CN109679939A - Candida parapsilosis acid protease SAPP1 and expression, purification process - Google Patents

Abstract

The invention discloses Candida parapsilosis acid protease SAPP1 and expression, purification process.The amino acid sequence of the Candida parapsilosis acid protease SAPP1 is as shown in SEQ ID NO.1, and for the enzyme activity of the acid protease up to 176.9U/mL, specific enzyme activity reaches 1478.3U/mg, is much higher than existing Candida acid protease；Its hydrolysis effect is also superior to business papain and acid protease.The present invention also provides the acid protease SAPP1 and expression, purification process, successful expression has purified Candida parapsilosis acid protease SAPP1 on Pichia pastoris for the first time, the yield of SAPP1 protease is greatly improved, yield may be up to 312.5mg/L fermentation liquid, have wide application value.

Description

Candida parapsilosis acid protease SAPP1 and expression, purification process

Technical field

The invention belongs to technical field of bioengineering, in particular to Candida parapsilosis acid protease SAPP1 and table It reaches, purification process.

Background technique

Candidiasis is the virulence factor of 8%~10% Nosocomial bloodstream infection in the world, and candida albicans is It is most common, but the infection frequency of other species (such as Candida parapsilosis Candida parapsilosis) is also increasing. Candida parapsilosis is the most common Candida in Latin America second, especially popular in 1 years old children below.It is close smooth Candida is also the common source of infection in Europe.The pathogenesis and use indwelling medical instrument and height sugar of Candida parapsilosis Feed is related, has become a major reason of septicemia and immunocompromised patient wound and tissue infection.This species warp It often is found to be present in medical staff's hand, and has resulted in several infection outbreaks.

Different from saccharomyces albicans and Candida tropicalis, Candida parapsilosis is not a kind of obligate mankind Pathogen, it be from nonhuman origin as separated in domestic animal, insect or soil.Candida parapsilosis be also it is a kind of just Normal mankind fungal component is one of the fungi most often separated.The individual and surgery patients of immunologic hypofunction, especially that The patient of a little gastrointestinal surgeries, the risk for infecting Candida parapsilosis are very high.At present for treating by C.parapsilosis Caused Invasive candidiasis there is no common recognition, to its infection mechanism also without gem-pure research, it is generally recognized that it is secreted Acid protease destroying host's cuticula, playing an important role in hydrolyte and protein.Mainly collect in current research In on Candida albicans, it is few to the research of Candida parapsilosis, recombinantly express and purify Candida secreting acidic Protease is almost without the expression and purification of acid protease to research Candida infections mechanism and finds potential treatment method It is of great significance.

On the other hand, Candida parapsilosis is also a kind of important engineering bacteria.Wei Wenting etc. utilizes nearly smooth false silk ferment Female engineering bacteria as production mannitol；Xie Xinlei etc. is using Candida parapsilosis as the engineering bacteria of production grease；Li Ya For jasmine etc. using sundrying tea as raw material, inoculation Candida parapsilosis fermentation of pu'er tea produces GABA；Xu Minwei utilizes nearly smooth false silk Reaction medium of the yeast as alloisomerism production (S)-PED.The acid protease in Candida parapsilosis source in nutrition and Pathogenic aspect has critical function, and has great with the protease of high activity and high stability in acid condition Prospects for commercial application.The yield of recombinant expression Candida acid protease is lower at present, such as Zuzana Vinterov á exists The yield that Candida parapsilosis SAPP1 is expressed in saccharomyces cerevisiae is 3mg/L；E.Hochuli etc. is in Bacillus coli expression SAP2 Enzyme activity be 2.3U/mg；Jing Li et al. is 19.6U/mg in the enzyme activity of Bacillus coli expression SAP6.

Summary of the invention

The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, provide a kind of Candida parapsilosis acid Property protease SAPP1, which belongs to A1 family, and fermentation liquid protease activity is 176.9U/mL, and specific enzyme activity is 1478.3U/mg, higher than the acid protease enzyme activity of similar report.

Another object of the present invention is to provide the heterogenous expressions and purification process of the acid protease SAPP1.This Invention, using the technical method of genetic engineering, therefrom obtains acid protease gene using Candida parapsilosis as source Then SAPP1, construction recombination plasmid recombinantly express in Pichia pastoris, by affinity chromatography to the acidic protein in fermentation liquid Enzyme component is purified, and successful expression has purified Candida parapsilosis acid protease SAPP1 in Pichia pastoris for the first time.

A further object of the present invention is to provide a kind of recombinant expression carriers, recombined engineering cell.

The purpose of the invention is achieved by the following technical solution:

A kind of Candida parapsilosis acid protease SAPP1, amino acid sequence is as shown in SEQ ID NO.1.

The nucleotide sequence of the coding Candida parapsilosis acid protease SAPP1 is preferably such as SEQ ID NO.2 It is shown.

The heterogenous expression and purification process of the Candida parapsilosis acid protease SAPP1, includes the following steps:

(1) building contains the recombinant expression carrier of the acid protease gene segment SAPP1；

(2) by the recombinant expression carrier transformed cells；

(3) fermentation inducement and purifying are carried out to positive cell.

