅ detects ear swelling of the mice. The results showed that the three doses of AST reduced the DTH response of Cy-increased mice in a concentration-dependent manner. The high-dose group had similar effects to ginsenoside (100 mg · kg— ^). Table 14 Effects of AST on Cyclic DTH in mice degree

Number of animals

(mg-kg— ¹ ) (Δη¾) Solvent 1 10 19 · 8 ± 2 · 1

Cy ― 10 27.9 ± 3.2

Cy + AST 25 10 24.2 ± 2.9 * * ^#

50 10 21.0 ± 2.4 ^##

100 10 19.2 ± 2.0 ^##

Cy + GS 100 9 19.9 ± 2.3 ^##

GS: ginsenoside, d-3 ip Cy 250 mg · kg "¹; d-3 ~ d + 4 ig solvent or drug

± S, ** p <0.01, compared with the solvent group; ^# p <0.05, p <0.01, compared with the Cy group.

(4) Effect of Cy on IgM production in mouse spleen cells

Grouped and administered according to Table 15 (d_ ₂ ~ d ₊₄ ), d _{5 was used to} detect the amount of IgM produced by spleen cells in each group of mice. The results showed that AST had a dose-dependent antagonistic effect on Cy inhibiting IgM production in mice, and the effect in the high-dose group was significantly better than total gypenosides (GPS :). Effect of AST on Cytosolic IgM Production in Mouse Spleen Cells

Group A value

(mg · kg ^_1 )

Solvent-0.62 ± 0.06

Cy ― 0 · 32 ± 0.05 **

Cy + AST 20 0.37 ± 0.05 **

40 0.48 ± 0.07 ** ^##

80 0.60 ± 0.07 ^##

Cy + GPS 200 0.52 ± 0 · 07 ** ^##

GPS: Gypenosides, dOscCySOmg -kg- d g solvent or drug.

X soil S, ** p <0.01, compared with the solvent group; ^## p <0.01, compared with the Cy group.

(5) Effect on the function of major immune cells in vitro

In the range of 1 · ml ~ 25, AST can significantly promote the suboptimal dose of ConA (3 / g · ml) and ^{LPS (6 / g · ηιΓ 1} ) were induced proliferative response of mouse spleen lymphocyte and a suboptimal dose of LPS-induced promotion of large Murine peritoneal macrophages produce IL-1, and suboptimal ConA induces rat splenocytes to produce IL-2. Their dose-response curves are bell-shaped. It shows that AST has a concentration-dependent two-way regulation effect on the proliferation or secretion function of three immune cells. Experiment 3: Analgesic effect of astragalus saponins on mice

experimental method:

3.1 Mouse hot plate experiment

The qualified female mice were placed at 55 ± 0.5. C The metal plate of the water bath takes the mouse's hind leg as a signal of pain response, and the latency of the pain response is used as an indicator of pain severity.

3.2 Mouse writhing experiment

Three hours after ig administration, ip 0.6% glacial acetic acid, 0.2ml per mouse, immediately recorded the number of mouse writhing reactions within 15min.

Experimental results:

(1) Hot plate method is divided into groups and administered according to Table 16. The latency of pain response was measured before and 2h, 4h and 6h after administration. All three doses of AST significantly prolonged the pain latency, with effects occurring 2 h after administration, peaking at 4 h, and then decreasing. Table 16 Analgesic effect of AST (mouse hot plate method) Latent period (s)

Dose

Group after administration

( ^{mgkg _1} ) before administration

2 4 6 (h) Contrast era ― 21 · 6 ± 3.8 20 · 0 ± 5.1 21.9 ± 2 · 6 22.4 ± 2 · 5

AST 20 20.4 ± 0.9 26.4 ± 6.5 ** 30.3 ± 4 · 9 ** 26.8 ± 6 · 0 *

40 20.8 ± 0.7 30.6 ± 2.8 ** 31.7 ± 5.9 ** 26.6 ± 4.2 *

80 21.7 soil 1 · 7 30.5 ± 4.4 ** 35.1 ± 6.7 ** 25 · 6 ± 4 · 0 *

Indo 2 20.7 ± 2.5 31.5 ± 7.6 ** 31 · 4 ± 5 · 4 ** 25 · 8 ± 2.7 **

ρ <0.05, ** ρ <0.01, compared with the control group

(2) Writhing method The results in Table 17 show that the three AST measurement groups can significantly inhibit the number of writhing in mice, and the inhibition rate in the high-dose group is comparable to Indo.

