CN109679938A

CN109679938A - A kind of chitinase Chit46 and its expression and purification method and application

Info

Publication number: CN109679938A
Application number: CN201910064040.5A
Authority: CN
Inventors: 罗晓春; 邓俊劲; 李志伟; 史丹; 茅和花; 梁爽
Original assignee: South China University of Technology SCUT
Current assignee: South China University of Technology SCUT
Priority date: 2019-01-23
Filing date: 2019-01-23
Publication date: 2019-04-26
Anticipated expiration: 2039-01-23
Also published as: CN109679938B

Abstract

The present invention provides a kind of chitinase Chit46 and its expression and purification methods and application.The chitinase Chit46 derives from Trichoderma harzianum, and amino acid sequence is as shown in SEQ ID NO.1, and the fermentation liquid enzyme activity of the chitinase is 31.4U/mL, specific enzyme activity 34.5U/mg, higher than the chitinase of similar report.The present invention also provides the expression and purification methods of the chitinase Chit46, and the yield of chitinase is greatly improved, and crude enzyme liquid produces protein content up to 1.26g/L, and protein content reaches 0.77g/L after purification.The chitinase can be used for tobacco brown spot pathogen hydrolysis, and hydrolysing activity is good, and hydrolysate is stablized, and the overwhelming majority is chitobiose, eliminates subsequent many and diverse each degree of polymerization purifies and separates technique, has a good application prospect.

Description

A kind of chitinase Chit46 and its expression and purification method and application

Technical field

The invention belongs to technical field of bioengineering, in particular to a kind of chitinase Chit46 and its expression and purification method With application.

Background technique

Chitin is the natural polymer that content is only second to cellulose on the earth, rich in shrimp and crab shells (Arcidiacono and Kaplan,1992).The content of chitin is 20% or so in shrimp shell, and at present dry shrimp shell per ton Price is only 450 yuan, and the price of the chitin extracted from shrimp and crab shells reaches per ton 50,000 to 100,000 yuan.But chitin Slightly solubility is restricted its application greatly, and the soluble oligosaccharide that its hydrolysis generates has huge application value.It is numerous in the recent period to grind Study carefully discovery, the hydrolysate chitin oligo saccharide (poly β-Isosorbide-5-Nitrae-N-Acetyl-D-glucosamine) of chitin, because it remains chitin day Right original acetyl group, and before having significantly more biological effect and application than chitosan oligosaccharide (poly β-Isosorbide-5-Nitrae gucosamine) Scape.Chitin oligo saccharide is easily absorbed by intestinal mucosa, and competitive pathogenic microorganism can be blocked to intestines mucin (N- acetyl glucosamine Amine-modified glycoprotein) adherency, and block the invasion of enteropathogenic, adjust intestinal health；Chitin oligo saccharide has significant anti-swollen Tumor effect, can activate human macrophage, lymphocyte, NK cell and complement system, and many cell factors is induced to generate, and improve Human body immune function；It also has the bioactivity such as anti-oxidant, plant defense induction and treatment senile dementia.In addition to this, A kind of organic matter of the chitin oligo saccharide as low molecular weight, and wherein contain nitrogen, it can be used as a kind of good nitrogen source.Closely It increases sharply year by year over year to the research temperature of chitin oligo saccharide.Chitin oligo saccharide is prepared by obtaining the chitinase of high yield and high enzyme activity With great application prospect.Chitin oligo saccharide is prepared from the shellfish shell such as shrimp, crab and shellfish insect with huge economic valence Value.

The preparation of chitin oligo saccharide is always a problem of industrial circle, and domestic at present there has been no chitin oligo saccharide production is extensive The enterprise of industrialization.The technology of existing research, the preparation method of chitin oligo saccharide mainly have chemical degradation method, chitosan oligosaccharide acetylation method With enzyme edman degradation Edman.Chemical degradation method generally uses Concentrated acid hydrolysis chitin, commonly uses concentrated hydrochloric acid, although its simple process, development is more early, But the disadvantages of this method is there are severe reaction conditions, not easy to control, low output, equipment requirement are high and pollution environment, and chitin The product oligosaccharides degree of polymerization is all below 4；Chitosan oligosaccharide acetylation method (patent CN201110409312.4) step complexity is time-consuming and laborious, With high costs, a possibility that industrialization, is very low；Enzyme edman degradation Edman is current most potential method, however institute in existing enzyme edman degradation Edman The specificity enzyme used, such as chitinase (patent CN2011102588936) and chitosan enzyme (patent CN200610080091X), generally all there is a problem of that enzyme activity is not high enough low with production of enzyme, and commodity chitinase price phase To valuableness；And use about more than the 30 kinds enzymes mixing such as non-specific enzyme such as cellulase, protease, lipase, to chitin and Chitosan can realize partly or completely all-hydrolytic, but non-specific enzyme needs to act synergistically between each other, in an experiment be often more The Application of composite of kind enzyme, different batches hydrolysate homogeneity and stability are low, and product quality is unable to control, even same The enzyme effect of enzyme, different batches or producer differs greatly, and is unfavorable for establishing fixed experimental technique.Thus obtain high yield and high enzyme Chitinase living is the key technology for preparing chitin oligo saccharide and its industrialization.Obtain highly expressed chitinase and its Use in chitin recycling has great researching value and application potential.

So far, not yet someone recombinantly expresses the Chit46 chitinase for isolating and purifying Trichoderma harzianum, more not someone It is used for tobacco brown spot pathogen hydrolysis；Further acquisition higher yield and the new chitinase of high enzyme activity are still the research of this field One of direction.

Summary of the invention

The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, provide a kind of Trichoderma harzianum chitinase Chit46；The fermentation liquid enzyme activity of the chitinase be 31.4U/mL, specific enzyme activity 34.5U/mg, crude enzyme liquid produce protein content be 1.26g/L, protein content is 0.77g/L after purification, higher than the chitinase of similar report.

Another object of the present invention provides the Trichoderma harzianum chitinase Chit46 expression and purification process, to breathe out thatch Trichoderma is source, using the technical method of genetic engineering, using the chitinase gene chit46 construction recombination plasmid, Then recombinantly express in Pichia pastoris, the chitinase component in fermentation liquid purified by affinity chromatography, for the first time at Function expression and purification Trichoderma harzianum chitinase Chit46.