Expression vector described in step (1) is preferably expression vector pICh, and the expression vector is by by expression vector PPIC9K promoter engineering is dl+2x201 AOXl, and nucleotide sequence is as shown in SEQ ID No.5；Optimize α-factor letter Number peptide-coding sequence removes 3 Pst I and 1 Xho I in carrier pPIC9K as shown in SEQ ID No.6, and mutation Amp is anti- Property gene 7068T > G, delete Kan resistance fragments, and the transformation of multienzyme enzyme site is replaced with into EcoR I, BamH I, Mlu I, Xho I, Pst I, Apa I are obtained.

The acid protease gene segment SAPP1 and expression vector pICh segment is preferably carried out in molar ratio for 1:5 Connection.

It is total that acid protease gene segment SAPP1 described in step (1) preferably passes through extraction Candida parapsilosis RNA, reverse transcription obtain Candida parapsilosis cDNA, then using the Candida parapsilosis cDNA as template, and design is special Property primer is obtained by PCR amplification.

The specific primer is preferably forward primer F (5 '-GTCAGGATCCATTCCAGAGGAGGCTGCTAA-3’) With reverse primer R (5 '-ATGCCTGCAGAACGGCAGAAATGCTCGA-3 '), underlined sequences respectively indicate BamH I digestion Site and Pst I restriction enzyme site.

The Candida parapsilosis is preferably Candida parapsilosis GIM2.146.

The Candida parapsilosis is preferably incubated in YPD solid medium, and 30 DEG C are cultivated 2 days.

The formula of the YPD solid medium is preferably glucose 2g, peptone 2g, yeast extract 1g, agar powder 1g。

Cell described in step (2) is preferably Pichia pastoris GS115.

Conversion described in step (2) is transferred to after preferably linearizing the recombinant expression carrier by electrotransformation Cell.

The operation of the linearisation preferably recombinant expression carrier described in Sal I endonuclease digestion.

It is described in step (2) that the specific steps of the recombinant expression carrier transformed cells are further preferred are as follows:

1. constructing and extracting pMD18-T-SAPP1 cloning vector plasmids, PCR amplification is carried out using it as template, identifies product Purification and recovery is used afterwards, obtains recovery product；

2. being dl+2x201 AOXl, nucleotide sequence such as SEQ ID No.5 Expression vector pPIC9K promoter engineering It is shown；Optimize α-factor signal coding sequence as shown in SEQ ID No.6, remove in carrier pPIC9K 3 Pst I and 1 Xho I is mutated Amp resistant gene 7068T > G, deletes Kan resistance fragments, and the transformation of multienzyme enzyme site is replaced with EcoR I, BamH I, Mlu I, Xho I, Pst I, Apa I, building obtain expression vector pICh；

3. carrying out double digestion to 2. pICh carrier that step recovery product 1. and step obtain using BamH I and Pst I Afterwards, difference purification and recovery, protease gene segment and pICh carrier after obtaining double digestion；

4. by step 3. obtained in protease gene segment and pICh carrier carry out Ligation in vitro, building obtains expression matter Grain pICh-SAPP1；

5. to expression plasmid pICh-SAPP1, with Sal I endonuclease digestion, by expression plasmid vector linearization；

6. preparing Pichia pastoris GS115 competence；It is transferred to using 5. linearization plasmid that electrotransformation obtains step complete In red yeast.

Step 1. described in identification identified preferably by agarose gel electrophoresis.

Step 1. described in building pMD18-T-SAPP1 cloning vector plasmids concrete operations are as follows: by acid protease Genetic fragment SAPP1 is connect with pMD18-T carrier, and carrier T linked system is as follows: pMD18-T be 0.5 μ L, SAPP1 be 4.5 μ L, Solution I is 5 μ L.

Step 4. described in protease gene segment and pICh carrier preferably in molar ratio for 1:5 proportion connected in vitro It connects.

Purifying described in step (3) preferably uses affinity chromatography to purify destination protein；The nickel column is affine Chromatographing eluent used is preferably 0.15M imidazoles, 0.5M NaCl, 0.02M phosphate buffer (pH 7.4).

The condition of fermentation inducement described in step (3) is preferably in BMMY culture solution, and 28 DEG C, 250rpm oscillation training It supports, the methanol solution of addition 1.5% in every 24 hours carries out inducing expression；The time of induction is preferably 7 days.

The formula of the BMMY culture solution is preferably yeast extract 10g, tryptone 20g, YNB 13.4g, methanol 10mL, 1M potassium phosphate (pH 6.0) 100mL, distilled water are settled to 1000mL.

A kind of recombinant expression carrier, the nucleotide sequence containing the acid protease SAPP1.

A kind of recombined engineering cell, contains the recombinant expression carrier；The recombined engineering cell can express described Acid protease SAPP1.

The present invention has the following advantages and effects with respect to the prior art:

1. successful expression has purified Candida parapsilosis acid protease SAPP1 to the present invention in Pichia pastoris for the first time.

2. the SAPP1 proteinase activity that the present invention obtains is much higher than existing similar acid protease.

Using the protease activity of the folin's methods measurement SAPP1 in national standard, fermentation liquid under the conditions of pH 5.0 and 40 DEG C is measured Protease activity is 176.9U/mL, specific enzyme activity 1478.3U/mg, higher than the acid protease enzyme activity of similar report, such as Zuzana The yield that Vinterov á etc. expresses Candida parapsilosis SAPP1 in saccharomyces cerevisiae is 3mg/L；E.Hochuli etc. is in large intestine The enzyme activity that bacillus expresses SAP2 is 2.3U/mg；Jing Li et al. is 19.6U/mg in the enzyme activity of Bacillus coli expression SAP6；And this The hydrolysis effect of the SAPP1 protease of invention is better than business papain and acid protease.

