CN109680091A - A kind of primer and detection method based on high-flux sequence detection arbuscular mycorrhizal fungi - Google Patents
A kind of primer and detection method based on high-flux sequence detection arbuscular mycorrhizal fungi Download PDFInfo
- Publication number
- CN109680091A CN109680091A CN201910024614.6A CN201910024614A CN109680091A CN 109680091 A CN109680091 A CN 109680091A CN 201910024614 A CN201910024614 A CN 201910024614A CN 109680091 A CN109680091 A CN 109680091A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- mycorrhizal fungi
- arbuscular mycorrhizal
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primers and detection method based on high-flux sequence detection arbuscular mycorrhizal fungi, the following steps are included: using the genomic DNA to measuring plants or soil sample as template, PCR amplification is carried out after connecting high-flux sequence universal primer connector by primer one and primer two, pcr amplification product carries out high-flux sequence after purification, the original series measured are obtained into Cleandata sequence by processing, region corresponding with the arbuscular mycorrhizal fungi 28SrRNA canonical sequence with clear annotation information carries out Blast and compares, the similarity and coverage rate compared by setting, filter out the sequence etc. that there is higher similarity with canonical sequence；This method can delicately detect the arbuscular mycorrhizal fungi spore in soil sample and the arbuscular mycorrhizal fungi mycelium in plant, and arbuscular mycorrhizal fungi can be made preferably to be annotated in the level of category, can both carry out qualitative analysis or carry out relative quantitative assay.
Description
Technical field
The present invention relates to the methods of arbuscular mycorrhizal fungi in plant identification in field of biotechnology or soil sample and dedicated
Primer specifically designs a kind of primer and detection method based on high-flux sequence detection arbuscular mycorrhizal fungi.
Background technique
Arbuscular mycorrhizal fungi can form mutualistic symbiosis body " mycorhiza " with most vascular plant root systems.Host plant is logical
It crosses arbuscular mycorrhizal fungi and absorbs mineral nutrition, and arbuscular mycorrhizal fungi obtains photosynthate from plant.Since mycorhiza can promote
Into various plants growth and development, the ability that plant resists poor environment is improved, the competitiveness of plant is promoted, is before one kind has very much
The bio-feritlizer of scape.Arbuscular mycorrhizal fungi is a kind of obligate biotroph fungal component, i.e., only establishes altogether with live plant root system
Its history of life could be normally grown, develops, breeds and completed after raw body system.The spore of arbuscular mycorrhizal fungi is present in soil
In.The spore of arbuscular mycorrhizal fungi is the important evidence of arbuscular mycorrhizal fungi identification, but that there is separation processes is cumbersome, and identification is difficult
The features such as degree is high, and dedicated technician is needed to identify.Molecular Identification technology is the another of progress arbuscular mycorrhizal fungi identification
Kind means, have the characteristics that accuracy is high.With the development of high throughput sequencing technologies, clump branch is carried out using high throughput sequencing technologies
The research of mycorrhizal fungi polymorphism is also underway, is based on high throughput sequencing technologies platform Illumina, and 300bp or so becomes master
The sequencing length of stream makes it necessary to develop a kind of primer sequence and mirror for being suitable for current 300bp or so length sequencing technologies
Other method.Current Illumina platform sequencing approach focuses mostly in the research region ITS2, but drawing due to the amplification region ITS2
Object is not designed exclusively for arbuscular mycorrhizal fungi, so that the detection effect of arbuscular mycorrhizal fungi is unsatisfactory.In addition, arbuscular mycorrhiza
There are better Phylogenetic Relationships in the region 28SrRNA of fungi compared to the region ITS, it is necessary to be set based on the region 28SrRNA
A kind of primer pair and comparison method for arbuscular mycorrhizal fungi is counted to use in current bioinformatics method more
Cleandata is directly compared with database, the highest often sequence not annotate in detail of the result similarity compared in this way
Column, and the sequence clearly annotated is neglected, such as have the sequence clearly annotated in database, also there is display " unknown " sequence,
And most of situation, the sequence detected are compared in database, it is " unknown " that the highest sequence of similarity, which all annotates, at all
The exhaustive division information of obtained sequence can not be inquired；It is a kind of to there is clear annotation information sequence for comparison sequence it is therefore necessary to establish
The method of column improves the recall rate of arbuscular mycorrhizal fungi and annotation accuracy in sample.
Summary of the invention
The purpose of the present invention is to provide a kind of primer based on high-flux sequence detection arbuscular mycorrhizal fungi and detection sides
Method, used method directly analyze biological gene type rather than phenotype, so qualification result is not by environmental factor, sample morphology
With the influence of material source.This method can not only make up the subjective factor in the spore shape identification of arbuscular mycorrhizal fungi, together
When have the characteristics that dosage is few, high-efficient, stability is high, accurate and reliable；Meanwhile, it is capable to be obtained when avoiding comparing in the database
To be sequence that annotation is " unknown ", and the sequence information clearly annotated can not be obtained.