A further object of the present invention is to provide a kind of recombinant expression carriers, recombined engineering cell.

Another object of the present invention is to provide application of the chitinase Chit46 in tobacco brown spot pathogen hydrolysis.

The purpose of the invention is achieved by the following technical solution:

A kind of Trichoderma harzianum chitinase Chit46, amino acid sequence is as shown in SEQ ID NO.1.

The nucleotide sequence of the coding Trichoderma harzianum chitinase Chit46 is preferably as shown in SEQ ID NO.2.

The expression and purification method of the chitinase Chit46, includes the following steps:

(1) building contains the recombinant expression carrier of the chitinase gene segment chit46；

(2) by the recombinant expression carrier transformed cells；

(3) fermentation inducement and purifying are carried out to positive cell.

Expression vector described in step (1) is preferably plasmid pPIC9BM, and the plasmid is by by the multienzyme of plasmid pPIC9K Enzyme site transformation is followed successively by BamHI, EcoRI, ApaI and MluI and obtains.

Chitinase gene segment chit46 and the pPIC9BM carrier segments are preferably the ratio of 1:5 in molar ratio It is attached.

Chitinase gene segment chit46 described in step (1), which preferably passes through, extracts Trichoderma harzianum total serum IgE, reverse transcription Trichoderma harzianum cDNA is obtained, then using the Trichoderma harzianum cDNA as template, design specific primer is obtained by PCR amplification.

Preferred forward primer F (the 5 '-CTGC of the specific primerGAATTCAGCCCCCTGGCCACAG-3 ') and it is reversed Primer R (5 '-ACTTACGCGTGTTCAGACCGTTCCTGATGTT-3 '), the sequence of underscore respectively indicates EcoR I digestion position Point and MluI restriction enzyme site.

The Trichoderma harzianum is preferably Trichoderma harzianum GIM 3.442.

The Trichoderma harzianum is preferably incubated in improvement PDA solid medium, and 30 DEG C are cultivated 2 days.

The formula of the improvement PDA solid medium is dehydrated potato powder filtered solution 200mL, tobacco brown spot pathogen 4g, sulfuric acid Magnesium 0.75g, potassium dihydrogen phosphate 0.75g, agar powder 4g.

Cell described in step (2) is preferably Pichia pastoris GS115.

Conversion described in step (2) is transferred to after preferably linearizing the recombinant expression carrier by electrotransformation Cell.

The operation of the linearisation preferably recombinant expression carrier described in BglII endonuclease digestion.

It is in step (2) that the specific steps of the recombinant expression carrier transformed cells are further preferred are as follows:

1. constructing and extracting pMD18-T-chit46 cloning vector plasmids, PCR amplification is carried out using it as template, identifies product Purification and recovery is used afterwards, obtains recovery product；

2. Expression vector pPIC9K multienzyme enzyme site is transform as BamHI, EcoRI, ApaI and MluI, building is expressed Carrier pPIC9BM；

3. carrying out double enzymes to 2. pPIC9BM carrier that step recovery product 1. and step obtain using EcoRI and MluI After cutting, difference purification and recovery, chitinase gene segment chit46 and the pPIC9BM carrier after obtaining double digestion；

4. by step 3. obtained in chitinase gene segment chit46 and pPIC9BM carrier carry out Ligation in vitro, structure It builds to obtain expression plasmid pPIC9BM-chit46；

5. to expression plasmid pPIC9BM-chit46, with BglII endonuclease digestion, by expression plasmid vector linearization；

6. preparing Pichia pastoris GS115 competence；It is transferred to using 5. linearization plasmid that electrotransformation obtains step complete In red yeast.

Step 1. described in identification identified preferably by agarose gel electrophoresis.

The concrete operations of the step 1. building pMD18-T-chit46 cloning vector plasmids are as follows: by chitinase gene Segment chit46 is connect with pMD18-T carrier, and carrier T linked system is as follows: pMD18-T be 0.5 μ L, chit46 be 4.5 μ L, Solution I is 5 μ L.

Step 4. described in chitinase gene segment and pPIC9BM carrier preferably in molar ratio for 1:5 proportion carry out Ligation in vitro.

Purifying described in step (3) preferably passes through affinity chromatography and is purified, and eluent is preferably 0.15M miaow Azoles, 0.5M NaCl, 0.02M phosphate buffer (pH7.4).

The condition of fermentation inducement described in step (3) is preferably in BMMY culture solution, and 28 DEG C, 250rpm oscillation training It supports, the methanol solution of addition 1.5% in every 24 hours carries out inducing expression；The time of induction is preferably 7 days.

The formula of the BMMY culture solution is preferably yeast extract 10g, tryptone 20g, YNB13.4g, methanol 10mL, 1M potassium phosphate (pH 6) 100mL, distilled water are settled to 1000mL.

A kind of recombinant expression carrier, the nucleotide sequence containing the chitinase Chit46.

A kind of recombined engineering cell, contains the recombinant expression carrier；The recombined engineering cell can express described Chitinase Chit46.

Application of the chitinase Chit46 in tobacco brown spot pathogen hydrolysis.

The chitin source is preferably one of shellfish such as shrimp, crab, shellfish and insect or at least two.

It is 6.0 that the condition of application of the chitinase in tobacco brown spot pathogen hydrolysis, which is preferably pH, and temperature is 45 DEG C.

The measuring method of hydrolysate is that DNS method measures reduced sugar and deacetylation measurement in the application.

The detection method of hydrolysate is HPLC method in the application, and chromatographic column is Asahipak NH2P-504E, chromatography System is Shimadzu-LC-20A.

The testing conditions of hydrolysate are preferred in the application are as follows: 70% acetonitrile of mobile phase, 20 μ L of applied sample amount, flow velocity 0.7mL/min, temperature are 30 DEG C, elution time 40min, Detection wavelength 210nm.

The present invention has the following advantages and effects with respect to the prior art:

1. successful expression has purified a kind of new Trichoderma harzianum chitinase Chit46 to the present invention for the first time.