3. the yield of SAPP1 protease is greatly improved in method of the invention, yield may be up to 312.5mg/L fermentation Liquid.

Detailed description of the invention

Fig. 1 is the plasmid map of recombinant expression carrier pICh-SAPP1.

Fig. 2 is the PAGE gel electrophoretogram of recombinant protein, wherein M indicate standard molecular weight albumen, swimming lane 1 be through 7 days crude enzyme liquids obtained after fermentation inducement are crossed, swimming lane 2 is by sample after purification, and swimming lane 3 is the conversion by induction in 7 days The Pichia pastoris supernatant of empty carrier.

Fig. 3 is hydrolysising experiment result photo figure, wherein 1 is to be diluted to the fermentation liquid that 100U/mL embodiment 2 obtains, 2 are The business papain (extensive and profound in meaning star) of 100U/mL, 3 be the business acid protease (Xia Sheng) of 100U/mL, and 4 be the dilute of inactivation Release the fermentation liquid that 100U/mL embodiment 2 obtains.

Specific embodiment

Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited In this.

The heterogenous expression of 1 Candida parapsilosis SAPP1 protease of embodiment

(1) Candida parapsilosis culture

Candida parapsilosis GIM2.146 (being purchased from Guangdong Province's Culture Collection) is seeded to the training of YPD solid It supports in base (glucose 2g, peptone 2g, yeast extract 1g, agar powder 1g), 30 DEG C are cultivated 2 days.

(2) Candida parapsilosis Total RNAs extraction

(1) it is put into the mortar of Liquid nitrogen precooler, is added with the Candida of the tweezers intake about 100mg after high pressure steam sterilization Enter a small amount of liquid nitrogen, is quickly ground with mortar, add a small amount of liquid nitrogen, continue to grind, 3 times repeatedly, until whole Candidas are thorough Bottom becomes white powder.

(2) 2mL RNAiso Plus (being purchased from Dalian treasured bioengineering Co., Ltd) is added into mortar, as far as possible by powder It is completely covered, is then stored at room temperature, until RNAiso Plus melts completely, continue to be ground to lysate being transparent with mortar. Resulting lysate equivalent is transferred in 1.5mL centrifuge tube, is stored at room temperature 5 minutes.12000rpm, 4 DEG C are centrifuged 5 minutes, small Heart Aspirate supernatant, moves into new centrifuge tube and (is sure not to draw precipitating).

(3) 400 μ L chloroforms are added to supernatant obtained in step (2), cover tightly centrifuge tube lid, acutely oscillation 15 seconds.To After solution is fully emulsified, then several minutes of rear 12000rpm are stored at room temperature, 4 DEG C are centrifuged 15 minutes.

(4) centrifuge tube is carefully taken out from centrifuge, homogenate is divided into three layers at this time, colourless supernatant, intermediate white Chromoprotein layer and with coloured lower layer's organic phase；Aspirate supernatant is transferred in another new centrifuge tube.

(5) isometric isopropanol is added in the supernatant obtained to step (4), the centrifuge tube that turns upside down mixes well Afterwards, it stands at room temperature after ten minutes, 12000rpm, 4 DEG C are centrifuged 10 minutes.

(6) after centrifugation, precipitating is arranged at test tube bottom.It carefully discards supernatant, 1mL 75% slowly is added along centrifugation tube wall Ethyl alcohol (being sure not to touch precipitating), gently turn upside down, washing centrifuge tube tube wall, 12000rpm, 4 DEG C of centrifugations are careful after five minutes Discard ethyl alcohol.

(7) centrifuge tube lid is opened, pipe is inverted, drying at room temperature precipitates 5 minutes, and the RNase-free that 20 μ L are added is water-soluble Solution precipitating, it is to be precipitated be completely dissolved after, lysate is transferred in RNase-free centrifuge tube, -80 DEG C of preservations are placed in.

(3) RT-PCR clones SAPP1 coded sequence:

(1) PrimeScript 1st strand cDNA synthesis kit kit (Dalian treasured bioengineering is used Co., Ltd) reverse transcription is carried out, following component is added in the PCR pipe of a rnase-free:

1 RT-PCR system of table

(2) 65 DEG C of heat preservation said mixtures are immediately placed on ice after five minutes, add 45 × First-Strand of μ L Buffer, 2 μ L 0.1M DTT, 1 μ L 40U/mL RNase inhibitor are gently mixed and cultivate at 37 DEG C in said mixture 2 minutes；

(3) 1 μ L reverse transcriptase is added, is cultivated 50 minutes after being gently mixed at 37 DEG C；

15 minutes inactivation reverse transcriptase of (4) 70 DEG C of cultures, are placed in -20 DEG C of preservations；

(5) forward primer F (5 '-GTCA are designedGGATCCATTCCAGAGGAGGCTGCTAA-3 ') and reverse primer R (5 '- ATGCCTGCAGAACGGCAGAAATGCTCGA-3').The Candida cDNA obtained using previous step is template, according to following PCR System and program carry out PCR reaction and obtain target DNA fragment；

2 PCR system of table

PCR reaction condition are as follows: 94 DEG C of initial denaturation 3min；94 DEG C are denaturalized 30 seconds；51 DEG C are annealed 30 seconds；72 DEG C extend 2 minutes； 32 circulations；Last 72 DEG C extend 10 minutes；Then product is identified by agarose gel electrophoresis, agarose concentration is 1.5%, deposition condition 120V, 25min, the operating process of agarose gel electrophoresis is referring to " Molecular Cloning:A Laboratory guide ".? It is about 1200bp to acid protease gene stripe size, recycles target gene using gel reclaims kit.