To achieve the above object, the technical solution adopted by the present invention is that, one kind detecting arbuscular mycorrhiza based on high-flux sequence
The primer and detection method of fungi, which is characterized in that the primer of arbuscular mycorrhizal fungi has two, is respectively as follows:
One: 5 '-CCGCTGAACTTAAGCATATC-3 ' of primer；
Two: 5 '-AGCTGCAWTCCCAAACAACT-3 ' of primer；
Wherein the W in primer two is degenerate primer, site A and the mixing of T equal proportion, ratio 1:1；
Detection method based on high-flux sequence detection arbuscular mycorrhizal fungi, comprising the following steps:
Using plant to be detected or soil total DNA as template, by primer one and primer two plus high-flux sequence universal primer connector
Composition primer pair carries out first round PCR amplification afterwards, obtains a wheel PCR product of the both ends with universal joint；It is with a wheel PCR product
Template carries out two wheel PCR amplifications with 5 ' universal primers of the end with sequence measuring joints and index of PCR product, obtains the sequencing of both ends band
Two wheel products of connector and index sequence；High throughput is carried out after purification with ethyl alcohol/sodium acetate to the two wheels pcr amplification product
The original series measured are split by data, splice and be obtained by filtration Cleandata sequence, with arbuscular mycorrhizal fungi by sequencing
The corresponding sequence of 28SrRNA is compared, and the similarity compared by setting is more than or equal to 97% and coverage rate is greater than 99.6%, small
In 100.4%, the sequence that there is higher similarity with the arbuscular mycorrhizal fungi sequence with clear annotation information is filtered out, will be sieved
The sequence chosen is carried out in NCBI with the highest arbuscular mycorrhizal fungi canonical sequence of its similarity using Blast function one-to-one
Secondary comparison (one-to-one secondary comparison can eliminate influence of the Database size to e-value), obtain for annotation
e-value.According to similarity, coverage rate and e-value by the Sequence annotation screened to level-one is belonged to, to realize clump in sample
The detection and identification of mycorrhizal fungi.
Preferably, the system of the PCR amplification are as follows: 12.5 μ of Pusion Hot start flex 2X Master Mix
2.5 μ l, Reverse Primer of l, Forward Primer, 2.5 μ l, Template DNA, 50 ng, adds ddH2O to 25 μ l.
Preferably, the reaction condition of the PCR amplification are as follows: 98 DEG C initial denaturation 30 seconds；Then it is followed according to following parameters
Ring reaction: 98 DEG C be denaturalized 10 seconds, 54 DEG C renaturation 30 seconds, 72 DEG C extend 45 seconds；Circulation 35 times；It is protected after circular response at 72 DEG C
It holds 10 minutes.Reaction product will be obtained to save at 4 DEG C.
Preferably, the detection range of the arbuscular mycorrhizal fungi includes with subordinate:Gigaspora、Dentiscutata、Scutellospora、Racocetra、Rhizophagus、Glomus、Kamienskia、Dominikia、Funneliformis、Septoglomus、Acaulospora、Sacculospora、Pacispora、Diversispora、Otospora、Redeckera、Corymbiglomus、Claroideoglomus、Ambispora、Archaeospora、Palaeospora。
The beneficial effects of the present invention are the primer special devised for arbuscular mycorrhizal fungi, the primer pair is given
Under reaction condition, arbuscular mycorrhizal fungi can be specifically detected, and relative quantification point can be carried out according to the sequence number of detection
Analysis.Method used in this patent directly analyzes biological gene type rather than phenotype, so qualification result is not by environmental factor, sample
The influence of product form and material source.This method can not only make up arbuscular mycorrhizal fungi spore shape identify in it is subjective because
Element, while having the characteristics that dosage is few, high-efficient, stability is high, accurate and reliable, to arbuscular mycorrhizal fungi mycelium in plant and
The detection of arbuscular mycorrhizal fungi spore has great significance in soil.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Arbuscular mycorrhizal fungi is searched from ncbi database with subordinate:Gigaspora、Dentiscutata、Scutellospora、Racocetra、Rhizophagus、Glomus、Kamienskia、Dominikia、Funneliformis、Septoglomus、Acaulospora、Sacculospora、Pacispora、Diversispora、Otospora、Redeckera、Corymbiglomus、Claroideoglomus、Ambispora、Archaeospora、PalaeosporaThe 28SrRNA sequence of strain is represented, wherein Genbank ID is shown in Table 1, is about according to the above sequence search length
Design the PCR primer of a pair of of distinctive in the target area of 300bp:
One: 5 '-CCGCTGAACTTAAGCATATC-3 ' of primer；
Two: 5 '-AGCTGCAWTCCCAAACAACT-3 ' of primer；
W in primer two is degenerate primer, site A and the mixing of T equal proportion, ratio 1:1.
