CN109679971A - The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon - Google Patents

The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon Download PDF

Info

Publication number
CN109679971A
CN109679971A CN201910033125.7A CN201910033125A CN109679971A CN 109679971 A CN109679971 A CN 109679971A CN 201910033125 A CN201910033125 A CN 201910033125A CN 109679971 A CN109679971 A CN 109679971A
Authority
CN
China
Prior art keywords
watermelon
aox
molecular labeling
claox
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910033125.7A
Other languages
Chinese (zh)
Inventor
胡仲远
张明方
薛琴
杨景华
丁长庆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang University ZJU
Original Assignee
Zhejiang University ZJU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University ZJU filed Critical Zhejiang University ZJU
Priority to CN201910033125.7A priority Critical patent/CN109679971A/en
Publication of CN109679971A publication Critical patent/CN109679971A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0055—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10)
    • C12N9/0057—Oxidoreductases (1.) acting on diphenols and related substances as donors (1.10) with oxygen as acceptor (1.10.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y110/00—Oxidoreductases acting on diphenols and related substances as donors (1.10)
    • C12Y110/03—Oxidoreductases acting on diphenols and related substances as donors (1.10) with an oxygen as acceptor (1.10.3)
    • C12Y110/03011—Ubiquinol oxidase (1.10.3.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention belongs to vegetables resistance molecule marker development and technical field of molecular marker-assisted breeding, specifically, the invention discloses a kind of resistance AOX genes of feed watermelon, and the invention also discloses the molecular labelings of the important adversity gene AOX of watermelon ----and the associated PCR molecular labeling of resistance SNP；The purposes of the molecular labeling is: the assisted selection for the resistance AOX gene in watermelon.Present invention molecular labeling ClAOX-K/N label obtained, can be used for the backcrossing assistant breeding of watermelon resistance AOX.