Analgesic effect of AST (mouse writhing method) Number of writhing mice Number of writhing inhibition rate

(Only) (times / 15min) (%) Control ― 10 44 ± 9

AST 20 10 8 ± 4 ** 82

40 9 6 ± 4 ** 86

80 9 4 + ** 91

Indo 2 10 4 + 2 ** 91 ig 3 hours after drug or solvent, ip 0.6% glacial acetic acid 0.2ml, immediately observe the number of mouse writhing reactions within 15min, soil S, n = 10, ** p <0.01, and control Compared with the results of the above pharmacodynamic experiments in the group, Astragalus Total Saponin (AST) on carrageenan or adjuvant-induced acute inflammation and croton oil and gas-producing granulomatous hyperplasia with rat collagen arthritis (CIA) and rat adjuvant Arthritis (AA, developing and existing arthritis) has obvious anti-inflammatory effects, and can correct the abnormal immune function of CIA mice and AA mice; It can also cause excessive secretion of IL by synovial cells of AA rats The ability of -1 and NO to return to normal: DTH response to mice with reduced or increased Cy and IgM production reduced by Cy, AST both restored or approached normal levels without significantly affecting the immune function of normal mice. In addition, AST also has a significant effect on the pain model of mice caused by heat (hot plate method) and acetic acid (twisted body method). Pain effect. These indicate that AST has both anti-inflammatory and analgesic effects and function-dependent two-way immunomodulatory effects. The in vitro experiments on the function of major immune cells show that AST can promote the proliferation response of mouse spleen lymphocytes induced by suboptimal ConA and LPS, and the production of IL-1 and IL-2 in the abdominal cavity of rats. It is bell-shaped. It shows that AST has a concentration-dependent two-way regulation effect on the proliferation and secretion function of the above immune cells. Studies have shown that AST is an anti-inflammatory immunomodulator with both immunomodulatory and anti-inflammatory and analgesic effects. The above-mentioned action characteristics of AST not only indicate that it can be used for the treatment of immune-mediated chronic inflammatory diseases such as rheumatoid arthritis and / or lupus erythematosus, but also can be widely used to correct various immune dysfunctions. Toxicology experiment:

Fruit 1: Determination of the maximum tolerated amount of astragalus saponins in mice. 1.1 Test drugs

AST, with a content of 54.40%, was prepared with a 1% sodium carboxymethylcellulose sodium solution and ground to prepare a suspension with a maximum concentration of 125 mg · ml "for ig administration. AST was prepared with dilute ethanol and the maximum dissolved concentration was 10 mg · Ml " ¹ , ethanol concentration below 10%, for ip administration.

1.2 Experimental methods

Forty Kunming mice, weighing 20 ± lg, male and female, were divided into two groups of 20 rats each. A group of mice (20 males and half females) were fasted for 14 hours, could not help but weigh, and each rat was given an AST solution of 0.4ml-10g ¹ ig 125mg · ml " ¹ and the dose of AST was 5g · kg ^-1 (According to the AST yield of 1.5%, it is equivalent to 333g crude drug · kg, which is 666 times the effective daily oral dose.) Another group of mice (20 males and females), each mouse ip 0.25mg · 10g , AST solution 10mg · ml ^-1 . One dose of ip AST is 250mg 'kg (equivalent to 16.65g · kg of crude drug — ^ observe the appearance, behavior, mental state, breathing, body temperature of mice immediately and continuously for 14 days after administration , Manure and daily feed consumption.