(4) screening and identification of TA clone and recombinant plasmid

(1) high fidelity enzyme product is after gel extraction, is carried out using Ex-taq enzyme plus A reacts, by following system by step (3) target gene fragment (SAPP1) obtained is connect with pMD18-T carrier (being purchased from Dalian treasured bioengineering Co., Ltd), even 16 DEG C of narrow bars part, 2h；

3 carrier T linked system of table

Then (purchase is in the limited public affairs of Dalian treasured bioengineering for 42 DEG C of thermal shocks, 70 seconds conversion bacillus coli DH 5 alpha competent cells Department), be coated with containing amicillin resistance LB liquid medium (tryptone 10g, yeast extract 5g, sodium chloride 10g, Distilled water is settled to 1000mL) in, 37 DEG C of overnight incubations.Then bacterium colony PCR is carried out using 2 × Taq PCR Mix screen the positive Bacterium colony, reaction system and program are as follows:

4 bacterium colony PCR system of table

Bacterium colony PCR reaction condition are as follows: 94 DEG C of initial denaturation 3min；94 DEG C are denaturalized 30 seconds；51 DEG C are annealed 30 seconds；72 DEG C extend 1 Minute；32 circulations；Last 72 DEG C extend 10 minutes；Then product is identified by agarose gel electrophoresis, agarose concentration It is 1%, deposition condition 120V, 25min, obtaining acid protease gene stripe size is about 1200bp；

(2) LB liquid medium that picking positive colony is added to the resistance of benzyl containing ammonia expands on 37 DEG C, 220rpm shaking table Cultivate 12h.It takes the bacterium solution for expanding and cultivating in centrifuge tube, send to Sangon Biotech (Shanghai) Co., Ltd. and surveyed Sequence, measuring clone gene length by sequencing is 1128bp, and nucleotide sequence is as shown in SEQ ID No.2.

(5) gene SAPP1 converts Pichia pastoris GS115:

(1) the pMD18-T-sapp1 cloning vector plasmids that clone has acid protease gene are extracted, are carried out using it as template Then product is carried out agarose gel electrophoresis identification, is recycled with kits by PCR amplification, PCR system referring to table 2 above. Expression vector pPIC9K promoter AOXl transform as dl+2x201AOXl (by-the 777 of wild type A0X1 promoter sequence to- 712 sequence deletion, and repetitive sequence -203 arrives -190 sequence, the nucleotide sequence such as SEQ of the dl+2x201 AOXl Shown in ID No.5), analysis Pichia pastoris codon preference optimization α-factor signal coding sequence is such as SEQ ID Shown in No.6, above-mentioned two step carries out RF clone's transformation to carrier after all passing through gene chemical synthesis segment.It removes 3 in carrier pPIC9K A Pst I and 1 Xho I, mutation Amp resistant gene 7068T > G (refer to that the 7068th base sports G from T, use AACGTTGTTG CCATTGCGGC AGGCATCGTG GTGTCACG carries out RF clone to carrier), use weight after Pst I digestion New connection deletes Kan resistance fragments and TACTTGAAGTCG GACAGTGAGT GTAGTCTTGA GAAATTCTGA AGCCGTATTTTTATTATCAG TGAGTCAGT carries out RF clone to carrier, and the transformation of multienzyme enzyme site is replaced with EcoR I, BamH I, Mlu I, Xho I, Pst I, Apa I, building obtain expression vector pICh.

Double digestion (double digestion system is carried out to specifications to recovery product and pICh carrier using BamH I and Pst I Such as table 5), with common DNA QIAquick Gel Extraction Kit purification and recovery is carried out to the DNA after digestion respectively, then uses nucleic acid concentration detector Detect DNA concentration；

5 double digestion system of table

37 DEG C of digestion condition, 4h；

(2) by protease gene segment SAPP1 and the pICh carrier segments of purification and recovery be in molar ratio 1:5 ratio benefit Ligation in vitro is carried out with T4 ligase, 22 DEG C of condition of contact, 8h, linked system such as following table.

6 T4 ligase linked system of table

42 DEG C of recombinant plasmid thermal shock 70 seconds after connection is converted into e.colistraindh5α.Flat containing ammonia benzyl Positive single colonie is selected on plate, is extracted its plasmid and is carried out double digestion identification, and bacterium solution and plasmid order-checking are also carried out to the bacterial strain Identification；PICh-SAPP1 is named as to successful expression plasmid is constructed.