Description

The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon
Technical field
The invention belongs to vegetables resistance molecule marker development and technical field of molecular marker-assisted breeding, specifically design one kind It is quickly screened suitable for the abiotic resistance germplasm of watermelon and back cross breeding provides a kind of novel and easy molecular labeling and auxiliary Selection method.
Background technique
The mitochondrial protein that the alternative oxidase of plant is encoded by karyogene AOX (alternative oxidase), generally It is present in higher plant, (McDonald and Vanlerberghe 2006, Van in fungi and low no spinal animals Aken,Zhang et al.2009).It is a small gene family that the gene of alternative oxidase is encoded in higher plant, early Phase according to its function it is different be divided into again two subfamilies of AOX1 and AOX2 (Clifton, Millar et al.2006, Costa, Cardoso et al.2009,Abu-Romman,Shatnawi et al.2012,Costa,Cardoso et al.2014)。 To arabidopsis AOX family the study found that its family is made of 5 AOX genes, each group in entire growth course of AOX1a It knits and has expression in organ；AOX1b is mainly the early expression in development of floral organs；Although AOX1c entire was developed a Also there is expression in each tissue and organ in journey, but its expression is lower；AOX1d is only early stage lotus throne leaf development It is expressed with having in the growth course of floral organ；AOX2 mainly in seed maturation and germination process expression (Clifton, Millar et al.2006).The typical feature of AOX1 subfamily be with it is various biology, abiotic stress it is closely related and Have in unifacial leaf, dicotyledon presence (Clifton, Millar et al.2006, Giraud, Ho et al.2008, Ho,Giraud et al.2008,Watanabe,Hachiya et al.2008).The expression tool of each gene in AOX2 subfamily It is organized specific and closely related with each stage of development, while the Asia AOX2 is not up to the present found in monocotyledon yet Relevant report (Considine, Holtzapffel et al.2002, Frederico, the Zavattieri et of family al.2009).With the discovery that deepens continuously to alternating oxidation Study of way, the gene of AOX2 subfamily in some species Expression is also by the regulation of environment stress (Cavalcanti, Oliveira et al.2013).
It is currently known most of abiotic stress researchs relevant to alternating oxidation approach and all concentrates on temperature stress, especially It is low temperature stress.A large number of studies show that plant is by low temperature or when being grown on low temperature environment, the expression of AOX gene or albumen contain Amount meeting significantly up-regulation (Vanlerberghe and Mcintosh 1992, Taylor, Day et al.2002, Fiorani, Umbach et al.2005,Armstrong,Badger et al.2008,Mizuno,Sugie et al.2008,Umbach, Lacey et al.2009,Wang,Rajakulendran et al.2011).Using tracer method studies have shown that AOX Gene is able to respond the low temperature stress of instantaneous (a few minutes to dozens of minutes), short-term (a few houres to several days), long-term (a few weeks).It is right Low-temperature sensitive type plant Zea mays carry out 5 DEG C and find after low-temperature treatment 5 days, and specific gravity of the alternating oxidation breathing in total breathing is up to 60% (Ribas-Carbo,Aroca et al.2000).AtAOX1a gene expression after the short-term low-temperature treatment of arabidopsis is significantly raised, But the extension with the processing time can restore again to normal level (Armstrong, Badger et al.2008).AOX is to low temperature The response of stress is not only different due to the difference of species and histoorgan, also by the degree of low temperature stress, time and stress hair The influence of the developmental state of plant when raw.Plant carbon metablism is closely related with alternating oxidation approach under low temperature stress, and AOX is overexpressed Transgenic Arabidopsis plants can be accumulated when by low temperature carbohydrate more more than wild type (Wang, Rajakulendran et al.2011).The missing of AOX gene can enhance mitochondria stress response to control intracellular ROS Content.After the transgene tobacco progress low-temperature treatment that AOX is inhibited to expression, its ROS with higher amount compared with wild type Relevant enzyme is removed, the oxidative damage slightly lighter than wild type (Wang, Rajakulendran et al.2011) is also shown.
Alternating oxidation approach is not only involved in the regulation of low temperature stress, is also closely related with stress such as arid, salt, elements.It is dry Drought coerces AOX gene expression up-regulation in lower wheat leaf blade, the specific gravity that ATLD algorithm accounts in total breathing rise (Bartoli, Gomez et al.2005,Vassileva,Simova-Stoilova et al.2009)；After Osmotic treatment in alfalfa-leaves AOX gene shows downward expression (Filippou, Antoniou et al.2011)；Drought stress will lead to Mitochondrial electron The numerous electronics of transfer chain more transmits (Galle, Florez-Sarasa et al.2010) from alternating oxidation approach；To quasi- The expression study discovery of AOX gene, salt stress can induce AOX gene under the plants salt stress such as southern mustard, pea, tobacco, white poplar Expression (Kreps, Wu et al.2002, Seki, Narusaka et al.2002, Ottow, Brinker et al.2005, Andronis and Roubelakis-Angelakis 2010,Marti,Florez-Sarasa et al.2011)；Tobacco from The plants such as cell, Arabidopsis thaliana Seedlings, the soybean of body culture coerce the expression meeting of lower AOX gene at P elements (Phosphate, P) Obviously raise (Rychter and Mikulska 1990, Parsons, Yip et al.1999, Gonzalez-Meler, Giles et al.2001,Vijayraghavan and Soole 2010)；More and more evidences show alternating oxidation way Diameter has extremely important effect during plant abiotic stress regulatory.And crucial base of the AOX as alternating oxidation approach Cause plays a significant role the screening and molecular mark of plant abiotic resistance.And wildlife species are generally left Stronger degeneration-resistant character, this phenomenon often with related resistance genes in wild germplasm genome and common cultivation kind emphasis Gene order difference is related.