2. Chit46 fermentation liquid protease activity of the invention is every milliliter of 31.4 units, specific enzyme activity is 34.5 every milligram Unit is higher than chitinase, such as Zhikui Hao Chitinolyticbacter meiyuanensis in the prior art SYBC-H1 highest enzyme activity reaches 9.6U/mL；Gou respects the fermentation condition that the optimization microbacterium Z4 such as pavilion produces chitinase, and highest enzyme activity reaches To 4.13U/mL；The research in slow raw Rhizobiaceae Blastobacter bacterial strain SYBC-H2 fermentation secretion chitinase such as Kui of Hao Middle discovery, the producing enzyme reciprocation with corn pulp and chitin is preferable, and enzyme activity reaches 5.70U/mL；Shaoqing Yang etc. is used Recombinant protein expression balun Pueraria lobota hereby series bacillus chitinase enzyme activity be 2.14U/mL.

3. the yield of chitinase, chitinase Chit46 crude enzyme liquid of the invention is greatly improved in method of the invention It produces protein content and is up to 1.26g/L, protein content is up to 0.77g/L after purification, higher than the chitinase of similar report.

4. not yet someone's recombinant expression isolated and purified the Chit46 chitinase of Trichoderma harzianum at present, more not someone by its It is hydrolyzed for tobacco brown spot pathogen.The present invention has purified a kind of new Trichoderma harzianum chitinase Chit46's in successful expression for the first time On the basis of, it is applied to tobacco brown spot pathogen hydrolysis for the first time.

5. the hydrolysing activity of chitinase Chit46 is good, and hydrolysate is stablized, and the overwhelming majority is chitobiose, eliminates Subsequent many and diverse each degree of polymerization purifies and separates technique.

Detailed description of the invention

Fig. 1 is the plasmid figure spectrogram of recombinant expression carrier pPIC9BM-chit46.

Fig. 2 is N-Acetyl-D-glucosamine concentration-light absorption value canonical plotting.

Fig. 3 is the PAGE gel electrophoretogram of recombinant protein, wherein M indicate standard molecular weight albumen, swimming lane 1 be through The Pichia pastoris supernatant of the conversion empty carrier of induction in 7 days is crossed, swimming lane 2 is the crude enzyme liquid obtained after fermentation inducement by 7 days, swimming Road 3 is the sample after 7 days fermentation inducements after purification.

Fig. 4 is the product HPLC analysis chart of standard items and chitinase Chit46 hydrocolloid chitin；Wherein, top figure Piece is standard items, and Lower panel is the product of chitinase Chit46 hydrocolloid chitin.

Specific embodiment

Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited In this.

The heterogenous expression of 1 chitinase Chit46 of embodiment and purifying

(1) Trichoderma harzianum culture

Trichoderma harzianum GIM 3.442 (being purchased from Guangdong Province's Culture Collection) is seeded to improvement PDA solid training Support base (dehydrated potato powder filtered solution 200mL, tobacco brown spot pathogen 4g, magnesium sulfate 0.75g, potassium dihydrogen phosphate 0.75g, agar powder 4g) In, 30 DEG C are cultivated 2 days.

The tobacco brown spot pathogen (is purchased from the preparation method comprises the following steps: weighing 10.0g chitin and gives birth to work bioengineering (Shanghai) stock Part Co., Ltd, article No. A500659), the concentrated hydrochloric acid that 100mL concentration is 36% is added, keeps stirring up to all dissolving, is added 100mL ethyl alcohol and 300mL distilled water, a large amount of floccules visible at this time occur, and are then rinsed with water gained floccule until neutral, Drying weighing is placed 4 DEG C and is saved backup.

(2) Trichoderma harzianum Total RNAs extraction

(1) it is put into the mortar of Liquid nitrogen precooler, is added with the mycelium of the tweezers intake about 100mg after high pressure steam sterilization A small amount of liquid nitrogen is quickly ground with mortar, adds a small amount of liquid nitrogen, continues to grind, and 3 times repeatedly, until whole mycelium thoroughly become At white powder.

(2) 2mL RNAiso Plus (being purchased from Dalian treasured bioengineering Co., Ltd) is added into mortar, as far as possible by powder It is completely covered, is then stored at room temperature, until RNAiso Plus melts completely, continue to be ground to lysate being transparent with mortar. Resulting lysate equivalent is transferred in 1.5mL centrifuge tube, is stored at room temperature 5 minutes.12000rpm, 4 DEG C are centrifuged 5 minutes, small Heart Aspirate supernatant, moves into new centrifuge tube and (is sure not to draw precipitating).

(3) 400 μ L chloroforms are added to supernatant obtained in step (2), cover tightly centrifuge tube lid, acutely oscillation 15 seconds.To After solution is fully emulsified, then several minutes of rear 12000rpm are stored at room temperature, 4 DEG C are centrifuged 15 minutes.

(4) centrifuge tube is carefully taken out from centrifuge, homogenate is divided into three layers at this time, colourless supernatant, intermediate white Chromoprotein layer and with coloured lower layer's organic phase.Aspirate supernatant is transferred in another new centrifuge tube；

(5) isometric isopropanol is added in the supernatant obtained to step (4), the centrifuge tube that turns upside down mixes well Afterwards, it stands at room temperature after ten minutes, 12000rpm, 4 DEG C are centrifuged 10 minutes.

(6) after centrifugation, precipitating is arranged at test tube bottom.It carefully discards supernatant, 1mL 75% slowly is added along centrifugation tube wall Ethyl alcohol (being sure not to touch precipitating), gently turn upside down, washing centrifuge tube tube wall, 12000rpm, 4 DEG C of centrifugations are careful after five minutes Discard ethyl alcohol.

(7) centrifuge tube lid is opened, pipe is inverted, drying at room temperature precipitates 5 minutes, and the RNase-free that 20 μ L are added is water-soluble Solution precipitating, it is to be precipitated be completely dissolved after, lysate is transferred in RNase-free centrifuge tube, -80 DEG C of preservations are placed in.