(3) expression plasmid carrier is extracted from the bacteria suspension of positive colony bacterial strain using the small extraction reagent kit of plasmid, it is then right Expression plasmid carrier Sal I endonuclease digestion, by expression plasmid vector linearization, digestion system is as follows:

7 single endonuclease digestion system of table

After digestion, plasmid is recycled with QIAquick Gel Extraction Kit and measures concentration；

(4) Pichia pastoris GS115 competence is prepared, the specific steps are as follows:

A. by Pichia pastoris GS115 bacterial strain (being purchased from Invitrogen) that -80 DEG C freeze in YPD plate (tryptone 20g, yeast extract 10g, glucose 20g, agar powder 20g, distilled water are settled to 1000mL) on streak inoculation, 30 DEG C culture 3 It；

B. the single colonie of picking Pichia pastoris GS115 bacterial strain be seeded to containing 25mL YPD culture solution (tryptone 20g, Yeast extract 10g, glucose 20g, distilled water are settled to 1000mL) 250mL triangular flask in, 30 DEG C, 250rpm oscillation training It supports 2 days；

C. the finally obtained bacterial suspension inoculation of 1mL step b to another bottle is taken to contain in 50mL YPD culture solution triangular flask, 30 DEG C, 250rpm shaken cultivation a few hours, until the OD600 of bacteria suspension reaches 2.0；

D. bacteria suspension is shifted in sterilized 50mL centrifuge tube, 5000rpm, 4 DEG C are centrifuged 5 minutes, supernatant are removed, with pre-cooling Sterile water 10mL thallus is resuspended, be then transferred in 15mL centrifuge tube；

E.5000rpm, it is centrifuged 5 minutes for 4 DEG C, removes supernatant, thallus is resuspended with the 1M sorbierite 10mL of pre-cooling, repeat one It is secondary；

F.5000rpm, it is centrifuged 5 minutes for 4 DEG C, removes supernatant, thallus is resuspended with 1mL 1M sorbierite, is placed in and turns on ice for electricity Change；

(5) linearization plasmid that step (3) obtains is transferred in Pichia pastoris using electrotransformation, electric shock condition is 1.5kV, 2mm electricity revolving cup, 10ng linearization plasmid.Bacterium solution after electrotransformation is coated with MD plate, 30 DEG C are cultivated 2 days, select 5 Single colonie is inoculated with YPD fluid nutrient medium respectively, and then low temperature pyrolyzer Pichia pastoris converts daughter cell,

Cleavage method is as follows:

A. from MD plate (glucose 20g, YNB 13.4g, agar powder 20g, distilled water are settled to 1000mL), picking 10 A Pichia pastoris transformant single colonie is seeded to respectively in 2mL YPD culture solution, and 30 DEG C, 220rpm shaken cultivation 2 days；

B. 1mL bacterium solution is transferred in centrifuge tube respectively, 8000rpm is centrifuged 2min, abandons supernatant；

C. 1mL TE buffer is added, thallus is resuspended, 8000rpm is centrifuged 2min, abandons supernatant, is repeated once；

D. it is transferred to -80 DEG C of refrigerators after boiling water bath 30min and places a hour, then boiling water bath 10min；

E.8000rpm it is centrifuged 2min, gained supernatant is placed in -20 DEG C of preservations；

Bacterium colony PCR identification, reaction system and program reference table (PRT) 4 are carried out using 2 × Taq PCR Mix.

2 protease SAPP1 fermentation inducement of embodiment, purifying and enzyme activity determination

The positive restructuring Pichi strain scribing line MD plate that embodiment 1 obtains is selected, 30 DEG C are cultivated 2 days, picking single bacterium It falls and is inoculated in equipped with 50mL BMGY culture solution (yeast extract 10g, tryptone 20g, YNB 13.4g, glycerol 10mL, 1M phosphorus Sour potassium (pH6.0) 100mL, distilled water are settled to 1000mL) triangular flask in, 30 DEG C, 250rpm shaken cultivation to OD600 ≈ 5.0.It is then centrifuged for collecting thallus, equivalent shifts bacterial sediment to being equipped with 100mL BMMY culture solution (yeast extract 10g, pancreas Peptone 20g, YNB 13.4g, methanol 10mL, 1M potassium phosphate (pH6.0) 100mL, distilled water are settled to 1000mL) triangular flask In 28 DEG C, 250rpm shaken cultivation, every 24 hours addition 1.5% methanol solution carry out inducing expression, induce 7 days.Fermentation liquid 5000rpm, 4 DEG C of centrifugation 10min obtain supernatant and measure enzyme activity；Using in " SB/T 10317-1999 protease activity amylograph " " folin's methods " measurement SAPP1 protease activity.Then destination protein is purified using affinity chromatography, wherein the affine layer of nickel column Analysis applied sample amount is 50mL, and eluent used is 0.15M imidazoles, 0.5M NaCl, 0.02M phosphate buffer (pH7.4).With conversion The GS115 bacterial strain of empty carrier pICh is as experiment contrast.

By preceding method, measuring the resulting fermentation liquid protease activity of the present invention is 176.9U/mL, and specific enzyme activity is 1478.3U/mg.It is measured after purification by the BCA protein concentration kit of Sangon Biotech (Shanghai) Co., Ltd. The yield of protease is 312.5mg/1000mL fermentation liquid.

The yield that Zuzana Vinterov á etc. expresses Candida parapsilosis SAPP1 in saccharomyces cerevisiae is 3mg/L.By As it can be seen that the present invention not only succeeds, heterogenous expression purifies to obtain SAPP1 for this, and yield is realized and significantly improved.