Summary of the invention
The resistance AOX gene that the technical problem to be solved by the present invention is to be cloned into a feed watermelon, provides one kind With the associated PCR molecular labeling of resistance SNP；Present invention molecular labeling ClAOX-K/N label obtained, can be used for watermelon resistance The backcrossing assistant breeding of AOX.
In order to solve the above technical problem, the present invention provides a kind of resistance AOX gene of feed watermelon, the cores of the gene Nucleotide sequence is as described in SEQ ID NO:1.
The present invention goes back while providing the molecular labeling of the important adversity gene AOX of watermelon, using rice as species (with cultivation Watermelon CW and feed watermelon WW is species), it is that molecular labeling ClAOX-K or molecular labeling ClAOX-N, molecular labeling primer are selected from Following primer pair, nucleotides sequence therein are classified as 5 ' → 3 ',
ClAOX-K:WW forward primer (F): TTAAACTTGTGTCTTTGAGGTATTC；
WW reverse primer (R): TGGATGTCCTGCACACACAAAAA.
ClAOX-N:CW forward primer (F): ACTTGTCTTTAAGGTACTGAATTTT；
CW reverse primer (R): ACATACAAAAAGAAAAAACCCAT.
The present invention goes back while providing the purposes of above-mentioned molecular labeling: the auxiliary for the resistance AOX gene in watermelon is selected Select breeding.
The improvement of purposes as molecular labeling of the invention: when for the hybridization of beautiful side (maternal, cultivated watermelons) and 1550 When offspring, banding pattern and the consistent single plant of ClAOX-K banding pattern in offspring is selected to be used for breeding.
That is, selecting to contain only single band in offspring when screening the filial generation of beautiful side's female parent and feed watermelon 1550 Pure lines single plant, construct near isogenic lines for being constantly returned.
The present invention goes back while providing the protein of the coding of the resistance AOX gene in above-mentioned feed watermelon, protein tool There is amino acid sequence described in SEQ ID NO:3.
Another: the nucleotide sequence of the AOX gene of cultivated watermelons as described in SEQ ID NO:2, compile by the AOX gene of cultivated watermelons The protein of code has amino acid sequence described in SEQ ID NO:4.
Team where inventor by studying for many years, find feed watermelon (wild germplasm) and cultivated watermelons it is important There are a single base mutation (SNP) in the sequence of adversity gene ClAOX, which results in the non-synonymous prominent of amino acid K to N Become.The series jump is likely to closely related with the abiotic resistance such as low temperature resistant.
The exploitation of molecular labeling (molecular labeling ClAOX-K/N related with the resistance AOX gene in watermelon) of the invention Method, comprising the following steps:
1), with Plant DNAzol (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonnium Bromide) method extract respectively cultivated watermelons (glad No. 3 male parents in capital, honey are precious, sweet No. 10 male parents in Zhejiang) and wild feed watermelon (940, 1326,1550) genomic DNA；
2) RNA, is carried out to above-mentioned material with the RNApre pure plant kit (TIANGEN, DP432) of Tiangeng company Extraction, and reverse transcription is at cDNA；
3) it, is carried out in watermelon using polymerase chain reaction (Polymerase Chain Reaction, PCR) method The screening of resistance AOX genetic marker；
4) a PCR molecular labeling ClAOX-K/N, is developed.
The PCR molecular labeling of the important adversity gene AOX of watermelon, specially following methods obtain:
1), compare the genome sequence of the gene C lAOX of cultivated watermelons (CW) and feed watermelon (WW) coding alternative oxidase Column, the resistance AOX gene identified in 2 class watermelons have SNP at the genomic level；
2) SNP, is had based on the resistance AOX gene in cultivated watermelons and feed watermelon at the genomic level, in third It includes subregion and separately designs pair of primers；
3) cultivated watermelons (glad No. 3 male parents in capital, honey are precious, sweet No. 10 male parents in Zhejiang) and wild, are extracted with Plant DNAzol method Watermelon (940,1326,1550) seedling genomic DNA；
4) screening of the resistance AOX genetic marker in watermelon, is carried out using PCR method；
PCR system are as follows: 1 μ l, Blue mix of 200ng/ μ l watermelon genomic DNA 10 μ l, 10 μM of forward and reverse each 1.0 μ of primer L, ddH27 μ l of O, 20 μ l of total volume.；
PCR amplification program are as follows: 94 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 30 seconds, 54.8 DEG C (ClAOX-K)/50.4 DEG C (ClAOX-N) it anneals 30 seconds, 72 DEG C extend 30 seconds, 35 circulations；72 DEG C of terminations are reacted 10 minutes；