1.3 Results

ig AST 5g · kg ¹ or ip AST 250mg · kg ¹ had no significant effect on the weight gain of mice at 7 and 14 days, and had normal posture, shiny hair, behavioral activity, mental state, breathing, body temperature, and feces were normal. None of the animals died.

The above results show that the maximum tolerable amount of astragalus total saponin (AST) in mice is 5 g. Kg- ¹ (equivalent to 333 g · kg-equivalent to more than 500 times the daily oral dose of an adult) in mice. Toxic reactions and death. The maximum tolerated amount of ip AST in another mouse was 250mg · kg (16.65g · kg equivalent to the crude drug). After 14 days of observation, there was no toxic reaction and death. This shows that the present invention is very toxic. Experiment 2: Astragalus total saponins in rats Long-term toxicity test.

2.1 Drug: Astragalus total saponin powder, content 54.52%, suspended with 1% sodium carboxymethyl cellulose to the required concentration.

2.2 Experimental methods:

60 Wistar rats, 7-8 weeks old, female rats weighing 150 ± s 15g, male rats weighing 170 ± s 15go, rats were randomly divided into 3 groups of 20 rats each, male and female, which is low in the present invention High-dose group (ig astragalus total saponin 90mg · kg ' ¹ , d " ¹ and 900mg · kg" ^1. (T ¹ ) and a control group (i _g 1% carboxymethyl cellulose sodium solution). Ig drug or vehicle was started at 8:00 am every day for 90 consecutive days. During the experiment, the behavior, activity, hair, skin color, stool, and breathing of the rats were observed daily. The food intake was weighed once a day and the weight was weighed once a week. The dose was adjusted according to the change in body weight. After 90 days of administration, 1/2 of the rats in each group was collected for blood testing, and the femoral artery was sacrificed to sacrifice the rats. The blood was collected to determine the blood biochemical indicators. Heart, liver, kidney, spleen, lung , Adrenal gland, sacral gland, testis or ovary, uterus or prostate, whole brain, thymus and other 11 organs, declare and calculate the organ coefficient (g / 100g body weight, expressed in%). Take the following organs for tissue morphology Examination of heart, liver, kidney, spleen, lung, adrenal gland, sacral gland, Stomach, thymus, testis (with epididymis) or ovary, prostate or uterus. Stomach in the pylorus, cardia, the small curve and the large curve are taken from each of the four tissues, and other organs are taken from the same tissue. 10% neutral formalin solution, conventional embedding, sectioning, and staining. First observe the high-dose group and the control group. The high-dose group has positive lesions, and then observe the relevant organs in the low-dose group to understand the dose of the test substance. -Toxicity relationship. After the other 1/2 animals were discontinued and observed for 2 weeks, the indicators were measured according to the above-mentioned sub-methods.

2.3 Experimental results:

(1) Observation of general conditions The rats in the treatment group and the control group ate and moved normally during the 90-day experimental period, their hairs were moist, and no abnormal stool was observed.

(2) Weight The rats in all three groups gained weight without significant differences between groups. The results are shown in Table 18. Table 18 Astragalus total saponin ig90d changes in rat body weight over time (x ± s, g) Number of animals in the group 0W 1W 2W 3W 4W 5W 6W 7W ten 10 152.9 ± 7.6 168.8 ± 11.3 183.8 ± 8.0 200.5 ± 10.5 210.5 ± 13.3 219.3 soil 12.2 228.0 ± 26.3 225.8 ± 20.1 Teruo 10 171.5 ± 10.8 201.2 ± 17.4 226.5 ± 19.6 251.0 ± 23.6 270.0 ± 26.1 289.7 ± 21.2 291.0 ± 30.7 300.2 ± 34.6 Combined 20 162.2 ± 9.4 185.0 ± 16.2 205.2 ± 26.3 225.8 ± 31.4 240,3 + 36.6 254.4+ 39.9 259.5 ± 42.6 263.0+ 44.1