Embodiment 1
Detect arbuscular mycorrhizal fungi classification in clover plant tissue:
One, DNA is extracted
(1) the clover Plant tissue samples in 200mg with being planted in astragalus mongolicus sample soil are moved in pre-cooling sterile mortar, is stood
Liquid nitrogen is injected in mortar, tissue is fully ground into the mortar stick of Liquid nitrogen precooler it is powdered, it is vertical after grinding sufficiently
It is fitted into the centrifuge tube being pre-chilled in advance, and is put into liquid nitrogen bottle；
(2) centrifuge tube equipped with sample is added to the CTAB extracting solution of 65 DEG C of 1ml preheatings, shakes and mixes on vortex oscillation instrument,
Sample is set to suspend completely, 65 DEG C of water-bath 60min；
(3) it is shaken up during water-bath 2~3 times, guarantees that cracking sufficiently, after taking-up, is cooled to room temperature；
(4) 8000rpm is centrifuged 5min, takes supernatant into new 2.0ml sterile centrifugation tube；
(5) 800 μ l chloroform-isoamyl alcohols (24:1) are added, turn upside down 100 times (being up and down 1 time), 12000rpm is centrifuged 20min；
(6) 600 μ l supernatants are drawn to new 2.0ml sterile centrifugation tube, isometric chloroform-isoamyl alcohol (24:1) are added, up and down
100 times reverse, 12000rpm is centrifuged 20min；
(7) 400 μ l supernatants are drawn into new 1.5ml sterile centrifugation tube, the isopropanol of 2/3 volume of supernatant volume is added
It with the sodium acetate (3M) of 1/10 volume, mixes well, -20 DEG C of placement 1h；
(8) 12000rpm is centrifuged 10min, abandons supernatant, and brief centrifugation is inhaled with yellow pipette tips and abandons surplus liquid, and room temperature dries 10min extremely
DNA precipitates the shape that is translucent；
(9) the sterile ddH of 50-100 μ l RNase containing 10mg/ml is added2O, dissolving DNA precipitating, after 37 DEG C of water-baths digest 1h
It is stored in -20 DEG C of refrigerators.
Two, polymerase chain reaction (PCR)
Using the total DNA containing plant endogenesis epiphyte DNA as template, primer pair is formed with primer one, carries out PCR amplification, specific side
Method is as follows:
(1) reaction process
1) universal joint is added at the end of primer 5 ', carries out primer synthesis；
2) specific primer with universal joint is held with the 5 ' of synthesis, carries out first round PCR, obtains one of both ends with universal joint
Take turns PCR product；
3) (end of universal primer 3 ' and the universal joint of a wheel PCR are anti-for universal primer of the 5 ' both ends of synthesis with sequence measuring joints and index
To complementation)；
4) using a wheel PCR product as template, 5 ' both ends carry out two wheel PCR with the universal primer of sequence measuring joints and index, obtain two
Hold the two wheel products with sequence measuring joints and index sequence；
5) two wheel products are library, and be available on the machine sequencing after purification,
(2) reaction system
The reaction system by the genomic DNA template of plant to be identified, embodiment 1 PCR reagent and deionized water form,
The reaction system is reference with 25 μ l, and the dosage of each ingredient is respectively as follows:
Pusion Hot start flex 2X Master Mix 12.5μl；
Forward Primer 2.5μl；
Reverse Primer 2.5μl；
DNA profiling 50ng；
With deionized water polishing to 25 μ l, after mixing, brief centrifugation,
(3) polymerase chain reaction condition
The reaction carries out in PCR instrument, reaction condition are as follows: 98 DEG C initial denaturation 30 seconds, then by following parameters carry out 35 times circulation
Reaction:
It is denaturalized 98 DEG C 10 seconds,
54 DEG C of renaturation 30 seconds,
Extend 72 DEG C 45 seconds,
It is kept for 10 minutes after circular response at 72 DEG C, PCR reaction terminates, and obtains reaction product, will obtain reaction product 4
DEG C save,
(4) amplified production recovery purifying
Pcr amplification product is detected by 2% agarose gel electrophoresis, and is recycled to target fragment, and recycling uses
AxyPrep PCR Cleanup Kit QIAquick Gel Extraction Kit.
Three, high-flux sequence is carried out to PCR reaction product
To PCR product after purification using Quant-iT PicoGreen dsDNA Assay Kit in Promega
Library is quantified in QuantiFluor fluorescent quantitation system, qualified library concentration should be in 2nM or more.By each of qualification
After upper machine sequencing library (Index sequence is not reproducible) gradient dilution, mixed according to required sequencing amount by corresponding proportion, and pass through
NaOH denaturation carries out machine sequencing to be single-stranded.