Product detection: it observes and shines under 4.0% agarose gel electrophoresis containing 0.5%ug/ul EB, ultraviolet lamp Mutually record result.
When running out of a band using K label, and when length is 265bp condition, determine: the sample genotype is homozygosis KK.
When running out of a band using N label, and when length is 247bp condition, determine: the sample genotype is homozygosis NN.
When a band can be run out of using K and N label, and when length is 265 and 247bp condition, determine: the sample gene Type is heterozygosis KN.
5) PCR label ClAOX-K/N, is developed, is assisted using the backcrossing that the label can be used to watermelon resistance AOX gene Breeding.
During invention, inventor had used following molecular labeling primer:
CLAOX-F1-N2 ACTTGTCTTTAAGGTACTGAATT
CLAOX-R1-N2 ACATACAAAAAGAAAAAACCCAT
But the molecular labeling primer can not achieve the present invention.
Detailed description of the invention
Specific embodiments of the present invention will be described in further detail with reference to the accompanying drawing.
Fig. 1 is the nucleotide sequence of the resistance AOX gene in feed watermelon (940,1326,1550).
Fig. 2 is the amino acid alignment of the resistance AOX gene in feed watermelon and cultivated watermelons.
Fig. 3 is the electrophoretic band figure of verifying of the ClAOX-K/N label in parent；
A is glad No. 3 male parents in capital, honey treasured, Zhejiang honey No. 10 male parents, 940,1326,1550, CWCDNA, WWCDNA, Marker The electrophoretic band figure of (arraying from left to right), uses molecular labeling ClAOX-N；
In electrophoretic band figure, most left, most right is Marker；It is such as the following same；
B is glad No. 3 male parents in capital, honey treasured, Zhejiang honey No. 10 male parents, 940,1326,1550, CWCDNA, WWCDNA, (Cong Zuozhi The right side is arranged successively) electrophoretic band figure, use molecular labeling ClAOX-K.
Learnt according to Fig. 3: molecular labeling ClAOX-N specifically expressing in cultivated watermelons, molecular labeling ClAOX-K is in feed Specifically expressing in watermelon.
Fig. 4 is the electrophoretic band figure of application of the ClAOX-K/N label in hybridization F2 offspring；
A be beautiful side's female parent and 1550 hybridization F2 sample 1-19 electrophoretic band figure；
B be beautiful side's female parent and 1550 hybridization F2 sample 21-35 electrophoretic band figure；
A, in B are as follows: the first row molecular labeling ClAOX-K, the second row are molecular labeling ClAOX-N.
Learnt according to Fig. 4: 11 be homozygous KK, and 10,12,16,17,23,24,31 be homozygous NN.
Fig. 5 is electrophoretic band and sequence alignment result；
A be Marker, 1550, beautiful side is maternal, the electrophoretic band figure of CWCDNA (arraying from left to right) in triplicate, Use molecular labeling ClAOX-N；
B be Marker, 1550, beautiful side is maternal, the electrophoretic band figure of CWCDNA (arraying from left to right) in triplicate, Use molecular labeling ClAOX-K；
C is beautiful side's germline comparison result；D is 1550 sequence alignment results.
Fig. 6 is contrast difference's figure；
Fig. 7 is WW feed watermelon nucleotide (DNA) sequence.
Fig. 8 is CW cultivated watermelons nucleotide (DNA) sequence.
Specific embodiment
The present invention is described further combined with specific embodiments below, but protection scope of the present invention is not limited in This:
Embodiment 1,
Its F is obtained with beautiful side's female parent and 1550 hybridization1；F1Selfing, obtains F2。
One, DNA is extracted
, 1550, F maternal to above-mentioned beautiful side2Blade be handled as follows respectively:
1., weigh the water melon leaf liquid nitrogen grinding powdering of 0.1g, the DNAzol Extraction buffer of 1ml is then added (Lifescience company), 65 DEG C water-bath 30 minutes.Again plus the chloroform of 750 μ l, it and mixes.12,000rpm centrifugations 5 minutes, will Supernatant is transferred in new centrifuge tube.
2., after 1. above-mentioned steps are centrifuged in resulting supernatant plus 0.7 times of volume isopropanol, mix gently to DNA Precipitating.12,000rpm centrifugations 10 minutes, pour out supernatant.
3., again with the ethanol washing above-mentioned steps of 1ml 75% 2. resulting DNA sediment, overturn for several times, 3000rcf from The heart 5 minutes.
4., repeat the above steps, the DNA after washing is stored at room temperature and dries and is dissolved within 10 minutes in 100 μ l pure water.
5., the concentration of ultraviolet spectrophotometry detection above-mentioned steps 4. resulting DNA sample, 0.7% Ago-Gel The integrality of electrophoresis detection DNA.Complete suitable DNA is used for PCR amplification, and incomplete DNA is then extracted again, until having obtained Whole DNA.
Two, PCR amplification
1), PCR reaction system:
1 μ l, 2*Taq Master Mix (Biolife company) of 200ng/ μ l watermelon genomic DNA, 10 μ l, 10 μM forward and reverse Primer each 1.0 μ l, ddH27 μ l of O, 20 μ l of total volume.
Primer is following any:
ClAOX-K:WW forward primer (F): TTAAACTTGTGTCTTTGAGGTATTC；
WW reverse primer (R): TGGATGTCCTGCACACACAAAAA.
ClAOX-N:CW forward primer (F): ACTTGTCTTTAAGGTACTGAATTTT；
CW reverse primer (R): ACATACAAAAAGAAAAAACCCAT.
Primer (molecular labeling) can entrust Shanghai Sani Biotechnology Co., Ltd to synthesize, in ABI Veriti96PCR instrument Upper carry out PCR amplification.
2), response procedures:
94 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 30 seconds, and 54.8 DEG C (ClAOX-K)/50.4 DEG C (ClAOX-N) are annealed 30 seconds, and 72 DEG C extend 30 seconds, 35 circulation；72 DEG C of terminations are reacted 10 minutes；