F xiongxiong 10 157.4 ± 7.5 172.9 + 6.3 183.5 ± 8.3 199.9 ± 9.4 210.1 ± 9.0 216.2 ± 9.6 223,1 ± 11.7 224.8 ± 14.6 Dosage 10 Π4.4 ± 10.6 208.8 ± 13.2 226.7 ± 16.7 258.0 ± 19.3 273.6 ± Π.4 287.7 ± 15.3 302.9 ± 16.0 309.7 ± 20.9 Total amount 20 165.9 ± 12.5 190.9+ 20.9 205.1 ± 25.7 228.9 ± 33.1 241.9 ± 35.3 251.9 ± 38.7 263.0 ± 42.9 267.3 ± 46.9 Kaohsiung 10 152.6 ± 11.3 Π 3.5 ± 8.6 179.6 Soil 10.1 192.8 ± 17.7 201.1 ± 18.6 207.1 ± 18.6 224.7 ± 15.3 231.7 ± 18.6 Dose 10 170.9 ± 8.9 197.3 ± 9.6 218.5 ± 10.1 257.1 ± 26.2 276.0 ± 26.5 284.0 ± 23.2 288.0 ± 30.2 301.7 ± 35.3 Total 20 161.8 ± 13.7 185.4 ± 15.1 199.1 ± 22.3 225.0 ± 39.5 238.6 ± 44.4 245.6 ± 44.4 256.4 ± 39.9 268.7 ± 45.2 Number of animals in groups 8W 9W 10W 11W 12W 13W 14W * 15W * For female 10 223.1 ± 21.8 233.8 ± 22.3 233.4+ 21.5 226.5 ± 23.9 234.9 ± 34.5 241.6 ± 30.6 232.4+ 38.5 237.0 ± 41.6 Teruo 10

301.2 ± 47.6 320.0 ± 34.6 334.3 ± 34.0 324.3 ± 34.3 336.8 ± 35.7 328.9 ± 32.5 383.0 ± 55.3 387.2 ± 55.7

262.2 ± 51.5 277.0 ± 52.6 283.9 ± 58.7 275.4 ± 57.8 285.9 ± 62.4 285.2 ± 51.9 307.7 ± 91.2 312.1 ± 45.2 Low male 10 230.9 ± 12.1 234.6 ± 12.5 228.6 + 18.8 236.4+ 13.9 235.6+ 23.8 229.8 ± 24.4 236.4 ± 40.2 234.8 ± 35.0 Agent 10

313.5+ 19.8 326.2 ± 22.7 326.9 ± 20.6 320.1 ± 21.6 347.2+ 28.0 342.5 ± 26.0 369.6 ± 23.7 369.4 ± 28.0 Total amount 20

272.2 ± 45.3 280.4 ± 50.3 277.8 ± 53.9 278.3 ± 51.3 291.4 ± 62.2 286.2 ± 62.8 293.0 ± 76.8 304.1 ± 77.0 Kaohsiung 10 230.1 ± 18.1 233.0+ 18.6 228.0 ± 19.7 238.7 + 24.7 242.8 ± 26.7 243.3 ± 28.6 255.2 + 24.0 250.0 ± 24.7 Agent male 10

312.9 + 29.5 322.3 soil 29.8 335.2 ± 28.1 335.0 ± 38.9 337.5 ± 32.1 344.2+ 31.6 358.6 ± 37.4 366.4 ± 36.1 Total amount 20

271.5 ± 48.7 277.7 ± 51.8 281.6+ 59.9 286.9 ± 58.7 290.2 ± 55.4 293.6 ± 51.5 306.9 ± 62.1 308.2 ± 67.9 t test: compared with the control group P> 0.05, * is the change in body weight after discontinuation (5 males and 5 females) .