Four, bioinformatic analysis
(1) data split, splice and filter
According to the overlap relationship of both-end sequence, the tag that sequence assembly (merge) is grown up, and library introducing will be built in sequence
Barcode and primer sequence removal.In addition, sequenator judges the type (ATCG) that base is sequenced, quality according to fluorescence signal
Value is to identify the error probability of base, in order to guarantee the reliability of subsequent result, is needed the sequence of mass value low (error rate is high)
Column removal.The Analysis of quality control such as Q20, Q30 are carried out, final cleandata is obtained,
(2) sequence alignment and annotation
Sequence source
Table 1
The arbuscular mycorrhizal fungi sequence with clear annotation information corresponding with this primer amplified region
>Gigaspora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GCGGGAAGAGCACAAATTTAAAATCTACCTGGTTTTCAGGTCGAGTTGTAATTTGAAGATACGTTTTTGATGTTCCT
GGTTGGACTAAATCCTTTGGGATAAGGTATCATAGAGGGTGAGAATCCCGTGTATACCAACCATAGGGTGTTATTTA
ATAACGTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Dentiscutata
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GCGGGAAGAGCACAAATTTAAAATCTACCTGGTTTTCAGGTCGAGTTGTAATTTGAAGAAACGTTTTTGACGTTCCG
AGTTGGGATAAATCCTTTGGGATAAGGTATCATGGAGGGTGAGAATCCCGTGTATACCAACCGCTGGGATGTTATTT
AATACGTTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Scutellospora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GCGGGAAGAGCACAAATTTTAAATCTACCTGGTTTTACTGGGTCGAGTTGTAATTTGAAGAAACGTTTTTAATGTTC
CGGGTTGGTTTAAATCCTTTGGGATAAGGTATCATGGAGGGTGAGAATCCCGTGTATATCAACCGCTGGGATGTTAT
TAATACGTTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Racocetra
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GCGGGAAGAGCACAAATTTTAAATCTACCTGGTTTCCAGGTCGAGTTGTAATTTGAAGAAGTGTTTTTTACTTTCCG
GGTTGGGTTAAATCCTTTGGGATAAGGTATCATGGAGGGTGAGAATCCCGTGTATACCAACCGCAGGATTGTTTAAT
ATACACTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Diversispora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GAGGGAAAAGCTCAAATTTTAAATCTACCTGGTTTCCCAGGTCGAATTGTAATTTGAAGAAGCGATATCGGTGTTGA
AGTCTGGTTCAAGTTCTTTGGAACAAGACATCATGGAGGGTGAGAATCCCGTGCATGATCAGACCAAGATACTTAAT
ATTCGTTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Otospora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GAGGGAAAAGCTCAAATTTTAAATCTACCTGGTTCCCAGGTCGAATTGTAATTTGAAGAAGCGATATCGGTATTGAG
GTCTGGTTCAAGTTCTTTGGAACAAGACATCATGGAGGGTGAGAATCCCGTGCATGATCAGACCAAGATACCCAATA
TTCGTTTTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Redeckera
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAA
GTGGGAAAAGCTCAAATTTTAAATCTGCCTGGCACAACCAGGTCGAGTTGTAATTTGAAGAAGCGCTTTCGGTGTTT
TGATCTGGTTAAAGTTCTTTGGAACAAGACATCATGGAGGGTGAGAATCCCGTGCATGATCAGATCGAAATACTCCA
GATGCGCTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Corymbiglomus
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTCAGTAACGGCGAGTGAA
GTGGGAAAAGCTCAAATTTTAAATCTACCTTGGTCACACCAGGTCGAATTGTAATTTGAAGAAGCGTTTTCGATATT
TTTGGTTTGGTTGAAGGCCTTTGGAACAAGGCATCATGGGAGGGTGAGAATCCCGTACATGGTCAGACCGATATGTC
ACAGATGCGCTCTCTAAGAGTCGAGTTGTTTGGGAATGCAGCT
>Sacculospora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAA
GCGGGAAAAGCTCAAATTTTAAATCTACTTGGTTCTTCTAAGTCGAGTTGTAATTTGAAGAAACACTTTCGGAATTC
CGGTCTGGTCTAAATCCTTTGGAATGAGGTATCATGGAGGGTGAGAATCCCGTTCCTGATCAGGCATCCGTGAGTTT
CAATGTGAAGTGTTTTCTAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Rhizophagus
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACTGCGAGTGAA
GAGGGACAAGCTCAAATTTTAAATCTATCGGGTTTTACCTGATCGAGTTGTAATTTGAAGAGGCGTTTTCTGTGTTT
CTGATCAGTCCAAGTCCTTTGGGATAAGGCATCATGGAGGGTGAGAATCCCGTCCGGTTGATCATTGCGTTTTACGA
TACGCTTTCTAAGAGTCAAGTTGTTTGGGATTGCAGCT
>Glomus
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACTGCGAGTGAA
GAGGGACAAGCTCAAATTTTAAATCCATCGGGTTTTACCCGATCGAGTTGTAATTTGAAGAGGCGTTTTCTGTGTTT
CTGATCAGTCCAAGTCCTTTGGGATAAGGCATCATGGAGGGTGAGAATCCCGTCCGGTTGATCAGATTCGCTTTACG
ATACGCTTTCTAAGAGTCAAGTTGTTTGGGATTGCAGCT
>Kamienskia
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACTGCGAGTGAA
GAGGGATAAGCTCAAATTTTAAATCTGTTAGGTTTTACCTGACCGAGTTGTAATTTGAAGAAACGTTTTCGCGTGTG
TTTGATCGGCCCAAGTCCTTTGGGATGAGGCATCACGGAGGGTGATAATCCCGTACGGCCGTCATTGCACGTATACG
ATACGTTTTCAAAGAGTCAAGTTGTTTGGGATTGCAGCT
>Funneliformis
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCTCAGTAACGGCGAGCGAA
GAGGGATAAGCTCAAATTTTAAATCTGTTGGGTTCCACTTAACAGAGTTGTATTTTGAAGAAACGTTTTCTGCATCC
AGGATTAGCCTAAATCCTTTGGGATAAGGTATCATGGAGGGTGAGAATCCCGTTCATGGTTAATCTTAAGGAAGCTC
TACGATACGTTTTCCAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Septoglomus
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCCTAGTAACTGCGAGTGAA
GAGGGATAAGCTCAAATTTTAAATCTGATGGGTCCTACTTATCAGAGTTGTAATTTGAAGAAACGTTTTCTGTGTCT
TGTTAACCTAAATCTTTTGGAACAAGGTATCATGGAGGGTGACAGTCCCGTTCATGGTTAACATCAAGATACGTTAC
GATACGTTTTCTAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Dominikia
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTCCCTTAGTAACGGCGAGTGAA
GGGGGAAAAGCTCAAATTTTAAATCTGCTAGGTTTTACCTATCAGAGTTGTATTTTGAAGAAGCGTTTTCCGCGTCT
CGGTTGGCCCAAATCCTTTGGGATAAGGTATCATGGAGGGTGAGAATCCCGTTCGGTTGACCTTATGACGCTTTACG
ATACGCTCTCAAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Pacispora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAA
GTGGGAAAAGCTCAAATTTTAAATCTGTCTGGGTAACCAGACCGAGTTGTAATTTGAAGAAACGTATTCAACGTCAT
GGAATGATCAAAATCCTTTGGAAAGAGGTATCATGGAGGGTGATAATCCCGTTCATGGTCAAACCAGAAGCGTTACC
TATGCGTTTTCTAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Acaulospora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAA
CCGGGAAAAGCTCAAATTTAAAATCGCTTGGGTTTACCTGTGCGAGTTGTAATTTGAAGAATGTGTTTCGACTTTTT
TGGTTTGATCCAAATCCTTTGGGATGAGGTATCATAGAGGGTGAGAATCCCGTTCATGATTAAACCTTAGTTGTCAA
TTGATTCACTTTCTAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Claroideoglomus
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAA
GAGGGAAGAGCTCAAATTTTAAATCTGCCTTGTTTCAAGGTCGAGTTGTAATTTGAAGAAGCGTTTTCTTGGGCTCG
CGGCCGGTAGAAGTTCTTTGGAACAGGACATCATAGAGGGTGACAATCCCGTCTGCGACCGGTCGTGCGTTCATCTA
CGATACGCTTTCAAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Ambispora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCTTAGTAACGGCGAGTGAA
GCGGGAATGGCTCAAATTTTAAATCTGATCGGTTCTCCGATCCGAATTGTAATCTAAAGAAGCGTTTACAGCGTCCT
CTCGGGTATAGGTCCCTTGGAATAGGGCATCATAGAGGGTGAGAATCCCGTCTGTGACACGAGTTCGGGATGCGATA
CGTTACGCTTTCGACGAGTCGAGTTGTTTGGGATTGCAGCT
>Archaeospora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAA
GCGGGAACAGCCCAAATTTTAAATCGATCAAAAGGTCGAGTTGTAATTTGTAGAATTGCTTTCCACGTCTTTATCCG
ATGAAAAGTCCCTTGGAATAGGGCATCACAGAGGGTGATAATCCCGTATTTTATCGTGATTTTGACGTCGTGTGTAG
TAATTTCAAAGAGTCGAGTTGTTTGGGATTGCAGCT
>Palaeospora
CCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACCAGGATTCCCCTAGTAACGGCGAGTGAA
GCGGGAATAGCCCAAATTTTAAATCAATCTTTATGATTGAGTTGTAATTTGAAGAATTGCTTTCCATATCTTGATCC
GATGAAAAGTCTCTTGGAATAGAGCATCATAGAGGGTGATAATCCCGTATTCTGTCGTGATCTTGATATCGTGTGTA
GTAATTTCAAAGAGTCGAGTTGTTTGGGATTGCAGCT
The Cleandata arbuscular mycorrhizal fungi sequence with clear annotation information corresponding with above-mentioned and amplification region is carried out
Blast is compared, and filters out the similarity that is consistent with above-mentioned sequence greater than 97%, coverage is greater than 99.6%, the sequence less than 100.4%
Column secondary are compared the sequence screened the canonical sequence progress most like with it is one-to-one using the Blast function of NCBI
(one-to-one secondary comparison can eliminate influence of the Database size to e-value), obtains the e-value for annotation, will