Three, electrophoresis detection (product detection)
Amplified production 10ul is taken, under 1.0% agarose gel electrophoresis containing 0.005%Goldview, ultraviolet lamp Observe simultaneously film recording result.
ClAOX-K is corresponding as a result, as shown in Figure 5 B.Beautiful side's female parent does not have band, and 1550 be the band of 265bp, " F2 " For 256bp band or no band.
ClAOX-N is corresponding as a result, as shown in Figure 5A.Beautiful side's female parent is the band of 247bp, and 1550 do not have band, " F2 " For 247bp or no band.
Therefore, it can be seen that: using ClAOX-K/N label can efficiently distinguish F2The AOX genotype of plant.
Embodiment 2, with the beautiful side of molecular markers for identification it is maternal and 1550 sequence difference
Step 1~step 3 is the same as embodiment 1；
Four, the recycling of PCR product
PCR product recycling select OMEGA company exploitation PCR product QIAquick Gel Extraction Kit (centrifugal column type, catalog number (Cat.No.): DP1403), require to carry out referring to the description of product, the PCR product of recycling entrusts corresponding Bioisystech Co., Ltd to be sequenced.
According to Fig. 5, it can be concluded that there are no 265bp's for beautiful side's female parent and 1550 ClAOX-K amplified production There are the band of no 247bp is poor for the difference (as described in underscore) of band, beautiful side's female parent and 1550 ClAOX-N amplified production Different (as described in underscore).
Specifically:
Beautiful side's female parent can not obtain amplified production with ClAOX-K.
The sequence of 1550 ClAOX-K amplified production are as follows:
TTAAACTTGTGTCTTTGAGGTATTCAATTTTAAGATCTTGATGAATAATTATTCTATCATTTCAATTT TAGTGTCTCGTAGATTTGTTGATTTTATAAAATGTCGAATATGTCATTCTTATTAGATATGAAATTGAAATTTCAA TGATGTATTGGACGTACGCAATTGAAAGTTTTTAGAATATAGTTATGTTTTTAAGATGCTTTTTTAAGCTAACTAT TAAATGGCATGGGTCTT****TTTTGTGTGTGCAGGACATCCATT。
The sequence of beautiful side's female parent ClAOX-N amplified production are as follows:
ACTTGT**CTTTAAGGTACTGAATTTTAAGATCTTGATGGACAATTATTCTATCATTTTAATTTTAGT GTCTTGTAGATCTGTTGATTTTATAAAATGTCAAATATATCATACTTATTAGATATAAAATTGAAATTTCAATGATG TATTAGACGTACGCAATTGAAAGTTTTTAGAATATAGTTATGTTTTTAAGATGCTTTTTTAAGCAAACTATTAAATG GCATGGGTTTTTTCTTTTTGTATGT
1550ClAOX-N can not obtain amplified production.
As described in Figure 6.
Remarks explanation: above-mentioned " feed watermelon 1550 " is changed to " feed watermelon 940 ", " feed watermelon 1326 " respectively；Its Described in remaining same embodiment 2.Acquired results are identical as feed watermelon 1550.
Embodiment 3 utilizes marker assisted selection breeding
The plant for choosing homozygosis KK in F2 group, with the maternal backcrossing of beautiful virtue.Offspring chooses 4-5 plants of single plant that there is K to mark As non-circulation material and beautiful virtue maternal backcrossing 6-7 generation, then it is selfed.Selection homozygosis KK plant is marked with K again.In this approach will The stress-resistant AOX (K) of feed watermelon imports cultivated watermelons.
The above list is only a few specific embodiments of the present invention for finally, it should also be noted that.Obviously, this hair Bright to be not limited to above embodiments, acceptable there are many deformations.Those skilled in the art can be from present disclosure All deformations for directly exporting or associating, are considered as protection scope of the present invention.
Sequence table
<110>Zhejiang University
<120>the PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1898
<212> DNA
<213>watermelon (carinorain)
<400> 1
ttatagccgg agctttggct ccgtcgccgg ggttgccggt ggtggcagtg gcggcggtat 60
gaaggtcact ttcgcggcgg tggcgtcgcc ggggacgagg tatcagccga tggtggatgg 120
gggattccag tggaggaggt tgttgagctc gtccacggcg gtggcggagg aacaggggaa 180
ggtgaaatta gaacagggga ttaaggatat tgagaatcag gagaagaagg aaaaagagac 240
ggagaaagct ttggtttcta gttattgggg gatttacagg ccgaagatta ctagggaaga 300
tgggtctgaa tggccttgga actgctttat ggtatgcatt tggtcttcgc tttatttgcc 360
cttttcaatg atctgtttta ttgactttaa agcgagcttc gaatttggtt gttgtactct 420
tgcccatcaa ctgtctgtta aaatgattgt ttgcttttgg ctttaaattg tgtgtccttt 480
tcctgggtaa ttcgatattc tttgaagttt gcttcatttg gctttgggag atgcgattaa 540
acgttttata atccagtgtt ttgatgaaat ccttcttgtt aagtatgaca acggagtttc 600
tgcaactgtt gtttttcttt tctaaacctt taatgagttg ttgttctgaa gaaactcttg 660
gtgtaaatgc agccgtggga gacctacaga gcggatctgt ccatagatct tggaaagcac 720
catgagccga aaacttttct cgacaaagtc gcttaccgcg ttgtgaagct tcttcgaatc 780
ccaacagata tcttcttcca ggtgggttat ctgatttgtt tgtttgctct tccttcatat 840
cccttcatat caatttttag aacccttctt acaaatgatt ctaaatgtag aaagttcctc 900
tggtcaacac aatgtgtttg ccttttcttt ccggtaggat tcagaattga aaatccaagt 960
aactcttcaa tacaagttta atagtgtaga atctgttggt atggccctta aatagtttca 1020
ccttaatgtg tgagtttctg ttttacattg tctagaattc atttcagttt ccgtgttgtg 1080
cagagacgct acggttgtcg agcagtgatg ctcgagacag tggcagcggt gccagggatg 1140
gttggaggga tgttgttgca tctgaagtct ctgaggaagt ttcagcacag tggggggtgg 1200
attaaggcct tgcttgaaga agcggagaat gagaggatgc atttaatgac catgattgag 1260
cttgtgcagc ccaagtggta cgagcggctg cttgtgatca cagtgcaggg agtgtttttc 1320
aatgccttct ttgtgctcta cttgatgtcc cccaaattgg ctcatagaat tgttggctat 1380
ttggaagagg aagccatcca ttcttacact gagtacttga aggatatcga cgaaggaaag 1440
atcgagaacg tccctgctcc cgccattgcc atcgactact ggaggctgcc taaggatgca 1500
aggcttaaag atgttatcac agtcattcgg gccgatgagg cgcaccaccg cgacgtcaac 1560
cattttgctt cggtgagtaa ctttgcttcc ttttctgttc tcatacttca caaagtatta 1620