(3) Hematological examinations were performed at the end of administration and during the recovery period, and hematological indicators were measured in the high and low dose groups. There were no abnormalities in the hematological indicators of the rats in the high and low dose groups. Effect of Astragalus Total Saponin ig 90d on Hematological Indexes in Rats (withdrawal for 24 hours)

Dose red blood cell hemoglobin white blood cell white blood cell classification calculation (o / ₀ ) Platelet clotting time group (mg ■ kg " ¹ (10 ¹² · L" ¹ ) (g-U ¹ ) (10 ⁹ · IT ¹ ) Neutral lymphatic mononuclear ( 10 ⁹ -L " ¹ ) (s)

• d— ¹ )

Control group-9.3 ± 1.6 149.7 ± 10.1 5.9 ± 1.7 30.6 ± 4.8 65.5 ± 5.2 <1 91.8 ± 27.7 42.2 ± 10 Low-dose group 90 7.5 ± 2.6 142.4 + 6.7 6.1 ± 1.9 27.0 ± 4.6 70.1 ± 19.0 <1 117.2 ± 30.1 43.0 ± 11.2 High-dose group 900 8.8 ± 1.4 143.2 ± 18.4 5.4 ± 1.7 29.6 ± 8.9 67.0 ± 9.9 <1 104.3 ± 28.3 41.9+ 10.8 n = 10, x ± S. t test: p> 0.05 compared with the control group

Dose red blood cell hemoglobin white blood cell white blood cell classification calculation (%) Platelet clotting time group (mg · kg " ¹ (10 ¹² L" ¹ ) (g-L- ¹ ) (10 ⁹ -U ¹ ) Neutral lymphatic mononuclear (10 ⁹ L " ¹ ) (s) Control group-8.4 ± 1.7 155.4 ± 14.4 7.7 ± 0.9 25.7 ± 4.4 74.2 ± 6.1 1.8 ± 1.5 52.3 ± 13.4 40.5 ± 8.6 Low dose group 90 7.4 ± 0.6 153.0 ± 9.4 7.4 ± 0.6 28.7 ± 5.8 71.7 ± 7.8 1.3 ± 1.3 54.6 ± 16.1 36.5 ± 6.5 High-dose group 900 7.8 ± 1.3 158.1 ± 17.4 7.5 ± 1.1 24.0 ± 3.5 75.5 ± 5.7 1.1 ± 1.2 46.8+ 12.6 40.0 ± 5.6 n = 10, ± S. T Test: p> 0.05 compared with control group. AST: Astragalus total saponins.

(4) Blood biochemical examination At the end of the administration and the recovery period, there was no significant difference in the blood biochemical indexes of the rats in the high and low dose groups (Table 21 to Table 22). Effect of Astragalus Total Saponin ig90d on Blood Biochemical Indexes in Rats

Index (unit) Control group Low dose group High metering group

AST (U. L ' ¹ ) 202.3 ± 21.6 191.5 ± 17.7 191.6 soil 18.8

ALT (U · L " ¹ ) 49.9 ± 7.6 45 · 9 ± 3.0 41.5 ± 10.5

ALP (U · L " ¹ ) 81.1 ± 17.8 91 · 5 ± 27.3 86.9 ± 13.4

BUN (mmol · L " ¹ ) 16.2 ± 2.0 14.6 ± 1.5 14.1 ± 1.9

TPCg-L " ¹ ) 75.5 ± 8.7 79.2 ± 3.3 79.4 ± 8.4

^{ALB (g · L '1)} 42.2 ± 3.1 42.7 ± 2.3 43.9 ± 2.4

GLU ol. L ' ¹ ) 5.6 ± 0.5 5.5 ± 0.5 5.6 ± 0.7

T-BIL (umol · L ^_1 ) 2.6 ± 0.9 3 · 1 ± 1.1 3.0 ± 1.1

Grea (umol · L " ¹ ) 145.7 ± 36.5 117.5 ± 26.2 118.4 ± 31.3

T-CHO (mmol -L " ¹ ) 1.75 ± 0.25 1 · 79 ± 0.24 1.90 ± 0.31

n = 10, A; ± S. Compared with the control group, p> 0.05. • ATS: aspartate aminotransferase; ALT: alanine aminotransferase;

ALP: alkaline phosphatase; BUN: urea nitrogen;

TP: total protein; ALB: albumin;

GLU: blood glucose T-BIL: total bilirubin;

Grea: creatinine; T-CHO: total cholesterol.