The identical sequence of e-value is classified as one group, is annotated with the highest category of corresponding sequence similarity, is annotated into same category
E-value different groups are respectively labeled as sp1, sp2, spx ... etc.；
The results are shown in Table 2 for annotation:
Plant
Table 2
。
Embodiment 2
Detect arbuscular mycorrhizal fungi classification in soil
One, DNA is extracted
The gene that OMEGA soil DNA extracts kit (catalog number D5625-02) extracts soil is adopted in the extraction of soil DNA
Group DNA, the specific method is as follows:
(1) 500mg bead is weighed into 15ml centrifuge tube, and the soil sample of soil, adds 0.5g astragalus mongolicus sample is added
1ml Buffer SLX Mlus.Maximum speed vortex 3-5min；
(2) 100 μ l DS Buffer are added, is vortexed and mixes；
(3) 70 DEG C of incubation 10min, being during which mildly vortexed, it is primary to mix.Can be adjusted the temperature to by cracking difficult sample by 90 DEG C；
(4) room temperature 3000rpm is centrifuged 3min.800 μ l supernatants are shifted into new 2ml pipe and 270 μ l Buffer SP2 are added.
It is vortexed and mixes sample；
(5) 5min, 13000 X g, 4 DEG C of centrifugation 5min are placed on ice；
(6) it takes supernatant into new 2ml centrifuge tube, the isopropanol of 0.7 times of volume is added.It is mixed by inversion 20-30 times.If soil
DNA content is lower, can be by -20 DEG C of ice bath 1h of sample；
(7) 13000 X g, 4 DEG C of centrifugation 10min；
(8) supernatant is abandoned, precipitating is not encountered.Pipe is placed upside down the 1min on blotting paper and draws residual liquid；
(9) the Elution Buffer, vortex 10sec of 200 μ l is added.In 65 DEG C of incubation 10-20min；
(10) 50-100 μ l HTR solution is added, is vortexed and mixes 10sec；
(11) 2 min are placed at room temperature for, 13000 X g are centrifuged 2 min；
(12) take supernatant into the new pipe of 2ml；
(13) the XP2 Buffer of equal volume is added, is vortexed and mixes；
(14) complete soln in 13 steps is transferred in HiBind pillar, is placed in 2ml collecting pipe (offer), 10000 X g
It is centrifuged 1min.It abandons filtrate and places back in pillar in collecting pipe；
(15) 300 μ l XP2 buffer, 10000 X g are added and are centrifuged 1min, abandon filtrate and collecting pipe；
(16) renew 2ml collecting pipe (offer), 700 μ l SPW Wash buffer, 10000 X g are added and are centrifuged 1min, abandon filtrate
And pillar is placed back in collecting pipe；
(17) step (16) are repeated；
(18) filtrate is abandoned, 13000 X g skies are from 2min；
(19) pillar is placed in clean 1.5ml centrifuge tube (providing for oneself), be added 30-100 μ l Elution Buffer, 65 DEG C
Incubate 10-15min；
(20) 13000 X g are centrifuged 1min；
(21) 19-20 step is repeated, the DNA of extraction is stored in -20 DEG C；
The genomic DNA obtained by above method.
Two, polymerase chain reaction (PCR)
Ibid.
Three, high-flux sequence is carried out to PCR reaction product
Ibid.
Four, bioinformatic analysis
Ibid, the results are shown in Table 3 for annotation:
Soil
Table 3
。
Sequence table
<110>Inner Mongolia Technology University Baotou Medical College
<120>a kind of primer and detection method based on high-flux sequence detection arbuscular mycorrhizal fungi
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 49
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
atntnvrsnc cgctgaactt aagcatatca gctgcawtcc caaacaact 49
Claims (8)
1. a kind of primer pair based on high-flux sequence detection arbuscular mycorrhizal fungi, which is characterized in that primer sequence is as follows:
One: 5 '-CCGCTGAACTTAAGCATATC-3 ' of primer；
Two: 5 '-AGCTGCAWTCCCAAACAACT-3 ' of primer.
2. a kind of detection method using primer pair described in claim 1 based on high-flux sequence detection arbuscular mycorrhizal fungi,
It is characterized in that comprising the steps of:
Step 1, using the DNA in plant to be identified or soil as template, the primer pair described in claim 1 connection be suitable for high pass
First round PCR amplification is carried out after measuring the universal joint of sequence, obtains a wheel PCR product of the both ends with universal joint；With a wheel PCR
Product is template, carries out two wheel PCR amplifications with 5 ' universal primers of the end with sequence measuring joints and index of PCR product, obtains both ends
The two wheel products with sequence measuring joints and index sequence；
Step 2 carries out high-flux sequence to the two wheels pcr amplification product after purification, by the resulting data of high-flux sequence
Rawdata is converted into Cleandata by processing；
Step 3, by Cleandata sequence with there is the corresponding sequence of the arbuscular mycorrhizal fungi 28SrRNA of clear annotation information
Column are compared, and the similarity compared by setting is more than or equal to 97% and coverage rate is greater than 99.6%, less than 100.4%, filter out
Sequence under this condition, by the sequence screened and the highest arbuscular mycorrhizal fungi canonical sequence of similarity in NCBI into
The one-to-one Blast of row is compared, and obtains the e-value for annotation；
Step 4, according to similarity, coverage rate and e-value by the Sequence annotation screened to belong to level-one, to realize in sample
The detection and identification of arbuscular mycorrhizal fungi.
3. according to claim 2 true based on high-flux sequence detection arbuscular mycorrhiza using primer pair described in claim 1
The detection method of bacterium, it is characterised in that: the system of the PCR amplification are as follows: Pusion Hot start flex 2X Master
2.5 μ l, Template DNA of Mix 12.5 μ l, Forward Primer, 2.5 μ l, Reverse Primer, 50 ng, adds
ddH2O to 25 μ l.
4. according to claim 2 true based on high-flux sequence detection arbuscular mycorrhiza using primer pair described in claim 1
The detection method of bacterium, it is characterised in that: the reaction condition of the PCR amplification are as follows: 98 DEG C initial denaturation 30 seconds；Then according to following ginseng
Number carry out circular responses: 98 DEG C be denaturalized 10 seconds, 54 DEG C renaturation 30 seconds, 72 DEG C extend 45 seconds；Circulation 35 times；After circular response
It is kept for 10 minutes at 72 DEG C, reaction product will be obtained and saved at 4 DEG C.
5. according to claim 2 true based on high-flux sequence detection arbuscular mycorrhiza using primer pair described in claim 1
The detection method of bacterium, it is characterised in that: the detection range of the arbuscular mycorrhizal fungi includes with subordinate:Gigaspora、 Dentiscutata、Scutellospora、Racocetra、Rhizophagus、Glomus、Kamienskia、Dominikia、Funneliformis、Septoglomus、Acaulospora、Sacculospora、Pacispora、Diversispora、Otospora、Redeckera、Corymbiglomus、Claroideoglomus、Ambispora、Archaeospora、Palaeospora。
6. according to claim 2 true based on high-flux sequence detection arbuscular mycorrhiza using primer pair described in claim 1
The detection method of bacterium, it is characterised in that: in the step 1, original series processing mode is that data split, splice and filter.
7. according to claim 2 true based on high-flux sequence detection arbuscular mycorrhiza using primer pair described in claim 1
The detection method of bacterium, it is characterised in that: the way of purification in the step 1 was column purification, ethyl alcohol/sodium acetate purifying, SAP-
Any one mode in Exon I way of purification.
8. the primer pair according to claim 1 based on high-flux sequence detection arbuscular mycorrhizal fungi, which is characterized in that institute
Stating the W in primer two is degenerate primer, site A and the mixing of T equal proportion, and its ratio be 1:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910024614.6A CN109680091B (en) | 2019-01-10 | 2019-01-10 | Primer and detection method for detecting arbuscular mycorrhizal fungi based on high-throughput sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910024614.6A CN109680091B (en) | 2019-01-10 | 2019-01-10 | Primer and detection method for detecting arbuscular mycorrhizal fungi based on high-throughput sequencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109680091A true CN109680091A (en) | 2019-04-26 |
| CN109680091B CN109680091B (en) | 2022-04-19 |
Family
ID=66192942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910024614.6A Active CN109680091B (en) | 2019-01-10 | 2019-01-10 | Primer and detection method for detecting arbuscular mycorrhizal fungi based on high-throughput sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109680091B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877464A (en) * | 2021-03-10 | 2021-06-01 | 内蒙古科技大学包头医学院 | Plant identification method based on adjacent microsatellite sequences in transcriptome |
| CN116103308A (en) * | 2022-11-16 | 2023-05-12 | 福建农林大学 | Reporter gene for indicating formation of arbuscular mycorrhiza of tomato and application thereof |