It is all 13 of acid protease to annotation in Candida parapsilosis genome with similar recombinant expression method Gene (number of corresponding EMBL database is CCE40037, CCE41985, CCE45192, CCE45175, CCE45177, CCE41276, CCE40204, CCE40220, CCE39854, CCE40477, CCE40528, CCE45016 and CCE45014)) into Row heterogenous expression can not detect that activated protein or protein active are very low by Forint phenol method and hydrolysis circle method.

The SDS-PAGE of 3 recombinant protein of embodiment is detected

The expression of recombinant protease, the size of purity and molecular mass are confirmed using PAGE gel electrophoresis. The concentration gum concentration used is 5% for 12% and resolving gel concentration, and applied sample amount is 20 μ L, with the standard protein of standard molecular weight As Marker.The operating process of PAGE gel electrophoresis is referring to " protein electrophorese experimental technique ".For fermentation broth sample Preparation, inducing expression generate recombinant protease amount it is higher, can directly by fermentation liquid dilute 1 times after and sample-loading buffer It mixes, after boiling water boils 10min, 12000rpm is centrifuged 1min, carries out electrophoresis after loading.

SDS-PAGE electrophoresis such as Fig. 2 of crude enzyme liquid (referring to the fermentation liquid without affinity chromatography) and enzyme solution after purification Shown, M indicates standard molecular weight albumen, and swimming lane 1 is the crude enzyme liquid obtained after fermentation inducement by 7 days, and swimming lane 2 is by affine The sample of chromatographic purifying, swimming lane 3 are the Pichia pastoris supernatants of the conversion empty carrier by induction in 7 days.As can be seen from Figure, The Pichia pastoris of conversion empty carrier has no protein expression, and has one in the supernatant of not purified positive induction (i.e. swimming lane 1) Deep shallow two protein bands, wherein dark bands size is consistent with expected results close to 47kDa；It can be seen that, pass through by swimming lane 2 It crosses after purification process and is only left single expection protein band, show the acid protease for having successfully obtained the pure rank of electrophoresis SAPP1。

4 hydrolysising experiment of embodiment

It prepares proteolysis plate (skimmed milk power 10g, agar powder 20g, distilled water are settled to 1000mL), is beaten on plate Hole, be then added in hole respectively the 100U/mL of 100 μ L papain (the extensive and profound in meaning star Bioisystech Co., Ltd in Beijing, 500000U/g) solution, feeding acid protease (Ningxia Sunson Industrial Group Co., Ltd., 60000U/g) solution of 100U/mL And it is diluted to the fermentation liquid that 100U/mL embodiment 2 obtains.The observation experiment result after being placed at room temperature for 8 hours.With the dilution of inactivation Embodiment 2 to 100U/mL obtains fermentation liquid as experiment contrast.

As a result as shown in figure 3, the fermentation liquid of inactivation is enclosed without hydrolysis, and under the enzyme concentration of 100U/mL, fermentation of the invention The hydrolytic circle of liquid is significantly greater than business papain and feeding acid protease, and hydrolysis circle is more transparent, shows the hair Zymotic fluid is better than business papain and feeding acid protease to the hydrolysis effect of non fat dry milk protein.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

Sequence table

<110>South China Science & Engineering University

<120>Candida parapsilosis acid protease SAPP1 and expression, purification process

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 376

<212> PRT

<213>Candida parapsilosis GIM2.146 (Candida parapsilosis GIM2.146)