Table 22 Changes in blood biochemical parameters of rats during recovery

Index (unit) Control group Low dose group High metering group

AST (U · I ') 165.8 ± 21.7 157.0 ± 11.2 151.4 ± 16.9

ALT (U. L " ¹ ) 56.5 ± 10.5 55.0 ± 5.2 49.9 ± 6.5

ASP (U · L " ¹ ) 154.2 ± 40.5 135.7 ± 41.5 136.3 ± 38.8

BUN ol · L " ¹ ) 15.9 ± 2.0 14.5 ± 1.6 15.7 ± 1.4

TP g-L ' ¹ ) 62.4 ± 3.4 61.5 ± 4.3 60.4 ± 2.1

ALB (g · L " ¹ ) 39.9 ± 2.6 40.1 ± 3.9 40.6 ± 2.3

GLU (mmol · L " ¹ ) 5.1 ± 0.7 5.0 ± 0.8 5 · 5 ± 0 · 3

T— BIL (draw 1 · L " ¹ ) 3.1 ± 0.7 2.7 ± 0.5 2.5 ± 0.4

Grea (umol · L " ¹ ) 171.7 ± 15.0 163.7 ± 27.4 159.8 ± 30.2

T-CHO (mmol · L " ¹ ) 1.7 ± 0.3 1.8 ± 0.2 1.8 ± 0.1 n = 10,; c ± s, compared with the control group, p> 0.05.

(5) Organ coefficients There were no significant changes in the 11 organ coefficients in the high and low dose rats compared with the control group at the end of administration and the recovery period (Tables 23 to 24).

Table 23 Effect of astragalus total saponin ig 90d on organ coefficients in rats (withdrawal 24h) Organ coefficients (%) Control group Low dose group High dose group Heart 0.33 ± 0.03 0.32 ± 0.04 0.35 ± 0.05 Liver 3.31 ± 0.29 3.42 ± 0.20 3.26 ± 0.34 kidney 0.53 ± 0.06 0.48 ± 0.03 0.52 ± 0.06 spleen 0.18 ± 0.02 0.29 ± 0.18 0.19 ± 0.03 lung 0.49 ± 0.08 0.49 ± 0.23 0.59 ± 0.26 adrenal gland 0.010 ± 0.004 0.012 ± 0.006 0.013 ± 0.005 sacral gland 0.29 ± 0.11 0.25 ± 0.07 0.22 ± 0.05 Testis 1.08 ± 0.07 1.16 ± 0.07 1.05 ± 0.04 Ovarian 0.023 ± 0.007 0.020 ± 0.007 Uterus 0.18 ± 0.03 0.18 ± 0.04 0.18 ± 0.06 Whole brain 0.69 ± 0.11 0.66 ± 0.13 0.63 ± 0.16 Prostate 0.037 ± 0.007 0.034 ± 0.009 0.044 ± 0.006 Thymus 0.13 ± 0.03 0.14 ± 0.04 0.12 ± 0.02 n = 10, x ± s, compared with the control group, p> 0.05. Organ coefficient = organ weight (g) / 100g body weight Table 24 Changes in rat organ coefficient during recovery

Organ coefficient (%;) Control group Low dose group High metering group

Heart 0.31 ± 0.03 0.33 ± 0.04 0.31 ± 0.03 liver 3.22 ± 0.35 2.92 ± 0.78 3.20 ± 0.27 kidney 0.52 ± 0.06 0.53 ± 0.07 0.52 ± 0.05 spleen 0.19 ± 0.03 0.20 ± 0.04 0.19 ± 0.04 lung 0.59 ± 0.12 0.58 ± 0.08 0.59 ± 0.11 adrenal gland 0.015 ± 0.004 0.015 ± 0.004 0.016 ± 0.005 thyroid 0.24 ± 0.06 0.20 ± 0.03 0.22 ± 0.02 testis 0.90 ± 0.18 1.02 ± 0.14 1.07 ± 0.08 ovary 0.030 ± 0.007 0.030 ± 0.008 0.036 ± 0.006 uterus 0.17 ± 0.04 0.22 ± 0.07 0.17 ± 0.05 Whole brain 0.61 ± 0.12 0.66 ± 0.15 0.64 ± 0.15 Prostate 0.035 ± 0.007 0.033 ± 0.003 0.036 ± 0.003 Thymus' 0.12 ± 0.03 0.13 ± 0.04 0.14 ± 0.04 n = 10, ± s, compared with the control group, p> 0.05.