tcatcaaatt ttaaacttgt gtctttgagg tattcaattt taagatcttg atgaataatt 1680
attctatcat ttcaatttta gtgtctcgta gatttgttga ttttataaaa tgtcgaatat 1740
gtcattctta ttagatatga aattgaaatt tcaatgatgt attggacgta cgcaattgaa 1800
agtttttaga atatagttat gtttttaaga tgctttttta agctaactat taaatggcat 1860
gggtcttttt tgtgtgtgca ggacatccat tccaagga 1898
<210> 2
<211> 1901
<212> DNA
<213>watermelon (carinorain)
<400> 2
gtatagccgg agctttggct ccgtcgccgg ggttgccggt ggtggcagtg gcggcggtat 60
gaaggtcact tttgcggcgg tggcgtcgcc ggggacgagg tatcagccga tggtggatgg 120
gggattccag tggaggaggt tgttgagctc gtccacggcg gtggcagagg aacaggggaa 180
ggtgaaatta gaacagggga ttaaggatat tgagaatcag gagaagaagg aaaaagagac 240
ggagaatgct ttggtttcta gttattgggg gatttacagg ccgaagatta ctagggaaga 300
tgggtctgaa tggccttgga actgctttat ggtatgcatt tggtctttgc tttatttgcc 360
cttttcaatg atctgtctta ttgactttaa agcgagcttc gaatttggtt gttgtactct 420
tgcccatcaa ctgtctgtta aaatgcttgt ttgcttttgg ctttaaattg tgtgtccttt 480
tcctgggtaa ttcgatattc tttgaagttt gcttcatttg gctttgggaa atgcgattaa 540
acgttttata atccagtgtt ttgatgaaat ccttcttgtt aagtatgaca acggagtttc 600
tgcaactgtt gtttttcttt tctaaacctt taatgagttg ttgttctgaa gaaactcttg 660
gtgtaaatgc agccgtggga gacctacaga gcggatctgt ccatagatct tggaaagcac 720
catgagccga aaacttttct cgacaaagtc gcttaccgcg ttgtgaagct tcttcgaatc 780
ccaacagata tcttcttcca ggtgggttat ctgatttgtt tgtttgctct tccttcatat 840
cccttcatat caatttttag aacccttctt acaaatgatt ctaaatgtag aaagttcctc 900
tggtcaacac aatgtgtttg ccttttcttt ccggtaggat tcagaattga aaatccaagt 960
tactcttcat acaagtttaa tagtgtagaa tctgttggta tggcccttaa atagtttcac 1020
cttaatgtgt gagttcctgt tttacattgt ctagaattca tttcagtttc cgtgttgtgc 1080
agagacgcta cggttgtcga gcagtgatgc tcgagacagt ggcagcggtg ccggggatgg 1140
ttggagggat gttgttgcat ctgaagtctc tgaggaagtt tcagcacagt ggggggtgga 1200
ttaaggcctt gcttgaagaa gcggagaatg agaggatgca tttaatgacc atgattgagc 1260
ttgtgcagcc caagtggtac gagcggctgc ttgtgatcac agtgcaggga gtgtttttca 1320
atgccttctt tgtgctctac ttgatgtccc ccaaattggc tcatagaatt gttggctatt 1380
tggaagagga agccatccat tcttacactg agtacttgaa ggatatcgac gaaggaaaga 1440
tcgagaacgt ccctgctccc gccattgcca tcgactactg gaggctgcct aaggatgcaa 1500
ggcttaaaga tgttatcact gtcattcggg ccgatgaggc gcaccaccgc gacgtcaacc 1560
attttgcttc ggtgagtaac tttgcatcct tttctgttct catacttcac aaagtattat 1620
catcaaattt taaacttgtc tttaaggtac tgaattttaa gatcttgatg gacaattatt 1680
ctatcatttt aattttagtg tcttgtagat ctgttgattt tataaaatgt caaatatatc 1740
atacttatta gatataaaat tgaaatttca atgatgtatt agacgtacgc aattgaaagt 1800
ttttagaata tagttatgtt tttaagatgc ttttttaagc aaactattaa atggcatggg 1860
ttttttcttt ttgtatgtgc aggacatcca ttccaaggaa g 1901
<210> 3
<211> 301
<212> PRT
<213>watermelon (carinorain)
<400> 3
Met Lys Val Thr Phe Ala Ala Val Ala Ser Pro Gly Thr Arg Tyr Gln
1 5 10 15
Pro Met Val Asp Gly Gly Phe Gln Trp Arg Arg Leu Leu Ser Ser Ser
20 25 30
Thr Ala Val Ala Glu Glu Gln Gly Lys Val Lys Leu Glu Gln Gly Ile
35 40 45
Lys Asp Ile Glu Asn Gln Glu Lys Lys Glu Lys Glu Thr Glu Lys Ala
50 55 60
Leu Val Ser Ser Tyr Trp Gly Ile Tyr Arg Pro Lys Ile Thr Arg Glu
65 70 75 80
Asp Gly Ser Glu Trp Pro Trp Asn Cys Phe Met Pro Trp Glu Thr Tyr
85 90 95
Arg Ala Asp Leu Ser Ile Asp Leu Gly Lys His His Glu Pro Lys Thr
100 105 110
Phe Leu Asp Lys Val Ala Tyr Arg Val Val Lys Leu Leu Arg Ile Pro
115 120 125
Thr Asp Ile Phe Phe Gln Arg Arg Tyr Gly Cys Arg Ala Val Met Leu
130 135 140
Glu Thr Val Ala Ala Val Pro Gly Met Val Gly Gly Met Leu Leu His
145 150 155 160
Leu Lys Ser Leu Arg Lys Phe Gln His Ser Gly Gly Trp Ile Lys Ala
165 170 175
Leu Leu Glu Glu Ala Glu Asn Glu Arg Met His Leu Met Thr Met Ile
180 185 190
Glu Leu Val Gln Pro Lys Trp Tyr Glu Arg Leu Leu Val Ile Thr Val
195 200 205
Gln Gly Val Phe Phe Asn Ala Phe Phe Val Leu Tyr Leu Met Ser Pro
210 215 220
Lys Leu Ala His Arg Ile Val Gly Tyr Leu Glu Glu Glu Ala Ile His
225 230 235 240
Ser Tyr Thr Glu Tyr Leu Lys Asp Ile Asp Glu Gly Lys Ile Glu Asn
245 250 255
Val Pro Ala Pro Ala Ile Ala Ile Asp Tyr Trp Arg Leu Pro Lys Asp
260 265 270
Ala Arg Leu Lys Asp Val Ile Thr Val Ile Arg Ala Asp Glu Ala His
275 280 285
His Arg Asp Val Asn His Phe Ala Ser Asp Ile His Ser
290 295 300
<210> 4
<211> 303
<212> PRT
<213>watermelon (carinorain)
<400> 4
Met Lys Val Thr Phe Ala Ala Val Ala Ser Pro Gly Thr Arg Tyr Gln
1 5 10 15
Pro Met Val Asp Gly Gly Phe Gln Trp Arg Arg Leu Leu Ser Ser Ser
20 25 30
Thr Ala Val Ala Glu Glu Gln Gly Lys Val Lys Leu Glu Gln Gly Ile
35 40 45
Lys Asp Ile Glu Asn Gln Glu Lys Lys Glu Lys Glu Thr Glu Asn Ala
50 55 60
Leu Val Ser Ser Tyr Trp Gly Ile Tyr Arg Pro Lys Ile Thr Arg Glu
65 70 75 80
Asp Gly Ser Glu Trp Pro Trp Asn Cys Phe Met Pro Trp Glu Thr Tyr
85 90 95
Arg Ala Asp Leu Ser Ile Asp Leu Gly Lys His His Glu Pro Lys Thr
100 105 110
Phe Leu Asp Lys Val Ala Tyr Arg Val Val Lys Leu Leu Arg Ile Pro
115 120 125
Thr Asp Ile Phe Phe Gln Arg Arg Tyr Gly Cys Arg Ala Val Met Leu
130 135 140
Glu Thr Val Ala Ala Val Pro Gly Met Val Gly Gly Met Leu Leu His
145 150 155 160
Leu Lys Ser Leu Arg Lys Phe Gln His Ser Gly Gly Trp Ile Lys Ala
165 170 175
Leu Leu Glu Glu Ala Glu Asn Glu Arg Met His Leu Met Thr Met Ile
180 185 190
Glu Leu Val Gln Pro Lys Trp Tyr Glu Arg Leu Leu Val Ile Thr Val
195 200 205
Gln Gly Val Phe Phe Asn Ala Phe Phe Val Leu Tyr Leu Met Ser Pro
210 215 220
Lys Leu Ala His Arg Ile Val Gly Tyr Leu Glu Glu Glu Ala Ile His
225 230 235 240
Ser Tyr Thr Glu Tyr Leu Lys Asp Ile Asp Glu Gly Lys Ile Glu Asn
245 250 255
Val Pro Ala Pro Ala Ile Ala Ile Asp Tyr Trp Arg Leu Pro Lys Asp
260 265 270
Ala Arg Leu Lys Asp Val Ile Thr Val Ile Arg Ala Asp Glu Ala His
275 280 285
His Arg Asp Val Asn His Phe Ala Ser Asp Ile His Ser Lys Glu
290 295 300

Claims (4)

1. the resistance AOX gene of feed watermelon, it is characterized in that: the nucleotide sequence of the gene is as described in SEQ ID NO:1.
2. the molecular labeling of the important adversity gene AOX of watermelon, using rice as species, it is characterized in that: being molecular labeling ClAOX-K Or molecular labeling ClAOX-N, molecular labeling primer are selected from following primer pair, nucleotides sequence therein is classified as 5 ' → 3 ',
ClAOX-K:WW forward primer (F): TTAAACTTGTGTCTTTGAGGTATTC；
WW reverse primer (R): TGGATGTCCTGCACACACAAAAA；
ClAOX-N:CW forward primer (F): ACTTGTCTTTAAGGTACTGAATTTT；
CW reverse primer (R): ACATACAAAAAGAAAAAACCCAT.
3. the purposes of molecular labeling as claimed in claim 2, it is characterized in that: the auxiliary for the resistance AOX gene in watermelon Selection and use.
4. the purposes of molecular labeling according to claim 3, it is characterized in that: when for the filial generation of beautiful side and 1550, Banding pattern and the consistent single plant of ClAOX-K banding pattern in offspring is selected to be used for breeding.
CN201910033125.7A 2019-01-14 2019-01-14 The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon Pending CN109679971A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910033125.7A CN109679971A (en) 2019-01-14 2019-01-14 The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910033125.7A CN109679971A (en) 2019-01-14 2019-01-14 The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon

Publications (1)

Publication Number Publication Date
CN109679971A true CN109679971A (en) 2019-04-26

Family

ID=66192418

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910033125.7A Pending CN109679971A (en) 2019-01-14 2019-01-14 The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon

Country Status (1)

Country Link
CN (1) CN109679971A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110272911A (en) * 2019-07-05 2019-09-24 四川大学 Application of the AOX1a gene in terms of improving drought resistance in plants

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107447010A (en) * 2017-08-29 2017-12-08 中国农业大学 Tomato shot hole resistance molecule marks and its application in tomato shot hole resistant gene NIL structure
CN108456684A (en) * 2018-04-10 2018-08-28 中国农业科学院郑州果树研究所 Watermelon seed size gene and its SNP marker and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107447010A (en) * 2017-08-29 2017-12-08 中国农业大学 Tomato shot hole resistance molecule marks and its application in tomato shot hole resistant gene NIL structure
CN108456684A (en) * 2018-04-10 2018-08-28 中国农业科学院郑州果树研究所 Watermelon seed size gene and its SNP marker and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LI,Y.M. ET AL.: "JF784048.1", 《GENBANK》 *
丁长庆: "西瓜交替氧化酶ClAOX及其相关基因ClCASPL在低温胁迫下的功能研究", 《中国博士学位论文全文数据库农业科技辑》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110272911A (en) * 2019-07-05 2019-09-24 四川大学 Application of the AOX1a gene in terms of improving drought resistance in plants

Similar Documents

Publication Publication Date Title
Soyk et al. Duplication of a domestication locus neutralized a cryptic variant that caused a breeding barrier in tomato
Shin et al. Natural variations at the Stay-Green gene promoter control lifespan and yield in rice cultivars
Nguyen et al. GmKIX8‐1 regulates organ size in soybean and is the causative gene for the major seed weight QTL qSw17‐1
Pottorff et al. Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species
CN107849570B (en) Methods and compositions for producing short shoot corn plants
US10577623B2 (en) Quantitative trait loci (QTL) associated with shatter resistant capsules in sesame and uses thereof
CN108165554B (en) Corn leaf width control gene ZmNL4 and application thereof
US11445692B2 (en) Quantitative trait loci (QTL) associated with shatter resistant capsules in sesame and uses thereof
Selinger et al. Major recent and independent changes in levels and patterns of expression have occurred at the b gene, a regulatory locus in maize
CN111172173B (en) Method for reducing plant height of corn or delaying flowering
CN107365865B (en) Molecular marker related to tomato fruit color and application thereof
Dunemann et al. Characterization of centromeric histone H3 (CENH3) variants in cultivated and wild carrots (Daucus sp.)
US20220010325A1 (en) Quantitative trait loci (qtl) associated with shattering-resistant capsules in sesame and uses thereof
US20220154202A1 (en) Gene Regulating Seed Weight in Improving Seed Yield in Soybean
CN109311952A (en) For controlling the allele in the domain MADS-BOX of palm shell phenotype
CN109836482A (en) Corn gene KRN2 and application thereof
Harris-Shultz et al. Identification of simple sequence repeat markers that differentiate bermudagrass cultivars derived from ‘Tifgreen’
Lu et al. Development and characterization of near-isogenic lines revealing candidate genes for a major 7AL QTL responsible for heat tolerance in wheat
Skowrońska et al. Development of triticale× wheat prebreeding germplasm with loci for slow-rusting resistance
Lee et al. Identification of a locus controlling compound raceme inflorescence in mungbean [Vigna radiata (L.) R. Wilczek]
Nair et al. Role of Molecular Markers in Crop Breeding: A Review.
Haseneyer et al. High level of conservation between genes coding for the GAMYB transcription factor in barley (Hordeum vulgare L.) and bread wheat (Triticum aestivum L.) collections
CN108347892A (en) Non-transgenic haploid inducing line in Curcurbitaceae
CN108064302A (en) QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage
CN109679971A (en) The PCR molecular labeling and application thereof of the important adversity gene AOX of watermelon

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20190426

RJ01 Rejection of invention patent application after publication