<400> 1

Ile Pro Glu Glu Ala Ala Lys Arg Asp Asp Asn Pro Gly Phe Val Ala

1 5 10 15

Leu Asp Phe Asp Val Leu Arg Lys Pro Leu Asn Leu Thr Glu Ala Leu

20 25 30

Leu Arg Glu Lys Arg Asp Ser Ile Ser Leu Ser Leu Ile Asn Glu Gly

35 40 45

Pro Ser Tyr Ala Ser Lys Val Ser Val Gly Ser Asn Lys Gln Gln Gln

50 55 60

Thr Val Ile Ile Asp Thr Gly Ser Ser Asp Phe Trp Val Val Asp Ser

65 70 75 80

Asn Ala Gln Cys Gly Lys Gly Val Asp Cys Lys Ser Ser Gly Thr Phe

85 90 95

Thr Pro Ser Ser Ser Ser Ser Tyr Lys Asn Leu Gly Ala Ala Phe Thr

100 105 110

Ile Arg Tyr Gly Asp Gly Ser Thr Ser Gln Gly Thr Trp Gly Lys Asp

115 120 125

Thr Val Thr Ile Asn Gly Val Ser Ile Thr Gly Gln Gln Ile Ala Asp

130 135 140

Val Thr Gln Thr Ser Val Asp Gln Gly Ile Leu Gly Ile Gly Tyr Thr

145 150 155 160

Ser Asn Glu Ala Val Tyr Asp Thr Ser Gly Arg Gln Thr Thr Pro Asn

165 170 175

Tyr Asp Asn Val Pro Val Thr Leu Lys Lys Gln Gly Lys Ile Arg Thr

180 185 190

Asn Ala Tyr Ser Leu Tyr Leu Asn Ser Pro Ser Ala Glu Thr Gly Thr

195 200 205

Ile Ile Phe Gly Gly Val Asp Asn Ala Lys Tyr Ser Gly Lys Leu Val

210 215 220

Ala Glu Gln Val Thr Ser Ser Gln Ala Leu Thr Ile Ser Leu Ala Ser

225 230 235 240

Val Asn Leu Lys Gly Ser Ser Phe Ser Phe Gly Asp Gly Ala Leu Leu

245 250 255

Asp Ser Gly Thr Thr Leu Thr Tyr Phe Pro Ser Asp Phe Ala Ala Gln

260 265 270

Leu Ala Asp Lys Ala Gly Ala Arg Leu Val Gln Val Ala Arg Asp Gln

275 280 285

Tyr Leu Tyr Phe Ile Asp Cys Asn Thr Asp Thr Ser Gly Thr Thr Val

290 295 300

Phe Asn Phe Gly Asn Gly Ala Lys Ile Thr Val Pro Asn Thr Glu Tyr

305 310 315 320

Val Tyr Gln Asn Gly Asp Gly Thr Cys Leu Trp Gly Ile Gln Pro Ser

325 330 335

Asp Asp Thr Ile Leu Gly Asp Asn Phe Leu Arg His Ala Tyr Leu Leu

340 345 350

Tyr Asn Leu Asp Ala Asn Thr Ile Ser Ile Ala Gln Val Lys Tyr Thr

355 360 365

Thr Asp Ser Ser Ile Ser Ala Val

370 375

<210> 2

<211> 1128

<212> DNA

<213>Candida parapsilosis GIM2.146 (Candida parapsilosis GIM2.146)

<400> 2

attccagagg aggctgctaa aagagacgac aatcctgggt ttgttgcctt ggactttgat 60

gtgcttagga aaccattgaa cttgaccgag gcgcttctcc gtgaaaagag agactccatt 120

tcgttgtcgt tgatcaatga aggtccatca tatgcatcta aagtttcagt cggttcaaac 180

aaacagcagc aaaccgtcat tattgatact ggttcgagtg acttttgggt agtggattca 240

aatgcccaat gtggaaaagg tgttgattgc aagagctcag ggacctttac cccatcatcg 300

tcttcttcat acaagaattt aggagctgct ttcactattc gatatgggga tggatctaca 360

tcgcaaggta catggggtaa agataccgtc acaatcaatg gagtctcaat cactggacaa 420

caaattgcag atgtcactca aacatcagtt gatcaaggta tattgggtat tggctacacc 480

agcaatgaag cagtttacga cacgagtggt cgtcaaacca ctccaaacta cgacaacgtt 540

cccgtgactt tgaaaaagca aggaaagatc agaaccaatg cttactcatt atatttgaac 600

tctccttcag ctgagactgg tacaatcatc tttggtggtg ttgataatgc caagtactct 660

ggcaagttgg ttgccgagca agttacctct tcacaagcgt tgactatttc gcttgcttcc 720

gtcaatttga aaggttcatc attttcattt ggagatggtg ctttgttgga ctctggaacg 780

acactcactt acttcccaag tgactttgcc gcacaacttg ctgataaagc tggtgctcgt 840

cttgttcaag tggctagaga ccaatacttg tactttattg attgtaacac cgatacatct 900

ggcacaacgg tgtttaactt tggaaatggg gcaaagatta ccgttccaaa cacagagtac 960

gtttatcaaa atggtgatgg tacttgtctt tggggtatcc aaccatcaga cgatactatt 1020

ttaggtgaca actttttgag acatgcttac ctcctttaca acttggatgc aaacacaatc 1080

tcaatcgctc aagtcaagta caccacagac tcgagcattt ctgccgtt 1128

<210> 3

<211> 30

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

gtcaggatcc attccagagg aggctgctaa 30

<210> 4

<211> 28

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

atgcctgcag aacggcagaa atgctcga 28

<210> 5

<211> 888

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc actttaggct actaacacca 180

tgactttatt agcctgtcta tcctggcccc cctggcgagg ttcatgtttg tttatttccg 240

aatgcaacaa gctccgcatt acacccgaac atcactccag atgagggctt tctgagtgtg 300

gggtcaaata gtttcatgtt ccccaaatgg cccaaaactg acagtttaaa cgctgtcttg 360

gaacctaata tgacaaaagc gtgatctcat ccaagatgaa ctaagtttgg ttcgttgaaa 420

tgctaacggc cagttggtca aaaagaaact tccaaaagtc gccataccgt ttgtcttgtt 480

tggtattgat tgacgaatgc tcaaaaataa tctcattaat gcttagcgca gtctctctat 540

cgcttctgaa ccccggtgca cctgtgccga aacgcaaatg gggaaacacc cgctttttgg 600

atgattatgc attgtctcca cattgtatgc ttccaagatt ctggtgggaa tactgctgat 660

agcctaacgt tcatgatcaa aatttcatga tcaaaattta actgttctaa cccctacttg 720

acagcaatat ataaacagaa ggaagctgcc ctgtcttaaa cctttttttt tatcatcatt 780

attagcttac tttcataatt gcgactggtt ccaattgaca agcttttgat tttaacgact 840

tttaacgaca acttgagaag atcaaaaaac aactaattat tcgaaacg 888

<210> 6

<211> 266

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

atgagatttc catctatttt cactgctgta ttgtttgcag catcttctgc tttggctgct 60

ccagttaaca ctactactga agatgaaact gctcaaattc cagctgaagc tgttattggt 120

tactctgatt tggaaggtga ttttgatgtt gctgttttgc cattttctaa ctctactaac 180

aacggtttgt tgtttatcaa tactactatt gcttcaattg ctgctaagga agaaggtgtt 240

tctttggaaa agagagaagc tgaggc 266

<210> 7

<211> 38

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

aacgttgttg ccattgcggc aggcatcgtg gtgtcacg 38

<210> 8

<211> 71

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

tacttgaagt cggacagtga gtgtagtctt gagaaattct gaagccgtat ttttattatc 60

agtgagtcag t 71

Claims (10)

1. a kind of Candida parapsilosis acid protease SAPP1, it is characterised in that:

Its amino acid sequence is as shown in SEQ ID NO.1.