(3) RT-PCR clones Chit46 coded sequence

(1) PrimeScript 1st strand cDNA synthesis kit kit (Dalian treasured bioengineering is used Co., Ltd) reverse transcription is carried out, following component is added in the PCR pipe of a rnase-free by table 1:

1 RT-PCR system of table

(2) 65 DEG C of heat preservation said mixtures are immediately placed on ice after five minutes, add 45 × First-Strand of μ L Buffer, 2 μ L 0.1M DTT, 1 μ L 40U/mL RNase inhibitor are gently mixed and cultivate at 37 DEG C in said mixture 2 minutes；

(3) 1 μ L reverse transcriptase is added, is cultivated 50 minutes after being gently mixed at 37 DEG C；

15 minutes inactivation reverse transcriptase of (4) 70 DEG C of cultures, are placed in -20 DEG C of preservations；

(5) forward primer F (5 '-CTGC are designedGAATTCAGCCCCCTGGCCACAG-3 ') and reverse primer R (5 '- ACTTACGCGTGTTCAGACCGTTCCTGATGTT-3').The Trichoderma harzianum cDNA obtained using previous step is template, according to following PCR system and program carry out PCR reaction and obtain target DNA fragment；

2 PCR system of table

PCR reaction condition are as follows: 94 DEG C of initial denaturation 3min；94 DEG C are denaturalized 30 seconds；51 DEG C are annealed 30 seconds；72 DEG C extend 2 minutes； 32 circulations；Last 72 DEG C extend 10 minutes；Then product is identified by agarose gel electrophoresis, agarose concentration is 1.5%, deposition condition 120V, 25min, the operating process of agarose gel electrophoresis is referring to " Molecular Cloning:A Laboratory guide ".? It is about 1200bp to chitinase gene stripe size, recycles target gene using gel reclaims kit.

(4) screening and identification of TA clone and recombinant plasmid

(1) high fidelity enzyme product is after gel extraction, is carried out using Ex-taq enzyme plus A reacts, by following system by step (3) target gene fragment (chit46) obtained is connect with pMD18-T carrier (being purchased from Dalian treasured bioengineering Co., Ltd), 16 DEG C of condition of contact, 2h；

3 carrier T linked system of table

Then (purchase is in the limited public affairs of Dalian treasured bioengineering for 42 DEG C of thermal shocks, 70 seconds conversion bacillus coli DH 5 alpha competent cells Department), be coated with containing amicillin resistance LB liquid medium (tryptone 10g, yeast extract 5g, sodium chloride 10g, Distilled water is settled to 1000mL) in, 37 DEG C of overnight incubations.Then bacterium colony PCR is carried out using 2 × Taq PCR Mix screen the positive Bacterium colony, reaction system and program are as follows:

4 bacterium colony PCR system of table

Bacterium colony PCR reaction condition are as follows: 94 DEG C initial denaturation 3 minutes；94 DEG C are denaturalized 30 seconds；51 DEG C are annealed 30 seconds；72 DEG C extend 1 Minute；32 circulations；Last 72 DEG C extend 10 minutes；Then product is identified by agarose gel electrophoresis, agarose concentration It is 1%, deposition condition 120V, 25min, obtaining chitinase gene stripe size is about 1200bp；

(2) LB liquid medium that picking positive colony is added to the resistance of benzyl containing ammonia expands on 37 DEG C, 220rpm shaking table Cultivate 12h.It takes the bacterium solution for expanding and cultivating in centrifuge tube, send to Sangon Biotech (Shanghai) Co., Ltd. and surveyed Sequence, measuring clone gene length by sequencing is 1224bp, and nucleotide sequence is as shown in SEQ ID NO.2.

(5) gene chit46 converts Pichia pastoris GS115:

(1) the pMD18-T-chit46 cloning vector plasmids that clone has chitinase gene are extracted, are carried out using it as template Then product is carried out agarose gel electrophoresis identification, is recycled with kits by PCR amplification, PCR system referring to table 2 above. Expression vector pPIC9K (purchase is in Invitrogen company) multienzyme enzyme site transformation, it is followed successively by BamH I, EcoR I, Apa I and Mlu I, and it is named as pPIC9BM (Fig. 1).Carrier construction is cloned using RF, 5 '-GAAGCTGGATCC of primerGAATTC CCGCTCGAGGGGCCCACGCGT(sequence of underscore respectively indicates EcoRI restriction enzyme site and MluI to CATCATCATCATC-3 ' Restriction enzyme site), reaction system are as follows:

5 RF of table clones system

Reaction condition are as follows: 98 DEG C of initial denaturation 3min；98 DEG C are denaturalized 10 seconds；58 DEG C are annealed 15 seconds；72 DEG C extend 8 minutes；32 A circulation；Last 72 DEG C extend 10 minutes；Product sequencing identification；

Double digestion (double digestion body is carried out to specifications to recovery product and pPIC9BM carrier using EcoR I and Mlu I System such as table 6), with common DNA QIAquick Gel Extraction Kit purification and recovery is carried out to the DNA after digestion respectively, is then detected with nucleic acid concentration Instrument detects DNA concentration；

6 double digestion system of table

37 DEG C of digestion condition, 4h；

It (2) is in molar ratio 1:5's by chitinase gene segment chit46 and the pPIC9BM carrier segments of purification and recovery Ratio using T4 ligase carry out Ligation in vitro, 22 DEG C of condition of contact, 8h, linked system such as following table.

7 T4 ligase linked system of table

42 DEG C of recombinant plasmid thermal shock 70 seconds after connection is converted into e.colistraindh5α.Flat containing ammonia benzyl Positive single colonie is selected on plate, is extracted its plasmid and is carried out double digestion identification, and bacterium solution and plasmid order-checking are also carried out to the bacterial strain Identification；PPIC9BM-chit46 is named as to successful expression plasmid is constructed.

(3) expression plasmid carrier is extracted from the bacteria suspension of positive colony bacterial strain using the small extraction reagent kit of plasmid, it is then right Expression plasmid carrier BglII endonuclease digestion, by expression plasmid vector linearization, digestion system is as follows:

8 single endonuclease digestion system of table

After digestion, plasmid is recycled with QIAquick Gel Extraction Kit and measures concentration.

(4) Pichia pastoris GS115 competence is prepared, the specific steps are as follows:

A. by Pichia pastoris GS115 bacterial strain (being purchased from Invitrogen) that -80 DEG C freeze in YPD plate (tryptone 20g, yeast extract 10g, glucose 20g, agar powder 20g, distilled water are settled to 1000mL) on streak inoculation, 30 DEG C culture 3 It；

B. the single colonie of picking Pichia pastoris GS115 bacterial strain be seeded to containing 25mL YPD culture solution (tryptone 20g, Yeast extract 10g, glucose 20g, distilled water are settled to 1000mL) 250mL triangular flask in, 30 DEG C, 220rpm oscillation training It supports 2 days；

C. the finally obtained bacterial suspension inoculation of 1mL step b to another bottle is taken to contain in 50mL YPD culture solution triangular flask, 30 DEG C, 220rpm shaken cultivation a few hours, until the OD600 of bacteria suspension reaches 2.0；

D. bacteria suspension is shifted in sterilized 50mL centrifuge tube, 5000rpm, 4 DEG C are centrifuged 5 minutes, supernatant are removed, with pre-cooling Sterile water 10mL thallus is resuspended, be then transferred in 15mL centrifuge tube；

E.5000rpm, it is centrifuged 5 minutes for 4 DEG C, removes supernatant, thallus is resuspended with the 1M sorbierite 10mL of pre-cooling, repeat one It is secondary；

F.5000rpm, it is centrifuged 5 minutes for 4 DEG C, removes supernatant, thallus is resuspended with 1mL 1M sorbierite, is placed in and turns on ice for electricity Change；

(5) linearization plasmid that step (3) obtains is transferred in Pichia pastoris using electrotransformation, electric shock condition is 1.5kV, 2mm electricity revolving cup, 10ng linearization plasmid.Bacterium solution after electrotransformation is coated with MD plate, 30 DEG C are cultivated 2 days, select 5 Single colonie is inoculated with YPD fluid nutrient medium respectively, and then low temperature pyrolyzer Pichia pastoris converts daughter cell,

Cleavage method is as follows:

A. from MD plate (glucose 20g, YNB 13.4g, agar powder 20g, distilled water are settled to 1000mL), picking 10 A Pichia pastoris transformant single colonie is seeded to respectively in 2mL YPD culture solution, and 30 DEG C, 220rpm shaken cultivation 2 days；

B. 1mL bacterium solution is transferred in centrifuge tube respectively, 8000rpm is centrifuged 2min, abandons supernatant；

C. 1mL TE buffer is added, thallus is resuspended, 8000rpm is centrifuged 2min, abandons supernatant, is repeated once；

D. it is transferred to -80 DEG C of refrigerators after boiling water bath 30min and places a hour, then boiling water bath 10min；

E.8000rpm it is centrifuged 2min, gained supernatant is placed in -20 DEG C of preservations；

Bacterium colony PCR identification, reaction system and program reference table (PRT) 4 are carried out using 2 × Taq PCR Mix.

Fermentation inducement, purifying and the enzyme activity determination of 2 chitinase Chit46 of embodiment

(1) the positive restructuring Pichi strain scribing line MD plate that embodiment 1 obtains is selected, 30 DEG C are cultivated 2 days, picking list Colony inoculation is in equipped with 50mL BMGY culture solution (yeast extract 10g, tryptone 20g, YNB 13.4g, glycerol 10mL, 1M Potassium phosphate (pH6.0) 100mL, distilled water are settled to 1000mL) triangular flask in, 30 DEG C, 250rpm shaken cultivation to OD600 ≈ 5.0.It is then centrifuged for collecting bacterial sediment, equivalent shifts bacterial sediment to being equipped with 100mL BMMY culture solution (yeast extract 10g, tryptone 20g, YNB 13.4g, methanol 10mL, 1M potassium phosphate (pH6.0) 100mL, distilled water are settled to 1000mL) 28 DEG C in triangular flask, the methanol solution of 250rpm shaken cultivation, addition 1.5% in every 24 hours carries out inducing expression, induces 7 days, It is final to obtain fermentation liquid.

(2) fermentation liquid 5000rpm, 4 DEG C of centrifugation 10min take supernatant to obtain crude enzyme liquid.

(3) destination protein is purified by affinity chromatography and obtains pure enzyme solution, wherein affinity chromatography applied sample amount is 150mL, eluent used are 0.15M imidazoles, 0.5M NaCl, 0.02M phosphate buffer (pH7.4).

(4) chitinase enzyme activity is measured using the DNS method of Ghose.

Compound concentration is the N-Acetyl-D-glucosamine solution of 0,200,400,600,800,1000 μ g/mL respectively, and phase is added The distilled water of same volume and DNS solution (preparation of the Ghose method) boiling water bath of 3 times of volumes react 10 minutes, are centrifuged 2 in 12000rpm Supernatant is drawn after minute and measures light absorption value under 540nm wavelength, obtains standard N-Acetyl-D-glucosamine gradient concentration solution-extinction It is worth curve, as shown in Figure 2.

1mL with the suitably diluted enzyme solution of 50mM sodium phosphate buffer of pH 6 (with anti-in the case where guaranteeing substrate excess conditions The detection production concentration that should be obtained is in made standard curve range) with 1mL contain 2% tobacco brown spot pathogen pH 6.0 50mM Sodium phosphate buffer respectively 45 DEG C preheat 5 minutes, after mixing well 45 DEG C water-bath 30 minutes, at once be added 2mL steam Distilled water and 6mL DNS reagent (preparation of Ghose method) terminate reaction, boiling water bath 10 minutes, draw after 12000rpm is centrifuged 2 minutes Supernatant measures light absorption value under 540nm wavelength, bent by standard N-Acetyl-D-glucosamine gradient concentration solution above-mentioned-light absorption value Line computation chitinase enzyme activity, using 100 DEG C of boiling water baths, 10 minutes enzyme solutions as blank control.With every in the case where 6.0,45 DEG C of pH Enzyme amount needed for the reduced sugar of minute hydrolysis 1 μm of ol N-Acetyl-D-glucosamine equivalent of production is 1 enzyme-activity unit (U).

To convert the GS115 bacterial strain of empty carrier pPIC9BM as experiment contrast.

Measuring the resulting fermentation liquid chitin enzyme activity of the present invention is 31.4U/mL, and the specific enzyme activity of enzyme solution is 34.5U/ after purification mg.Higher level is in compared with the chitinase of existing report, such as Gou respects the hair that pavilion optimization microbacterium Z4 produces chitinase Ferment condition, highest yield of enzyme reach 4.13U/mL；Kui of Hao etc. is fermented in slow raw Rhizobiaceae Blastobacter bacterial strain SYBC-H2 It secretes and is found in the research of chitinase, the producing enzyme reciprocation with corn pulp and chitin is preferable, and yield of enzyme reaches 5.70U/ mL；It is 0.151U/mL that Xin Niu etc., which recombinantly expresses dust cover ghost toadstool chitinase yield of enzyme with Pichia pastoris,；Shaoqing Yang etc. is 2.14U/mL with the yield of enzyme of Recombinant protein expression balun Pueraria lobota hereby series bacillus chitinase.

By the BCA protein concentration kit of Sangon Biotech (Shanghai) Co., Ltd. to crude enzyme liquid and after purification The yield of protease be measured, it is 1.26g/L that crude enzyme liquid, which produces protein content, and protein content is 0.77g/L after purification.

Further, the enzymatic property pair of chitinase Chit46 of the invention and the chitinase reported in the prior art Than as shown in table 9；It can be seen that present invention obtains a kind of new chitinases that enzyme activity is significantly higher than the prior art.

Table 9

Remarks:

1.*ND: undetermined

2. the document source of related chitinase:

[1]Alias,N.；Mahadi,N.M.；Murad,A.M.A.；Bakar,F.D.A.；Mahmood,N.A.N.； Illias,R.M.,Expression and characterization of Trichodermavirens UKM- 1endochitinase in Escherichia coli.World J.Microbiol.Biotechnol.2009,25(4), 561-572.

[2]Draborg,H.；Christgau,S.；Halkier,T.；Rasmussen,G.；Dalboge,H.； Kauppinen,S.,Secretion of an enzymatically active Trichoderma harzianum endochitinase by Saccharomyces cerevisiae.Curr.Genet.1996,29(4),404-9.

[3]de la Cruz,J.；Hidalgo-Gallego,A.；Lora,J.M.；Benitez,T.；Pintor-Toro, J.A.；Llobell,A.,Isolation and characterization of three chitinases from Trichoderma harzianum.Eur.J.Biochem.1992,206(3),859-67.

[4]Ike,M.；Nagamatsu,K.；Shioya,A.；Nogawa,M.；Ogasawara,W.；Okada,H.； Morikawa,Y.,Purification,characterization,and gene cloning of 46kDa chitinase (Chi46)from Trichoderma reesei PC-3-7and its expression in Escherichia coli. Appl.Microbiol.Biotechnol.2006,71(3),294-303.

[5]Song,J.Z.；Yang,Q.；Liu,B.D.；Chen,D.F.,Expression of the chitinase gene from Trichoderma aureoviride in Saccharomyces cerevisiae.Appl.Microbiol .Biotechnol.2005,69(1),39-43.

[6]Blaiseau,P.L.；Kunz,C.；Grison,R.；Bertheau,Y.；Brygoo,Y.,Cloning and expression of a chitinase gene from the hyperparasitic fungus Aphanocladium album.Curr.Genet.1992,21(1),61-6.

[7]Mi,Q.；Yang,J.；Ye,F.；Gan,Z.；Wu,C.；Niu,X.；Zou,C.；Zhang,K.Q.,Cloning and overexpression of Pochonia chlamydosporia chitinase gene pcchi44,a potential virulence factor in infection against nematodes.Process Biochem.2010,45(5),810-814.

The SDS-PAGE of 3 recombinant protein of embodiment is detected

Confirmed using PAGE gel electrophoresis the expression of the recombinant chitinase that embodiment 2 obtains, purity and The size of molecular mass.The concentration gum concentration used is 5% for 12% and resolving gel concentration, and applied sample amount is 20 μ L, with standard The standard protein of molecular weight is as Marker.The operating process of PAGE gel electrophoresis is referring to " protein electrophorese tests skill Art ".The amount of preparation for fermentation broth sample, the recombinant chitinase that inducing expression generates is higher, can be directly by fermentation liquid It is mixed after 1 times of dilution with sample-loading buffer, after boiling water boils 10min, 12000rpm is centrifuged 1min, carries out electrophoresis after loading.

SDS-PAGE electrophoresis of the crude enzyme liquid (referring to the fermentation liquid purified without affinity chromatography) with enzyme solution after purification As shown in figure 3, M indicates that standard molecular weight albumen, swimming lane 1 are the Pichia pastoris supernatants of the conversion empty carrier by induction in 7 days, Swimming lane 2 is by the crude enzyme liquid of 7 days fermentation inducements, and swimming lane 3 is the sample after 7 days fermentation inducements through affinitive layer purification Product.As can be seen from Figure, the Pichia pastoris for converting empty carrier has no protein expression, and not purified positive induction (is swum Road 2) supernatant in have deep shallow two protein bands, wherein dark bands size is close to 45kDa, with expected results phase Symbol；It can be seen that there are deep shallow two protein bands after purification process, there is document to speculate that molecular weight is lesser by swimming lane 3 Band is the protein band being not glycosylated, the results showed that has successfully obtained the chitinase Chit46 of the pure rank of electrophoresis.

4 chitinase Chit46 hydrocolloid chitin of embodiment

The tobacco brown spot pathogen (the preparation method is the same as that of Example 1) of acquisition 4% is resuspended with the 50mM sodium phosphate buffer of pH 6.0, The pure enzyme solution of chitinase Chit46 of the equivalent 50mM sodium phosphate buffer 30U/g of pH 6.0 is added, 40 after mixing well It DEG C oscillating reactions 12 hours, is centrifuged 2 minutes in 12000rpm, the supernatant of acquisition is chitinase Chit46 hydrocolloid chitin The product of matter.

The measurement of 5 chitinase Chit46 hydrocolloid chitin product of embodiment

Hydrolysate content of reducing sugar is measured using the DNS method of Ghose.Take 1mL with the suitably diluted embodiment 4 of distilled water Obtained hydrolysate, addition 1mL distilled water and 3mL DNS reagent, boiling water bath 10 minutes, after 12000rpm is centrifuged 2 minutes It draws supernatant and measures light absorption value under 540nm wavelength, and according to the standard N-Acetyl-D-glucosamine gradient concentration performed before experiment Solution-light absorption value curve calculates content of reducing sugar, using distilled water as blank control.Measuring hydrolysate content of reducing sugar is 8.24mg/mL。

Using " GB 29941-2013 national food safety standard food additives chitosan (chitosan) " A.3.2 the deacetylation of alkalimetry measurement hydrolysate, measuring its deacetylation is 8.71%, shows the hydrolysate overwhelming majority It really is chitin oligo saccharide.

The detection of 6 chitinase Chit46 hydrocolloid chitin product of embodiment

The ethyl alcohol of 3 times of volumes is added to remove the enzyme in product in the hydrolysate that embodiment 4 obtains, and is centrifuged in 12000rpm 2 minutes, supernatant placed 1 hour in 65 DEG C of baking ovens to remove ethyl alcohol, and products therefrom is detected with HPLC, and wherein chromatographic column is Asahipak NH2P-50 4E, chromatographic system Shimadzu-LC-20A.Testing conditions are 70% acetonitrile of mobile phase, applied sample amount 20 μ L, flow velocity 0.7mL/min, temperature are 30 DEG C, elution time 40min, Detection wavelength 210nm.As a result as shown in figure 4, detection The result shows that being made of in product N-Acetyl-D-glucosamine, chitobiose, chitin trisaccharide and chitin tetrose, wherein chitobiose is accounted for The overwhelming majority therein, up to 94.79%, other N-Acetyl-D-glucosamines, chitin trisaccharide and chitin tetrose account for 1.55% respectively, 2.8% and 0.87%, total content 15.92mg/mL, the rate of recovery is up to 79.6%.

The above results show that chitinase Chit46 has the application of hydrocolloid chitin preparation high-purity chitobiose Potentiality.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

Sequence table

<110>South China Science & Engineering University

<120>a kind of chitinase Chit46 and its expression and purification method and application

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 408

<212> PRT

<213>Trichoderma harzianum GIM 3.442 (T. harzianum GIM 3.442)

<400> 1

Ser Pro Leu Ala Thr Glu Glu Arg Ser Val Glu Lys Arg Ala Asn Gly

1 5 10 15

Tyr Ala Asn Ser Val Tyr Phe Thr Asn Trp Gly Ile Tyr Asp Arg Asn

20 25 30

Phe Gln Pro Ala Asp Leu Val Ala Ser Asp Val Thr His Val Ile Tyr

35 40 45

Ser Phe Met Asn Leu Gln Ala Asp Gly Thr Val Val Ser Gly Asp Thr

50 55 60

His Ala Asp Phe Glu Lys His Tyr Ala Asp Asp Ser Trp Asn Asp Val

65 70 75 80

Gly Thr Asn Ala Tyr Gly Cys Ala Lys Gln Leu Phe Lys Val Lys Lys

85 90 95

Ala Asn Arg Gly Leu Lys Val Leu Leu Ser Ile Gly Gly Trp Thr Trp

100 105 110

Ser Thr Asn Phe Pro Ser Ala Ala Ser Thr Asp Ala Asn Arg Lys Asn

115 120 125

Phe Ala Lys Thr Ala Ile Thr Phe Met Lys Asp Trp Gly Phe Asp Gly

130 135 140

Ile Asp Val Asp Trp Glu Tyr Pro Ala Asp Ala Thr Gln Ala Ser Asn

145 150 155 160

Met Val Leu Leu Leu Lys Glu Val Arg Ser Gln Leu Asp Ala Tyr Ala

165 170 175

Ala Gln Tyr Ala Pro Gly Tyr His Phe Leu Leu Thr Ile Ala Ala Pro

180 185 190

Ala Gly Lys Asp Asn Tyr Ser Lys Leu Arg Leu Ala Asp Leu Gly Gln

195 200 205

Val Leu Asp Tyr Ile Asn Leu Met Ala Tyr Asp Tyr Ala Gly Ser Phe

210 215 220

Ser Pro Leu Thr Gly His Asp Ala Asn Leu Phe Ala Asn Pro Ser Asn

225 230 235 240

Pro Asn Ala Thr Pro Phe Asn Thr Asp Ser Ala Val Lys Asp Tyr Ile

245 250 255

Asn Gly Gly Val Pro Ala Asn Lys Ile Val Leu Gly Met Pro Ile Tyr

260 265 270

Gly Arg Ser Phe Gln Asn Thr Ala Gly Ile Gly Gln Thr Tyr Asn Gly

275 280 285

Val Gly Gly Gly Gly Gly Gly Ser Thr Gly Ser Trp Glu Ala Gly Ile

290 295 300

Trp Asp Tyr Lys Ala Leu Pro Lys Ala Gly Ala Thr Ile Gln Tyr Asp

305 310 315 320

Ser Val Ala Lys Gly Tyr Tyr Ser Tyr Asn Ala Gly Thr Lys Glu Leu

325 330 335

Ile Ser Phe Asp Thr Pro Asp Met Ile Asn Thr Lys Val Ala Tyr Leu

340 345 350

Lys Ser Leu Gly Leu Gly Gly Ser Met Phe Trp Glu Ala Ser Ala Asp

355 360 365

Lys Lys Gly Ala Asp Ser Leu Ile Gly Thr Ser His Arg Ala Leu Gly

370 375 380

Gly Leu Asp Thr Thr Gln Asn Leu Leu Ser Tyr Pro Asn Ser Lys Tyr

385 390 395 400

Asp Asn Ile Arg Asn Gly Leu Asn

405

<210> 2

<211> 1224

<212> DNA

<213>Trichoderma harzianum GIM 3.442 (T. harzianum GIM 3.442)

<400> 2

agccccctgg ccacagaaga gcgctctgtt gagaagagag ccaacggata cgcaaactcc 60

gtctatttca ccaactgggg catttacgac cgcaacttcc agcctgccga tttggtggca 120

tcagatgtca ctcatgtcat ctactcattc atgaacctcc aggcagacgg cacagttgtc 180

tctggcgata cccacgctga tttcgagaag cactatgccg atgattcttg gaatgatgtc 240

ggcaccaatg cctacggctg tgccaagcag ctgttcaagg tcaagaaggc caaccgaggc 300

ctcaaggttc tgctctccat cggtggctgg acctggtcca ccaacttccc ttctgcagca 360

agcacggatg ccaaccgaaa gaactttgcg aaaactgcca ttaccttcat gaaggattgg 420

ggtttcgatg gcattgacgt cgactgggag taccctgcag acgccaccca ggcctccaac 480

atggttcttc tgctgaagga agtccgatct cagctggatg cttatgctgc ccagtacgcc 540

cctggctacc acttcctcct caccattgcc gccccagctg gcaaggataa ctactccaag 600

ctgcgcctgg ctgatctcgg ccaagtcctc gactacatca acctcatggc ctacgactac 660

gctggatcct tcagccccct caccggtcac gacgccaacc tgtttgccaa cccgtccaac 720

cccaatgcca cacccttcaa caccgattct gctgtcaagg attatatcaa tggaggtgtt 780

cccgccaaca agattgttct cggcatgccc atctacggac gatcattcca gaacaccgct 840

ggcattggcc agacttacaa cggagttgga ggtggcggtg gtggctccac tggaagctgg 900

gaggccggta tctgggatta caaggctctt cccaaggccg gcgccaccat ccagtacgac 960

tctgtcgcaa agggttacta cagctacaac gccggcacca aggagctcat ctctttcgat 1020

acccctgaca tgatcaacac caaggttgcc tacctcaagt ctctcggcct aggaggtagc 1080

atgttctggg aagcctcagc cgacaagaag ggagctgact cgctgattgg aacaagccac 1140

agagctcttg gaggcctgga cacgactcag aacttgctga gctaccccaa ctccaagtat 1200

gataacatca ggaacggtct gaac 1224

<210> 3

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

ctgcgaattc agccccctgg ccacag 26

<210> 4

<211> 31

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

acttacgcgt gttcagaccg ttcctgatgt t 31

<210> 5

<211> 52

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gaagctggat ccgaattccc gctcgagggg cccacgcgtc atcatcatca tc 52

Claims

1. a kind of Trichoderma harzianum chitinase Chit46, it is characterised in that:

The amino acid sequence of the Trichoderma harzianum chitinase Chit46 is as shown in SEQ ID NO.1.

2. Trichoderma harzianum chitinase Chit46 according to claim 1, it is characterised in that:

The nucleotide sequence of the coding Trichoderma harzianum chitinase Chit46 is as shown in SEQ ID NO.2.

3. the expression and purification method of the described in any item Trichoderma harzianum chitinase Chit46 of claims 1 or 2, feature exist In including the following steps:

(2) by the recombinant expression carrier transformed cells；

(3) fermentation inducement and purifying are carried out to positive cell.

4. the expression and purification method of Trichoderma harzianum chitinase Chit46 according to claim 3, it is characterised in that:

Expression vector described in step (1) is plasmid pPIC9BM, and the plasmid is by changing the multienzyme enzyme site of plasmid pPIC9K It makes and is followed successively by BamHI, EcoRI, ApaI and MluI are obtained；

Chitinase gene segment chit46 and the pPIC9BM carrier segments are that the ratio of 1:5 is attached in molar ratio；

The Trichoderma harzianum is Trichoderma harzianum GIM 3.442；

Cell described in step (2) is Pichia pastoris GS115；

It is converted into described in step (2) after linearizing the recombinant expression carrier and cell is transferred to by electrotransformation；

The operation of the linearisation is the recombinant expression carrier described in BglII endonuclease digestion.

5. the expression and purification method of the Trichoderma harzianum chitinase Chit46 according to claim 3, feature exist In by the specific steps of the recombinant expression carrier transformed cells in step (2) are as follows:

1. constructing and extracting pMD18-T-chit46 cloning vector plasmids, PCR amplification is carried out using it as template, is used after identifying product Purification and recovery obtains recovery product；

2. Expression vector pPIC9K multienzyme enzyme site is transform as BamHI, EcoRI, ApaI and MluI, building obtains expression vector pPIC9BM；

3. after carrying out double digestion to 2. pPIC9BM carrier that step recovery product 1. and step obtain using EcoRI and MluI, Purification and recovery respectively, chitinase gene segment chit46 and the pPIC9BM carrier after obtaining double digestion；

4. by step 3. obtained in chitinase gene segment chit46 and pPIC9BM carrier carry out Ligation in vitro, construct To expression plasmid pPIC9BM-chit46；

6. preparing Pichia pastoris GS115 competence；It is transferred to using 5. linearization plasmid that electrotransformation obtains step and finishes red ferment In mother.

6. according to the expression and purification method of the described in any item Trichoderma harzianum chitinase Chit46 of claim 3~5, feature It is:

Affinity chromatography is purified by described in step (3) to be purified；Eluent be 0.15M imidazoles, 0.5M NaCl, The phosphate buffer of the pH7.4 of 0.02M；

The condition of fermentation inducement described in step (3) is in BMMY culture solution, and 28 DEG C, 250rpm shaken cultivation, every 24 is small The methanol solution of Shi Tianjia 1.5% carries out inducing expression；The time of induction is 7 days；

The formula of the BMMY culture solution is yeast extract 10g, tryptone 20g, YNB 13.4g, methanol 10mL, 1M The potassium phosphate 100mL that pH is 6, distilled water are settled to 1000mL.

7. a kind of recombinant expression carrier, it is characterised in that:

Nucleotide sequence containing the described in any item Trichoderma harzianum chitinase Chit46 of claims 1 or 2.

8. a kind of recombined engineering cell, it is characterised in that:

Contain recombinant expression carrier as claimed in claim 7.

9. application of the described in any item Trichoderma harzianum chitinase Chit46 of claims 1 or 2 in tobacco brown spot pathogen hydrolysis.

10. application of the Trichoderma harzianum chitinase Chit46 according to claim 9 in tobacco brown spot pathogen hydrolysis, special Sign is:

The chitin source is one of shrimp, crab, shellfish and insect shellfish or at least two；

The condition of application of the chitinase in tobacco brown spot pathogen hydrolysis are as follows: pH 6.0, temperature are 45 DEG C.