(6) The appearance of 11 organs or tissues of the three animals was normal with naked eyes, and no abnormal changes were found in histopathological examination. The above experimental results show that for two consecutive doses of astragalus total saponins (90 and 900 mg · kg ¹ · (T ¹ ) for 90 d, the appearance, behavior, food intake, weight gain, hematological indexes, blood biochemical indexes, coefficient seed vital organs and 11 histologic important organs, no abnormal change;. no delayed recovery stopping the reaction results showed astragalosides 90 and 900mg kg ^¹ d- ¹ irrigation. 90d of gastric administration has no obvious toxic reaction to rats, indicating that the invention is safe for long-term administration.

Claims

Rights request:

1. Astragalus extract, which is characterized by containing the following weight percentages:

Astragalus total saponins 53-80%, astragalus flavonoids 10-25%.

2. Astragalus extract according to claim 1, characterized in that it contains the following substances in weight percentages:

Astragalus total saponins 74-80%, astragalus flavonoids 10-20%.

3. The astragalus extract according to claim 1 or 2, further comprising 10-25% of an organic acid.

4. The astragalus extract according to claim 1, 2 or 3, characterized in that it is prepared by the following steps:

b. The solution is concentrated to obtain an extract;

5. The astragalus extract according to claim 4, wherein the resin is selected from the group consisting of D-10 AB-8 or SIP-1300 resin.

The astragalus extract according to claim 5, wherein the resin is a D-101 resin.

The astragalus extract according to any one of claims 4-6, characterized in that the concentration of the ethanol aqueous solution in step a is 65-99%.

The astragalus extract according to claim 7, characterized in that the concentration of the ethanol aqueous solution in step a is 80-99%.

The astragalus extract according to any one of claims 4-8, wherein the concentration of the ethanol aqueous solution in step c is 70-90%.

The astragalus extract according to any one of claims 4-9, characterized in that the step a is performed under heating and refluxing conditions.

11. A method for preparing astragalus extract, comprising the following steps:

b. The solution is concentrated to obtain an extract;

12. The method according to claim 11, wherein the resin is selected from the group consisting of D-10K AB-8 or SIP-1300 resin.

13. The method of claim 12, wherein the resin is a D-101 resin.

14. The preparation method according to any one of claims 11-13, characterized in that the concentration of the ethanol aqueous solution in step a is 65-99%.

15. The preparation method according to claim 14, characterized in that the concentration of the ethanol aqueous solution in step a is 80-99%.

16. The preparation method according to any one of claims 11-15, wherein the concentration of the ethanol aqueous solution in step c is 70-90%.

17. The method according to any one of claims 11-16, characterized in that said step a is performed under heating and refluxing conditions.

18. Use of astragalus extract according to any one of claims 1-10 in the manufacture of a medicament for treating or preventing immune-mediated chronic inflammatory diseases.

19. The use according to claim 18, wherein said medicament is made into an oral preparation.

20. Use of astragalus extract according to any one of claims 1-10 in the preparation of a medicament for treating or preventing rheumatoid arthritis and / or lupus erythematosus.

21. The use according to claim 20, wherein said medicament is made into an oral preparation.

22. A method for treating or preventing an individual's immune-mediated chronic inflammatory disease, characterized by administering to the individual an effective amount of the astragalus extract according to any one of claims 1-io.

23. A method for treating or preventing rheumatoid arthritis and / or lupus erythematosus in an individual, characterized in that an effective amount of the astragalus extract according to any one of claims 1 to 10 is administered to the individual.