2. Candida parapsilosis acid protease SAPP1 according to claim 1, it is characterised in that:

The nucleotide sequence of the coding Candida parapsilosis acid protease SAPP1 is as shown in SEQ ID NO.2.

3. the heterogenous expression and purification process of Candida parapsilosis acid protease SAPP1 of any of claims 1 or 2, It is characterized in that, includes the following steps:

(1) building contains the recombinant expression carrier of the acid protease gene segment SAPP1；

(2) by the recombinant expression carrier transformed cells；

(3) fermentation inducement and purifying are carried out to positive cell.

4. the heterogenous expression and purification process of Candida parapsilosis acid protease SAPP1 according to claim 3, It is characterized in that:

Expression vector described in step (1) is expression vector pICh, and the expression vector is by starting Expression vector pPIC9K Son transform dl+2x201 AOXl as, and nucleotide sequence is as shown in SEQ ID No.5；Optimize α-factor signal peptide code sequence Column remove 3 Pst I and 1 Xho I in carrier pPIC9K as shown in SEQ ID No.6, are mutated Amp resistant gene 7068T > G deletes Kan resistance fragments, and the transformation of multienzyme enzyme site is replaced with EcoR I, BamH I, Mlu I, Xho I, Pst I, Apa I is obtained.

5. the heterogenous expression and purification process of Candida parapsilosis acid protease SAPP1 according to claim 3, It is characterized in that:

The acid protease gene segment SAPP1 and expression vector pICh segment is attached in molar ratio for 1:5；

The Candida parapsilosis is Candida parapsilosis GIM2.146；

It is converted into described in step (2) after linearizing the recombinant expression carrier and cell is transferred to by electrotransformation.

6. the heterogenous expression and purification process of Candida parapsilosis acid protease SAPP1 according to claim 5, It is characterized in that:

Cell described in step (2) is Pichia pastoris GS115；

The operation of the linearisation is the recombinant expression carrier described in Sal I endonuclease digestion.

7. the heterogenous expression and purification process of Candida parapsilosis acid protease SAPP1 according to claim 3, It is characterized in that, by the specific steps of the recombinant expression carrier transformed cells described in step (2) are as follows:

1. constructing and extracting pMD18-T-SAPP1 cloning vector plasmids, PCR amplification is carried out using it as template, is used after identifying product Purification and recovery obtains recovery product；

2. being dl+2x201AOXl Expression vector pPIC9K promoter engineering, nucleotide sequence is as shown in SEQ ID No.5； Optimize α-factor signal coding sequence as shown in SEQ ID No.6, removes 3 Pst I and 1 in carrier pPIC9K Xho I is mutated Amp resistant gene 7068T > G, deletes Kan resistance fragments, and the transformation of multienzyme enzyme site is replaced with EcoR I, BamH I, Mlu I, Xho I, Pst I, Apa I, building obtain expression vector pICh；

3. after carrying out double digestion to 2. pICh carrier that step recovery product 1. and step obtain using BamH I and Pst I, Purification and recovery respectively, protease gene segment and pICh carrier after obtaining double digestion；

4. by step 3. obtained in protease gene segment and pICh carrier carry out Ligation in vitro, building obtains expression plasmid pICh-SAPP1；

5. to expression plasmid pICh-SAPP1, with Sal I endonuclease digestion, by expression plasmid vector linearization；

6. preparing Pichia pastoris GS115 competence；It is transferred to using 5. linearization plasmid that electrotransformation obtains step and finishes red ferment In mother.

8. the heterogenous expression and purification process of Candida parapsilosis acid protease SAPP1 according to claim 3, It is characterized in that:

Purifying described in step (3) is to purify destination protein using affinity chromatography；Used in the affinity chromatography The phosphate buffer that eluent is 0.15M imidazoles, 0.5M NaCl, 0.02M pH are 7.4；

The condition of fermentation inducement described in step (3) is in BMMY culture solution, and 28 DEG C, 250rpm shaken cultivation, every 24 is small The methanol solution of Shi Tianjia 1.5% carries out inducing expression；The time of induction is 7 days；

The formula of the BMMY culture solution is yeast extract 10g, tryptone 20g, YNB 13.4g, methanol 10mL, 1M The potassium phosphate 100mL that pH is 6.0, distilled water are settled to 1000mL.

9. a kind of recombinant expression carrier, it is characterised in that:

Nucleotide sequence containing acid protease SAPP1 of any of claims 1 or 2.

10. a kind of recombined engineering cell, it is characterised in that:

Contain recombinant expression carrier as claimed in claim 9.