| CN118389744A (en) * | 2024-06-25 | 2024-07-26 | 中国科学院华南植物园 | Detection primer and detection method for saline-alkali tolerant licorice dominant arbuscular mycorrhizal fungi specific strain |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333566A (en) * | 2008-07-30 | 2008-12-31 | 黑龙江大学 | Analytical method for strain group structure of arbuscular mycorrhizal fungi of phellodendren amurense rupr. |
| CN104450536A (en) * | 2014-11-13 | 2015-03-25 | 山东农业大学 | Separation of arbuscular mycorrhizal fungi as well as preparation and application of arbuscular mycorrhizal fungi fungicide |
-
2019
- 2019-01-10 CN CN201910024614.6A patent/CN109680091B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333566A (en) * | 2008-07-30 | 2008-12-31 | 黑龙江大学 | Analytical method for strain group structure of arbuscular mycorrhizal fungi of phellodendren amurense rupr. |
| CN104450536A (en) * | 2014-11-13 | 2015-03-25 | 山东农业大学 | Separation of arbuscular mycorrhizal fungi as well as preparation and application of arbuscular mycorrhizal fungi fungicide |
Non-Patent Citations (3)
| Title |
|---|
| BENJAMIN S. T. MORGAN: "Barcoded NS31/AML2 primers for sequencing of arbuscular mycorrhizal communities in environmental samples", 《APPLICATIONS IN PLANT SCIENCES》 * |
| KNUD BRIANNIELSEN: "Colonization of new land by arbuscular mycorrhizal fungi", 《FUNGAL ECOLOGY》 * |
| 王启: "一种基于扩增子测序检测丛枝菌根真菌的方法", 《基因组学与应用生物学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877464A (en) * | 2021-03-10 | 2021-06-01 | 内蒙古科技大学包头医学院 | Plant identification method based on adjacent microsatellite sequences in transcriptome |
| CN116103308A (en) * | 2022-11-16 | 2023-05-12 | 福建农林大学 | Reporter gene for indicating formation of arbuscular mycorrhiza of tomato and application thereof |
| CN118389744A (en) * | 2024-06-25 | 2024-07-26 | 中国科学院华南植物园 | Detection primer and detection method for saline-alkali tolerant licorice dominant arbuscular mycorrhizal fungi specific strain |
| CN118389744B (en) * | 2024-06-25 | 2024-09-27 | 中国科学院华南植物园 | Detection primer and detection method for saline-alkali tolerant licorice dominant arbuscular mycorrhizal fungi specific strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109680091B (en) | 2022-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108753967B (en) | Gene set for liver cancer detection and panel detection design method thereof | |
| CN107190329B (en) | Fusion based on DNA is quantitatively sequenced and builds library, detection method and its application | |
| CN107177670B (en) | Method for detecting Parkinson disease pathogenic gene mutation in high throughput manner | |
| CN106676182B (en) | Method and device for detecting low-frequency gene fusion | |
| CN102373288B (en) | Method and kit for sequencing target areas | |
| CN103131754B (en) | Method for detecting nucleic acid hydroxylmethylation modification, and application thereof | |
| CN109680091A (en) | A kind of primer and detection method based on high-flux sequence detection arbuscular mycorrhizal fungi | |
| CN109486923B (en) | Primer system for sequencing multiple amplicons, application thereof and method for constructing sequencing library | |
| CN105368930B (en) | The determination method that enzymes combinations are sequenced in genotyping technique is sequenced | |
| CN106065414A (en) | Noninvasive cancer of pancreas polygenes detection method and kit based on blood plasma cfDNA detection technique | |
| CN108753954B (en) | Capture probe set of dementia-related gene, kit, library construction method and application | |
| CN110970091B (en) | Label quality control method and device | |
| CN107475403A (en) | The analysis method of the method for detection Circulating tumor DNA, kit and its sequencing result from peripheral blood dissociative DNA | |
| CN107699957A (en) | Fusion based on DNA, which is quantitatively sequenced, builds storehouse, detection method and its application | |
| CN103205420A (en) | Primer composition for amplifying T cell receptor beta chain CDR3 coding sequence and application thereof | |
| CN110004225B (en) | Tumor chemotherapeutic drug individualized gene detection kit, primers and method | |
| CN107475449A (en) | A kind of transcript profile sequence measurement spliced suitable for dwarf virus section and geminivirus infection coe virus genome | |
| CN111424119B (en) | High-flux detection primer and kit for SARS-CoV-2 virus | |
| CN110343754A (en) | A method of it is quickly detected for hematopoietic stem cell transplantation donor pathogenic microorganism | |
| CN110564843A (en) | Primer group and kit for detecting thalassemia mutant type and deletion type genes and application of primer group and kit | |
| CN106086193A (en) | A kind of method analyzing mixing sample DNA based on INDEL SNP linkage relationship | |
| CN106701949B (en) | A kind of detection method of gene mutation and reagent reducing amplification bias | |
| CN116355909A (en) | Marker for detecting amplification of neuroblastoma MYCN and application thereof | |
| CN107446991A (en) | A set of SNP site and its application for being applied to identification hop varieties and purity | |
| CN102586472B (en) | Method and kit for assaying hepatitis B virus DNA (deoxyribonucleic acid) sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |