CN109679909A - A kind of method of induced monocyte to macrophage differentiation - Google Patents
A kind of method of induced monocyte to macrophage differentiation Download PDFInfo
- Publication number
- CN109679909A CN109679909A CN201910116227.5A CN201910116227A CN109679909A CN 109679909 A CN109679909 A CN 109679909A CN 201910116227 A CN201910116227 A CN 201910116227A CN 109679909 A CN109679909 A CN 109679909A
- Authority
- CN
- China
- Prior art keywords
- culture bottle
- monocyte
- cell
- culture
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/06—Anti-neoplasic drugs, anti-retroviral drugs, e.g. azacytidine, cyclophosphamide
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The method of the present invention discloses a kind of method of induced monocyte to macrophage differentiation, includes the following steps: step 1, monocyte recovery；Step 2, monocyte culture and passage；Step 3, monocyte induction；Step 4, monocyte induction identification.Method of the induced monocyte of the present invention to macrophage differentiation, passing through the interferon regulatory factor inhibitor of low concentration --- Trimetinib regulates and controls the expression of interferon regulatory factor, achieve the purpose that promote monocyte to macrophage differentiation, has induced efficiency height, cost is relatively low, it is easy to operate, the advantages that can be applied to high throughput test, save cost.
Description
Technical field
The present invention relates to a kind of biological method, method of specifically a kind of induced monocyte to macrophage differentiation.
Background technique
Monocyte (monocytes) is maximum haemocyte and the maximum leucocyte of volume in blood, is that body is anti-
One important component of imperial system.Monocyte have apparent amoeboid movement, can swallow, remove injury, aging it is thin
Born of the same parents and its fragment.Monocyte may participate in immune response, and entrained antigenic determinant is handed to lymph after swallowing antigen
Cell, the specific immunity reaction of induction of lymphocyte.Monocyte is also to tackle intracellular pathogenic bacteria and helminth
Main cell defence system also has the ability of identification and killing tumor cell.
Candidate stem cell of the cells of monocytic origin in marrow, and developed in marrow, when they enter blood from marrow
When be still still immature cell.Monocyte was recycled in blood flow about one to three days, then normally entered the group of whole body
Knit and be divided into macrophage (Macrophage) and Dendritic Cells (Dendritic cell).Macrophage also belongs to white
One kind of cell, it can swallow the cell with vitellophag fragment, microorganism, cancer cell and certain protein, it is now recognized that
Monocyte is the predecessor of macrophage.
It is well known that the monocytes/macrophages system (mononuclear- of monocyte and macrophage composition
Phagocyte system, MPS) be body inherent immunity system important component, initially originate from candidate stem cell.It is single
Core-macrophage has various biological functions, mainly can be summarized as follows: the defence of i. nonspecific immunity:
By exciting innate immune response, is swallowed and remove by monocytes/macrophages after foreign pathogen enters body；Ii. antigen
Present: after exotic antigen enters body, first by monocytes/macrophages phagocytosis, digestion, by effective antigenic determinant and
Mhc class ii molecule is combined into complex, this species complex is identified by T cell, to excite immune response.Iii. medium work is secreted
L-1, interferon, complement (C1, C4, C2, C3, C5, Factor B) etc..
The physiological function research of monocytes/macrophages system remains unknown at present, and many problems demands solve, and the present invention mentions
A kind of method of induced monocyte to macrophage differentiation has been supplied, has inhibited monokaryon thin by drug Trimetinib trametinib
The promotive factor interferon regulatory factor (IRF4) that born of the same parents break up to Dendritic Cells direction, induced monocyte divide to macrophage
Change.The present invention provides new thinking and research means for monocytes/macrophages systematic research.
Chinese invention patent application number CN201410809692 discloses a kind of induced monocyte to macrophage differentiation
Method, intracellular p38IP protein level is lowered by shRNA interference and promotes directed differentiation of the monocyte to macrophage,
To increase the pick-up rate of macrophage, overcomes monocyte in the prior art and induce the method to macrophage differentiation complicated
And undesirable technical problem, new research and treatment thoughts are proposed for macrophage differentiation disorders.However, this method
The problems such as that there are still abductive approach is higher to cytotoxicity, operation is cumbersome, take a long time, higher cost.
Method content
The purpose of the present invention is to provide a kind of induced monocytes to the method for macrophage differentiation, to solve above-mentioned back
The problem of being proposed in scape technology.
To achieve the above object, this method provides the following technical solutions:
A kind of induced monocyte includes the following steps: step 1, monocyte recovery to the method for macrophage differentiation；
Step 2, monocyte culture and passage；Step 3, monocyte induction；Step 4, monocyte induction identification.
As this method further embodiment: the specific processing method of the step 1 monocyte recovery are as follows: by what is frozen
Monocyte is removed from liquid nitrogen, and then the unscrewing of cell cryopreservation tube lid is tightened for 1/4 week be immediately placed in 37 C water baths, is made
Liquid level just at cell cryopreservation tube lid below, it is ensured that touch cell pipe lid without any liquid, sprayed with 70% alcohol
Pipe surface is frozen, the alcohol of cryopreservation tube excess surface is removed and is moved into Biohazard Safety Equipment, is shifted cell using transfer pipet(te)
Into the culture bottle for having been loaded with pre- thermally equilibrated mononuclear cells cultures, culture bottle is put into 37 degrees Celsius, 5%CO2Culture
In case.
As this method further embodiment: the specific processing method of the step 2 monocyte culture and passage are as follows: step
Culture bottle is moved into Biohazard Safety Equipment from incubator, is inhaled when the cell confluency rate in step 1 is to 80~90% by rapid 2a.
Culture medium in culture bottle out, according to 100 μ l/cm2Culture bottle ware floor space use HBSS balanced salt solution rinse culture bottle,
It is light to shake HBSS balanced salt solution culture bottle 15 seconds and be sucked out in culture bottle, according to 100 μ l/em2Culture bottle ware floor space to
Pancreatin/EDTA solution is added in culture bottle, tightens culture bottle cap, culture bottle is placed in microscopy under microscope, when cell starts
Fall off ware bottom when pat culture bottle and by culture bottle move into Biohazard Safety Equipment in, according to 100 μ l/cm2Culture bottle ware floor space
Pancreatin neutralizer is added into culture bottle, mixes well, the liquid after mixing is sucked out into centrifuge tube；Step 2b.220g centrifugation 3
Minute, it discards supernatant, cell mass is resuspended using appropriate mononuclear cells cultures, according to 1*106The density inoculating cell of/ml is extremely
In culture bottle.
As this method further embodiment: the pancreatin/EDTA solution is in room temperature state.
As this method further embodiment: the specific processing method of the step 3 monocyte induction are as follows: according to step
2a operation, is resuspended after centrifugation using mononuclear cells cultures, inoculum density is according to 0.5*106/cm2Culture bottle ware bottom surface
Product is inoculated with, and culture medium is changed to the mononuclear cells cultures containing 0.3 μ g/ml Trimetinib after adherent 24 hours, is trained
Culture medium is sucked out after supporting 72 hours, and replaces the fresh mononuclear cells cultures containing 0.2 μ g/ml Trimetinib, continues to train
Induction identification and analysis is carried out to cell after supporting 72 hours.
As this method further embodiment: the specific processing method of the step 4 monocyte induction identification includes stream
Formula analyzes and identifies method, real-time fluorescence quantitative PCR analyzes and identifies method and immunoblotting assay identification method；
The flow cytometer showed identification method are as follows: operated according to step 2a, the cell after centrifugation is extracted using trizol method
RNA, reverse transcription obtain cDNA, prepare reaction system, carry out qPCR test using specific primer；
The immunoblotting assay identification method are as follows: operated according to step 2a, the cell after centrifugation uses protein lysate
Cell is cracked, polyacrylamide gel electrophoresis is reused, is resisted respectively using the CD14 antibody of specificity, CD16 after transferring film
Body, CD1a primary antibody are incubated for and secondary antibody is incubated for, ECL liquid color development；
The immunoblotting assay identification: it is operated according to step 2a, the cell after centrifugation is using protein lysate to cell
Cracked, reuse polyacrylamide gel electrophoresis, after transferring film respectively using the CD14 antibody of specificity, CD16 antibody,
CD1a primary antibody is incubated for and secondary antibody is incubated for, ECL liquid color development.
As this method further embodiment: the specific primer sequence of the CD14 are as follows: forward primer:
AGTGTGAAGCCTGGAAGCCG, reverse primer: CGCGCTCCATGGTCGATAAG；The specific primer sequence of CD16 are as follows: just
To primer: CAGACCCACCCACCTTGCC, reverse primer: CGCATGCCAGCTGAAACTAGA；The specific primer sequence of CD1a
It is classified as: forward primer: TTGGAGGAGCAACAGGGCTCAA, reverse primer: CTCAGCCAACCTGAGACCAGA.
As this method further scheme: the response procedures of step 1 to four are as follows: step 1: 95 DEG C, 3 minutes；Step
Rapid two: 95 DEG C, 10 seconds；Step 3: 60 DEG C, 45 seconds；Step 4: step 2 and step 3 repeat 40 times.
Compared with prior art, the beneficial effects of the present invention are: induced monocyte of the present invention is to macrophage differentiation
Method passes through the interferon regulatory factor inhibitor of low concentration --- and Trimetinib adjusts the expression of interferon regulatory factor
Control achievees the purpose that promote monocyte to macrophage differentiation have induced efficiency height, and cost is relatively low, easy to operate, can be with
Applied to high throughput test, the advantages that saving cost.
Detailed description of the invention
Fig. 1 is the monocyte figure before present invention induction.
Fig. 2 is the monocyte figure after present invention induction.
Fig. 3 is Trimetinib induction experiment schematic diagram of the present invention.
Fig. 4 is that the monocyte before present invention induction analyzes result figure.
Fig. 5 is the monocyte flow cytometer showed result figure before present invention induction.
Fig. 6 is the monocyte immunoblot results figure before present invention induction.
Fig. 7 is that the monocyte real-time fluorescence quantitative PCR after present invention induction analyzes result.
Specific embodiment
Below in conjunction with the attached drawing in this hair inventive embodiments, technical solution in the embodiment of the present invention carry out it is clear,
It is fully described by, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Base
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts it is all its
His embodiment, shall fall within the protection scope of the present invention.
Embodiment 1: to the method for macrophage differentiation, the method comprised the steps of: for a kind of induced monocyte
Step 1, monocyte recovery: the monocyte frozen is removed from liquid nitrogen, and cell cryopreservation tube lid is unscrewed 1/4
Zhou Ranhou, which is tightened, to be immediately placed in 37 C water baths so that liquid level just at cell cryopreservation tube lid below, it is ensured that do not appoint
What liquid touches cell pipe lid.Pipe surface is frozen with the sprinkling of 70% alcohol, removes the alcohol of cryopreservation tube excess surface and immigration
In Biohazard Safety Equipment.Cell is transferred to the culture bottle for having been loaded with pre- thermally equilibrated mononuclear cells cultures using transfer pipet(te)
In, culture bottle is put into 37 degrees Celsius, 5%CO2Incubator in.
Preferably, the monocyte frozen is purchased from promocell (C-12909).Preferably, mononuclear cells cultures are purchased from
promocell(C-28030)。
Step 2, monocyte culture and passage:
Culture bottle is moved into biology peace when the cell confluency rate in step 1 is to 80~90% by step 2a. from incubator
In full cabinet, the culture medium in culture bottle is sucked out, according to 100 μ l/cm2Culture bottle ware floor space moistened using HBSS balanced salt solution
Culture bottle is washed, it is light to shake HBSS balanced salt solution culture bottle 15 seconds and be sucked out in culture bottle.According to 100 μ l/cm2Culture bottle ware
Pancreatin/EDTA solution is added into culture bottle for floor space.Culture bottle cap is tightened, culture bottle is placed in microscopy under microscope, when
Cell pats culture bottle and moves into culture bottle in Biohazard Safety Equipment when starting shedding off ware bottom.According to 100 μ l/cm2Culture bottle
Pancreatin neutralizer is added into culture bottle for ware floor space, mixes well, and the liquid after mixing is sucked out into centrifuge tube；
Step 2b.220g is centrifuged 3 minutes.It discards supernatant, cell mass is resuspended using appropriate mononuclear cells cultures.According to
1*106The density inoculating cell of/ml is into culture bottle.
Preferably, pancreatin/EDTA solution is in room temperature state.Preferably, pancreatin/EDTA solution is selected from promocell.
Step 3, monocyte induction: it is operated according to step 2a, is resuspended, is connect using mononuclear cells cultures after centrifugation
Kind density is according to 0.5*106/cm2Culture bottle ware floor space be inoculated with.After adherent 24 hours by culture medium be changed to containing
The mononuclear cells cultures of 0.3 μ g/ml Trimetinib (trametinib).Culture medium is sucked out after 72 hours in culture, and more renews
The fresh mononuclear cells cultures containing 0.2 μ g/ml Trimetinib (trametinib).Continue culture 72 hours after to cell into
Row induction identification and analysis.
Preferably, Trimetinib is purchased from apexbio.
Step 4, monocyte induction identification:
Flow cytometer showed identification: being operated according to step 2a, be resuspended after centrifugation using HBSS balanced salt solution, is added after resuspension
Enter CD14 surface marker antibody, CD16 surface marker antibody, CD1a surface marker antibody and mix, carries out fluidic cell
Analysis.
Preferably, CD14 surface marker antibody (367130), CD16 surface marker antibody (302008), the surface CD1a
Marker antibody (300130) is purchased from biolegend.
Real-time fluorescence quantitative PCR analyzes and identifies: operating according to step 2a, the cell after centrifugation is extracted using trizol method
RNA, reverse transcription obtain cDNA, prepare reaction system, carry out qPCR test using specific primer.
Preferably, the specific primer sequence of CD14 are as follows:
Forward primer: AGTGTGAAGCCTGGAAGCCG；
Reverse primer: CGCGCTCCATGGTCGATAAG；
Preferably, the specific primer sequence of CD16 are as follows:
Forward primer: CAGACCCACCCACCTTGCC；
Reverse primer: CGCATGCCAGCTGAAACTAGA；
Preferably, the specific primer sequence of CD1a are as follows:
Forward primer: TTGGAGGAGCAACAGGGCTCAA；
Reverse primer: CTCAGCCAACCTGAGACCAGA；
Preferably, response procedures are as follows:
Step 1: 95 DEG C, 3 minutes；
Step 2: 95 DEG C, 10 seconds；
Step 3: 60 DEG C, 45 seconds；
Step 4: step 2 and step 3 repeat 40 times.
Immunoblotting assay identification: operating according to step 2a, and the cell after centrifugation carries out cell using protein lysate
Cracking reuses polyacrylamide gel electrophoresis, at the beginning of using the CD14 antibody, CD16 antibody, CD1a of specificity respectively after transferring film
Grade antibody incubation and secondary antibody are incubated for, ECL liquid color development.
Preferably, CD14 antibody, CDl6 antibody, CD1a primary antibody and secondary antibody are purchased from biolegend.
Embodiment 2:
Method from a kind of induced monocyte to macrophage differentiation, it is specific as follows:
Identification before monocyte induction:
1) monocyte frozen is removed from liquid nitrogen, cell cryopreservation tube lid is unscrewed then to tighten within 1/4 week and is put immediately
Enter in 37 C water baths so that liquid level just at cell cryopreservation tube lid below, it is ensured that touch cell without any liquid
Pipe lid.Pipe surface is frozen with the sprinkling of 70% alcohol, the alcohol of cryopreservation tube excess surface is removed and moves into Biohazard Safety Equipment.It uses
Cryopreservation tube inner cell is transferred to the T75 culture bottle for being preinstalled with the pre- thermally equilibrated mononuclear cells cultures of 10ml by transfer pipet(te)
In, culture bottle is put into 37 degrees Celsius, 5%CO2Incubator in.
2) when monocyte converges rate to 80~90%, the T75 culture bottle equipped with monocyte is moved from incubator
Enter in Biohazard Safety Equipment, the culture medium in T75 culture bottle be sucked out, 7.5ml HBSS balanced salt solution is added into T75 culture bottle,
It is light to shake HBSS balanced salt solution culture bottle 15 seconds and be sucked out in culture bottle.7.5ml pancreatin/EDTA is added into T75 culture bottle
Solution tightens culture bottle cap, and culture bottle is placed in microscopy under microscope, culture bottle is patted when cell starts shedding off ware bottom simultaneously
Culture bottle is moved into Biohazard Safety Equipment.7.5ml pancreatin neutralizer is added into T75 culture bottle, mixes well, is sucked out after mixing
Liquid into centrifuge tube, 220g be centrifuged 3 minutes.It discards supernatant, cell mass is resuspended using 3ml mononuclear cells cultures.It presses
According to 1*106The density inoculating cell of/ml is into culture bottle.
3) when monocyte, which converges rate, reaches 80~90% again, T75 culture bottle is removed from incubator, removes training
The culture medium in bottle is supported, 7.5ml pancreatin/EDTA solution is added into T75 culture bottle, tightens culture bottle cap, culture bottle is set
The microscopy under microscope pats culture bottle when cell starts shedding off ware bottom and moves into culture bottle in Biohazard Safety Equipment.To T75
7.5ml pancreatin neutralizer is added in culture bottle, mixes well, the liquid after mixing is sucked out into centrifuge tube, 220g is centrifuged 3 points
Clock.It is resuspended after centrifugation using HBSS balanced salt solution, CD14 surface marker antibody, CD16 surface marker is added after resuspension
Object antibody, CD1a surface marker antibody simultaneously mix, and carry out flow cytometry.
Experimental group:
1) monocyte frozen is removed from liquid nitrogen, cell cryopreservation tube lid is unscrewed then to tighten within 1/4 week and is put immediately
Enter in 37 C water baths so that liquid level just at cell cryopreservation tube lid below, it is ensured that touch cell without any liquid
Pipe lid.Pipe surface is frozen with the sprinkling of 70% alcohol, the alcohol of cryopreservation tube excess surface is removed and moves into Biohazard Safety Equipment.It uses
Cryopreservation tube inner cell is transferred to the T75 culture bottle for being preinstalled with the pre- thermally equilibrated mononuclear cells cultures of 10ml by transfer pipet(te)
In, culture bottle is put into 37 degrees Celsius, 5%CO2Incubator in.
2) when monocyte converges rate to 80~90%, the T75 culture bottle equipped with monocyte is moved from incubator
Enter in Biohazard Safety Equipment, the culture medium in T75 culture bottle be sucked out, 7.5ml HBSS balanced salt solution is added into T75 culture bottle,
It is light to shake HBSS balanced salt solution culture bottle 15 seconds and be sucked out in culture bottle.7.5ml pancreatin/EDTA is added into T75 culture bottle
Solution tightens culture bottle cap, and culture bottle is placed in microscopy under microscope, culture bottle is patted when cell starts shedding off ware bottom simultaneously
Culture bottle is moved into Biohazard Safety Equipment.7.5ml pancreatin neutralizer is added into T75 culture bottle, mixes well, is sucked out after mixing
Liquid into centrifuge tube, 220g be centrifuged 3 minutes.It discards supernatant, cell mass is resuspended using 3ml mononuclear cells cultures.It presses
According to 0.5*106The density inoculating cell of/ml is into culture bottle.
3) after cell adherent 24 hours, the T75 culture bottle equipped with cell is moved into Biohazard Safety Equipment, is removed in culture bottle
Culture medium, 15ml is added into T75 culture bottle and contains the monocyte culture of 0.3 μ g/ml Trimetinib (trametinib)
Base puts back to T75 culture bottle in incubator.Culture medium is sucked out after 72 hours in culture, and 15ml is added into T75 culture bottle and contains
The mononuclear cells cultures of 0.2 μ g/ml Trimetinib (trametinib), T75 culture bottle is put back in incubator.Continue to cultivate
72 hours.
4) T75 culture bottle is removed from incubator, removes the culture medium in culture bottle, is added into T75 culture bottle
7.5ml pancreatin/EDTA solution, tightens culture bottle cap, and culture bottle is placed in microscopy under microscope, when cell starts shedding off ware bottom
When pat culture bottle and will culture bottle move into Biohazard Safety Equipment in.7.5ml pancreatin neutralizer is added into T75 culture bottle, sufficiently
It mixes, the liquid after mixing is sucked out into centrifuge tube, 220g is centrifuged 3 minutes.Weight is carried out using HBSS balanced salt solution after centrifugation
It is outstanding, CD14 surface marker antibody, CD16 surface marker antibody, CD1a surface marker antibody are added after resuspension and mixes,
Carry out flow cytometry, Real time PCR, immunoblotting assay.
Control group:
1) monocyte frozen is removed from liquid nitrogen, cell cryopreservation tube lid is unscrewed then to tighten within 1/4 week and is put immediately
Enter in 37 C water baths so that liquid level just at cell cryopreservation tube lid below, it is ensured that touch cell without any liquid
Pipe lid.Pipe surface is frozen with the sprinkling of 70% alcohol, the alcohol of cryopreservation tube excess surface is removed and moves into Biohazard Safety Equipment.It uses
Cryopreservation tube inner cell is transferred to the T75 culture bottle for being preinstalled with the pre- thermally equilibrated mononuclear cells cultures of 10ml by transfer pipet(te)
In, culture bottle is put into 37 degrees Celsius, 5%CO2Incubator in.
2) when monocyte converges rate to 80~90%, the T75 culture bottle equipped with monocyte is moved from incubator
Enter in Biohazard Safety Equipment, the culture medium in T75 culture bottle be sucked out, 7.5ml HBSS balanced salt solution is added into T75 culture bottle,
It is light to shake HBSS balanced salt solution culture bottle 15 seconds and be sucked out in culture bottle.7.5ml pancreatin/EDTA is added into T75 culture bottle
Solution tightens culture bottle cap, and culture bottle is placed in microscopy under microscope, culture bottle is patted when cell starts shedding off ware bottom simultaneously
Culture bottle is moved into Biohazard Safety Equipment.7.5ml pancreatin neutralizer is added into T75 culture bottle, mixes well, is sucked out after mixing
Liquid into centrifuge tube, 220g be centrifuged 3 minutes.It discards supernatant, cell mass is resuspended using 3ml mononuclear cells cultures.It presses
According to 0.5*106The density inoculating cell of/ml is into culture bottle.
3) after cell adherent 24 hours, the T75 culture bottle equipped with cell is moved into Biohazard Safety Equipment, is removed in culture bottle
Culture medium, the fresh mononuclear cells cultures of 15ml are added into T75 culture bottle, T75 culture bottle is put back in incubator.Training
Culture medium is sucked out after supporting 72 hours, the fresh mononuclear cells cultures of 15ml are added into T75 culture bottle, T75 culture bottle is put
It returns in incubator.Continue culture 72 hours.
5) T75 culture bottle is removed from incubator, removes the culture medium in culture bottle, is added into T75 culture bottle
7.5ml pancreatin/EDTA solution, tightens culture bottle cap, and culture bottle is placed in microscopy under microscope, when cell starts shedding off ware bottom
When pat culture bottle and will culture bottle move into Biohazard Safety Equipment in.7.5ml pancreatin neutralizer is added into T75 culture bottle, sufficiently
It mixes, the liquid after mixing is sucked out into centrifuge tube, 220g is centrifuged 3 minutes.Weight is carried out using HBSS balanced salt solution after centrifugation
It is outstanding, CD14 surface marker antibody, CD16 surface marker antibody, CD1a surface marker antibody are added after resuspension and mixes,
Carry out flow cytometry, Real time PCR, immunoblotting assay.
Flow cytometry:
It is resuspended after cell centrifugation using HBSS balanced salt solution, 1: 100 surface CD14 2.5 μ l mark is added after resuspension
Will object antibody diluent, the CD16 surface marker antibody diluent of 2.5 μ l 1: 200PE label, 2.5 μ 11: 100APC label
CD1a surface marker antibody diluent and mix, carry out flow cytometry.
Real time PCR: reaction system is prepared according to as follows, runs qPCR instrument according to following response procedures
Device.Experimental data is exported after instrument end of run and is analyzed using Prism software.
Reaction system:
2x qPCR Mix 5μl
1 μM of 2.5 μ l of primer Mix
cDNA 2.5μl
Response procedures are as follows:
Step 1: 95 DEG C, 3 minutes；
Step 2: 95 DEG C, 10 seconds；
Step 3: 60 DEG C, 45 seconds.
Step 4: step 2 and step 3 repeat 40 times.
Immunoblotting assay:
1) polyacrylamide gel is prepared: choosing cleaned glass plate, long slab and short slab alignment are clamped and be put into folder, it is ensured that
Not leak adhesive is clamped, is prepared according to every piece of separation gel 7.5ml, concentration glue 3ml is prepared；
2) SDS-PAGE: offset plate is fixed, and is put into electrophoresis tank, and about 500ml electrophoretic buffer is added, and slowly extracts comb
Son removes inside groove liquid level foam, observes whether interior tank liquid leaks out, and needs to reinstall if leaking out, after confirming inside groove without leakage
The sample prepared is slowly added into sequence in glue hole, rainbow albumen marker, remaining swimming lane is added in one of swimming lane
With the isometric 1xloading buffer polishing of sample, electrophoresis apparatus is opened, connects power supply, parameter, constant pressure, 80V, to bromine are set
Phenol blue zone is moved at separation gel, when albumen marker is separated, adjusts voltage to 120V, bromophenol blue band is moved to offset plate end i.e.
Stop electrophoresis when will run out of；
3) transferring film (wet turn): preparing 1x transferring film buffer 1L, be cooled to 4 degree in advance, transferring film is pressed from both sides, sponge, transferring film filter paper, nitric acid
Cellulose membrane is immersed in transferring film buffer, and transferring film is pressed from both sides and is opened, transparent face-down, according to platinum sponge, transferring film filter paper, nitric acid
Cellulose membrane, polyacrylamide gel, transferring film filter paper, the sequence of black sponge are sequentially placed into transferring film folder, it is ensured that the process is equal
In transferring film buffer, aeration transferring film is prevented, transferring film is clamped, is put into transferring film slot and (pours into transferring film buffering in advance
Liquid), transferring film presss from both sides transparent side to red, and black side connects power supply to black, and Setting pattern is 300 milliamperes of constant current, and timing 90 divides
Clock, During migration should be carried out because highly exothermic at four degree.
4) Ponceaux is dyed: taking out transferring film folder after transferring film, nitrocellulose filter is put into Ponceaux solution, to nitre
Whether protein band clearly recycles Ponceaux solution afterwards on acid cellulose film, observe caused by having because of bubble on nitrocellulose filter
Uncolored region indicates that size is cut out nitrocellulose filter according to albumen marker；
5) it closes: nitrocellulose filter being soaked in excessive 5% skim milk/TBST, room temperature, timing 1 hour；
6) primary antibody: 5% skim milk extra on nitrocellulose filter is washed away with TBST, nitrocellulose filter is soaked in
Antigen to be checked corresponds in primary antibody solution, and 4 spend night；
7) secondary antibody: nitrocellulose filter is taken out from primary antibody solution, and TBST washes 3 times, and 5 minutes every time, by cellulose nitrate
Plain film is soaked in two corresponding anti-solution, room temperature, and timing 1 hour, TBST was washed 3 times, every time 5 minutes；
8) ECL develops the color: the ECL working solution now matched is dropped evenly on nitrocellulose filter of the surface without obvious drop,
Room temperature waits reaction 1 minute, and extra ECL working solution is removed, into dark situation using light reaching the film to nitrocellulose
Reaction on film is imaged, and film is put into automatic punching machine and is exposed；
Result is analyzed, the position of film and nitrocellulose filter is compared, marks marker, scanner scanning glue
Piece records result.
It is obvious to a person skilled in the art that invention is not limited to the details of the above exemplary embodiments, Er Qie
In the case where without departing substantially from spirit or essential attributes of the invention, the present invention can be realized in other specific forms.Therefore, no matter
From the point of view of which point, the present embodiments are to be considered as illustrative and not restrictive, and the scope of the present invention is by appended power
Benefit requires rather than above description limits, it is intended that all by what is fallen within the meaning and scope of the equivalent elements of the claims
Variation is included within the present invention.Any reference signs in the claims should not be construed as limiting the involved claims.
In addition, it should be understood that although this specification is described in terms of embodiments, but not each embodiment is only wrapped
Containing an independent technical solution, this description of the specification is merely for the sake of clarity, and those skilled in the art should
It considers the specification as a whole, the technical solutions in the various embodiments may also be suitably combined, forms those skilled in the art
The other embodiments being understood that.
Claims (8)
1. a kind of induced monocyte is to the method for macrophage differentiation, which comprises the steps of: step 1, monokaryon
Cell recovery；Step 2, monocyte culture and passage；Step 3, monocyte induction；Step 4, monocyte induction identification.
2. induced monocyte according to claim 1 is to the method for macrophage differentiation, which is characterized in that the step
The specific processing method of 1 monocyte recovery are as follows: the monocyte frozen is removed from liquid nitrogen, cell cryopreservation tube lid is unscrewed
Then tighten within 1/4 week and be immediately placed in 37 C water baths so that liquid level just at cell cryopreservation tube lid below, it is ensured that do not have
Any liquid touches cell pipe lid, freezes pipe surface with the sprinkling of 70% alcohol, removes the alcohol of cryopreservation tube excess surface and shifting
Enter in Biohazard Safety Equipment, cell is transferred to the culture bottle for having been loaded with pre- thermally equilibrated mononuclear cells cultures using transfer pipet(te)
In, culture bottle is put into 37 degrees Celsius, 5%CO2Incubator in.
3. induced monocyte according to claim 1 or 2 is to the method for macrophage differentiation, which is characterized in that described
The specific processing method of the culture of step 2 monocyte and passage are as follows: step 2a. wait for the cell confluency rate in step 1 to 80~
When 90%, culture bottle is moved into Biohazard Safety Equipment from incubator, the culture medium in culture bottle is sucked out, according to 100 μ 1/cm2
Culture bottle ware floor space use HBSS balanced salt solution rinse culture bottle, it is light to shake culture bottle 15 seconds and be sucked out in culture bottle
HBSS balanced salt solution, according to 100 μ l/cm2Culture bottle ware floor space pancreatin/EDTA solution is added into culture bottle, tighten
Bottle cap is cultivated, culture bottle is placed in microscopy under microscope, culture bottle is patted when cell starts shedding off ware bottom and by culture bottle
It moves into Biohazard Safety Equipment, according to 100 μ l/cm2Culture bottle ware floor space pancreatin neutralizer is added into culture bottle, it is sufficiently mixed
It is even, the liquid after mixing is sucked out into centrifuge tube；Step 2b.220g is centrifuged 3 minutes, is discarded supernatant, is used appropriate monocyte
Cell mass is resuspended in culture medium, according to 1*106The density inoculating cell of/ml is into culture bottle.
4. induced monocyte according to claim 3 is to the method for macrophage differentiation, which is characterized in that the pancreas
Enzyme/EDTA solution is in room temperature state.
5. induced monocyte according to claim 3 is to the method for macrophage differentiation, which is characterized in that the step
The specific processing method of 3 monocytes induction are as follows: operated according to step 2a, carry out weight using mononuclear cells cultures after centrifugation
Outstanding, inoculum density is according to 0.5*106/cm2Culture bottle ware floor space be inoculated with, culture medium is changed to after adherent 24 hours
Mononuclear cells cultures containing 0.3 μ g/ml Trimetinib, culture medium is sucked out after 72 hours in culture, and replaces fresh contain
The mononuclear cells cultures of 0.2 μ g/ml Trimetinib carry out induction identification and analysis to cell after continuing culture 72 hours.
6. induced monocyte according to claim 3 is to the method for macrophage differentiation, which is characterized in that the step
The specific processing method of 4 monocytes induction identification includes flow cytometer showed identification method, the real-time fluorescence quantitative PCR side of analyzing and identifying
Method and immunoblotting assay identification method；
The flow cytometer showed identification method are as follows: operated according to step 2a, the cell after centrifugation extracts RNA using trizol method, instead
Transcription obtains cDNA, prepares reaction system, carries out qPCR test using specific primer；
The immunoblotting assay identification method are as follows: operated according to step 2a, the cell after centrifugation is using protein lysate to thin
Born of the same parents crack, and reuse polyacrylamide gel electrophoresis, after transferring film respectively using the CD14 antibody of specificity, CD16 antibody,
CD1a primary antibody is incubated for and secondary antibody is incubated for, ECL liquid color development；
The immunoblotting assay identification: operating according to step 2a, and the cell after centrifugation carries out cell using protein lysate
Cracking reuses polyacrylamide gel electrophoresis, at the beginning of using the CD14 antibody, CD16 antibody, CD1a of specificity respectively after transferring film
Grade antibody incubation and secondary antibody are incubated for, ECL liquid color development.
7. induced monocyte according to claim 6 is to the method for macrophage differentiation, which is characterized in that the CD14
Specific primer sequence are as follows: forward primer: AGTGTGAAGCCTGGAAGCCG, reverse primer:
CGCGCTCCATGGTCGATAAG；The specific primer sequence of CD16 are as follows: forward primer: CAGACCCACCCACCTTGCC, reversely
Primer: CGCATGCCAGCTGAAACTAGA；The specific primer sequence of CD1a are as follows: forward primer:
TTGGAGGAGCAACAGGGCTCAA, reverse primer: CTCAGCCAACCTGAGACCAGA.
8. induced monocyte according to claim 1 is to the method for macrophage differentiation, which is characterized in that step 1~
Four response procedures are as follows: step 1: 95 DEG C, 3 minutes；Step 2: 95 DEG C, 10 seconds；Step 3: 60 DEG C, 45 seconds；Step 4: step
Rapid two repeat 40 times with step 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910116227.5A CN109679909B (en) | 2019-02-15 | 2019-02-15 | Method for inducing monocyte to differentiate into macrophage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910116227.5A CN109679909B (en) | 2019-02-15 | 2019-02-15 | Method for inducing monocyte to differentiate into macrophage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109679909A true CN109679909A (en) | 2019-04-26 |
| CN109679909B CN109679909B (en) | 2020-08-28 |
Family
ID=66195866
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910116227.5A Active CN109679909B (en) | 2019-02-15 | 2019-02-15 | Method for inducing monocyte to differentiate into macrophage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109679909B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120322854A1 (en) * | 2011-06-20 | 2012-12-20 | California Institute Of Technology | Regulation of macrophage activation using mir-125b |
| WO2016168264A1 (en) * | 2015-04-13 | 2016-10-20 | Kiromic, Llc | Methods and compositions for treating cancer with dendritic cells |
| CN109207425A (en) * | 2018-09-29 | 2019-01-15 | 中国医科大学附属口腔医院 | Porphyromonas gingivalis inducing macrophage excretion body rna expression research method |
-
2019
- 2019-02-15 CN CN201910116227.5A patent/CN109679909B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120322854A1 (en) * | 2011-06-20 | 2012-12-20 | California Institute Of Technology | Regulation of macrophage activation using mir-125b |
| WO2016168264A1 (en) * | 2015-04-13 | 2016-10-20 | Kiromic, Llc | Methods and compositions for treating cancer with dendritic cells |
| CN109207425A (en) * | 2018-09-29 | 2019-01-15 | 中国医科大学附属口腔医院 | Porphyromonas gingivalis inducing macrophage excretion body rna expression research method |
Non-Patent Citations (7)
| Title |
|---|
| 宁夏大学科学技术处编: "《宁夏大学国家科学基金获资助者名录（2015）》", 31 March 2017 * |
| 张茜茜: "丙肝病毒核心蛋白抑制单核细胞向巨噬细胞极化的作用研究", 《中国博士学位论文全文数据库》 * |
| 时国朝等: "单核细胞向巨噬细胞分化过程中CD44 mRNA表达和黏附功能的变化", 《上海交通大学学报(医学版)》 * |
| 申东梅等: "结核特异性多肽E6、E7和C14对单核-巨噬细胞亚型极化的影响", 《中国医药生物技术》 * |
| 范玉明等主编: "《毒理学安全性评价标准操作规程指南（下册）》", 31 May 2009 * |
| 谢树瑞等主编: "《临床病理诊断学》", 30 September 2017 * |
| 郑宇静等: "MEK1/2抑制剂曲美替尼的药理作用与临床评价", 《中国新药杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109679909B (en) | 2020-08-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3070865B2 (en) | Subset of human progenitor cells | |
| CN105331580B (en) | Enhance mescenchymal stem cell chemotactic ability and chemokine CCL5 expression | |
| CN102735680B (en) | Test strip for quickly detecting porcine circovirus 2 (PCV2) antibody by adopting colloidal gold | |
| CN102353783A (en) | Kit for detecting pig pseudorabies virus antibodies and block enzyme-linked immuno sorbent assay (ELISA) method | |
| CN111484969B (en) | Application of hair follicle stem cell source exosome in promoting hair follicle stem cell proliferation and differentiation to hair follicle cells | |
| CN110095599A (en) | The Microimmunofluorescence test method of cell-free loss | |
| Gupta et al. | An efficient method to generate kidney organoids at the air-liquid interface | |
| CN103865873B (en) | The allochthon of Subaerial blue green algae secretion and its application | |
| CN108486039B (en) | Method for inducing human adipose-derived stem cells to differentiate into testicular interstitial cells by using small molecules | |
| CN114487415A (en) | Tumor cell PD-L1PD-L2 immunofluorescence + FISH detection kit | |
| WO2024187710A1 (en) | Method for simulating sensitive response of jurkat cells in mechanical microenvironments | |
| CN109852581A (en) | A kind of method for promoting stem cell to break up at rouge and its agents useful for same or kit | |
| CN106589124A (en) | Application of CD146 monoclonal antibody in detection and separation and identification of glioma perivascular cells | |
| CN109679909A (en) | A kind of method of induced monocyte to macrophage differentiation | |
| Belenguer et al. | Cell population analysis of the adult murine subependymal neurogenic lineage by flow cytometry | |
| CN106635980B (en) | A kind of the sheep derived from peripheral blood cell line and its method for building up of spontaneous immortalization | |
| CN108410803B (en) | A kind of induced lipolysis stem cell at cartilage differentiation cultural method and culture solution | |
| CN108220233A (en) | Cell separation set surface treatment method, related utensil, peripheral blood rare cell or circulating tumor cell rapidly and efficiently separation method | |
| CN105483246A (en) | Application of differential expression of gene in oral cancer diagnosis | |
| Peters | Preparation of large quantities of pure bovine lymphocytes and a monolayer technique for lymphocyte cultivation | |
| CN108410796A (en) | A method of induction human mesenchymal stem cell breaks up to vascular endothelial cell | |
| Olsen et al. | Influence of culture conditions on growth of FL-74 cells and feline oncornavirus cell membrane associated antigen production | |
| CN111269940A (en) | Method for directly transdifferentiating mesenchymal stem cells into sperms by using transcription factor FOXO1 | |
| CN107541522A (en) | The monoclonal antibody of anti-Ebola virus GP protein and its application | |
| CN113754761A (en) | Monoclonal antibody for detecting new coronavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |