CN109676128B - Preparation method and application of molybdenum trisulfide coated gold nanorods - Google Patents

Preparation method and application of molybdenum trisulfide coated gold nanorods Download PDF

Info

Publication number
CN109676128B
CN109676128B CN201910149785.1A CN201910149785A CN109676128B CN 109676128 B CN109676128 B CN 109676128B CN 201910149785 A CN201910149785 A CN 201910149785A CN 109676128 B CN109676128 B CN 109676128B
Authority
CN
China
Prior art keywords
zearalenone
gold nanorods
molybdenum
solution
coated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910149785.1A
Other languages
Chinese (zh)
Other versions
CN109676128A (en
Inventor
黄昊文
花欣怡
汪志芳
阳秀梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan University of Science and Technology
Original Assignee
Hunan University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan University of Science and Technology filed Critical Hunan University of Science and Technology
Priority to CN201910149785.1A priority Critical patent/CN109676128B/en
Publication of CN109676128A publication Critical patent/CN109676128A/en
Application granted granted Critical
Publication of CN109676128B publication Critical patent/CN109676128B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F1/00—Metallic powder; Treatment of metallic powder, e.g. to facilitate working or to improve properties
    • B22F1/16—Metallic particles coated with a non-metal
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F1/00—Metallic powder; Treatment of metallic powder, e.g. to facilitate working or to improve properties
    • B22F1/05—Metallic powder characterised by the size or surface area of the particles
    • B22F1/054—Nanosized particles
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F9/00—Making metallic powder or suspensions thereof
    • B22F9/16—Making metallic powder or suspensions thereof using chemical processes
    • B22F9/18—Making metallic powder or suspensions thereof using chemical processes with reduction of metal compounds
    • B22F9/24—Making metallic powder or suspensions thereof using chemical processes with reduction of metal compounds starting from liquid metal compounds, e.g. solutions
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y40/00—Manufacture or treatment of nanostructures
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
    • G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry

Landscapes

  • Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Engineering & Computer Science (AREA)
  • Nanotechnology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • General Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Manufacturing & Machinery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Inorganic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a preparation method and application of gold nanorods coated by molybdenum tetrasulfide. The preparation method comprises the step of reacting the gold nanorods with a sodium thiosulfate solution and a molybdenum pentachloride solution for 4-8 hours to obtain the molybdenum tetrasulfide coated gold nanorods with peroxide mimic enzyme activity. The obtained molybdenum trisulfide-coated gold nanorod mimic enzyme is applied to detecting the content of mycotoxin zearalenone. According to the invention, by utilizing the characteristic that gold nanorods coated with molybdenum tetrasulfide are catalyzed and decomposed by hydrogen peroxide, and according to the specific combination of an antigen and an antibody, zearalenone and a zearalenone aptamer modified with the gold nanorods coated with molybdenum tetrasulfide are subjected to specific action, so that the purpose of detecting zearalenone is achieved; the method for detecting the zearalenone by adopting the molybdenum trisulfide coated gold nanorods has the advantages of high sensitivity, obvious phenomenon and simple and convenient operation, and can effectively and accurately determine the concentration of the zearalenone in crops.

Description

Preparation method and application of molybdenum trisulfide coated gold nanorods
Technical Field
The invention belongs to the technical field of chemical biological sensing and biological detection, and particularly relates to a preparation method and application of gold nanorods coated with molybdenum tetrasulfide.
Background
Enzymes are indispensable to life activities, and many reactions of the human body require catalysis by the enzymes, which can reduce activation energy of chemical reactions, accelerate chemical reaction rates, control chemical reaction degrees, and the like. The natural enzyme is a protein, nucleic acid or a complex thereof which is produced in vivo, has high efficiency, specificity, diversity, and the property of generating specific reaction with a substrate, and is widely applied in the fields of food, industry and agriculture, and medicine. However, natural enzymes also have a number of disadvantages. Such as the sensitive influence of external environmental conditions (strong acid, strong base and high temperature) on the catalytic activity, poor stability, easy inactivation, difficult purification, difficult storage, high price and the like. Therefore, finding and preparing enzymes with low cost and high efficiency requires intensive research by researchers. Meanwhile, the mimic enzyme is generated at the same time. The mimic enzyme is a kind of artificially synthesized non-protein molecule, and has the characteristics of simple structure, stable chemical property, low price, easy obtainment and the like.
The nanometer mimic enzyme is a mimic enzyme which not only has the unique performance of nanometer materials, but also has a catalytic function. The nano mimic enzyme is a nano material, and has special physical and chemical properties such as light, electricity, magnetism and the like if the specific surface area is high. Due to the unique properties, the nano material mimic enzyme has unique advantages in the fields of biosensing, biomedicine, imaging and the like. The gold nanorod is a rod-shaped gold nanoparticle with the size from several nanometers to hundreds of nanometers, the surface plasma resonance wavelength of the gold nanorod can be changed along with the length-width ratio of the gold nanorod, and the surface plasma resonance wavelength of the gold nanorod can be continuously adjusted from 550nm to 1550 nm. The molybdenum trisulfide coated gold nanorods prepared from the gold nanorods, sodium thiosulfate and molybdenum pentachloride retain the chemical and physical characteristics of the gold nanorods and also have the property of peroxidase. The gold nanorods are coated with the molybdenum tetrasulfide by using the peroxide to simulate the enzyme property and the antigen-antibody specific reaction, can be used for detecting zearalenone, enterotoxin, vomitoxin and the like, and contributes to food safety.
Zearalenone (Zearalenone), also known as F-2 toxin, mainly pollutes corn, wheat, rice, barley, millet, oats and other grains, and is a metabolite of Zearalenone.
Zearalenone has estrogenic effect, and can be used for treating hyperestrogenic syndrome of livestock, poultry and experimental mouse. Consumption of zearalenone containing foods by pregnant animals (including humans) can cause abortion, stillbirth and teratogenesis. The food made from wheat flour containing gibberellic disease can also cause poisoning symptoms of central nervous system, such as nausea, chill, headache, mental depression and ataxia. Once the substances enter a human body, the substances can cause poisoning of the human body, and no specific medicine is available for treating animal zearalenone poisoning. Food poisoning is a global public health problem that has frequently occurred in developed industrialized and developing countries, both in the past and now. The poisoning incidents which occur every year in China are very many, and reports are reported all over the country and are diseases which are mainly monitored by disease prevention and control departments. A large number of facts show that the food safety problem seriously affects the life of people, and an ultrahigh-sensitivity rapid analysis method for zearalenone is urgently needed to be established.
Research shows that the molybdenum trisulfide coated gold nanorods have certain catalytic capacity, and H is in the presence of the molybdenum trisulfide coated gold nanorods2O2Is rapidly catalytically decomposed, hydrogen peroxide is catalytically decomposed to generate hydroxyl radicals, the hydroxyl radicals oxidize TMB, and oxidation states TMB with different concentrations show different colors. Based on the method, a novel dual-mode detection method is established, visual semi-quantitative detection can be performed on the object to be detected by using color change, and quantitative detection can be performed on the accurate content of the object to be detected through the absorbance.
Disclosure of Invention
The invention aims to provide a preparation method and application of molybdenum trisulfide-coated gold nanorod mimic enzyme, which are simple in preparation, convenient to operate and suitable for popularization.
The purpose of the invention is realized by the following modes:
the preparation method of the tri-molybdenum tetrasulfide coated gold nanorod mimic enzyme is characterized in that the gold nanorod reacts with a sodium thiosulfate solution and a molybdenum pentachloride solution for 4-8 hours to obtain the tri-molybdenum tetrasulfide coated gold nanorod with the activity of the peroxidase mimic enzyme.
Further, the preparation method of the gold nanorod comprises the following steps: adding CTAB solution into an erlenmeyer flask, and firstly adding AgNO under the condition of stirring3Adding HAuCl into the solution4Continuously stirring the solution for 2-5 minutes, then dropwise adding ascorbic acid until the solution fades, and adding a CTAB solution and AgNO3Solution, HAuCl4And ascorbic acid in a ratio of 260-320: 0.7-0.9: 2.5-3.5: 0.2-0.4, standing for 2-3 hours to obtain the gold nanorods.
Further, the concentration of the CTAB solution is 0.1-0.2 mol/L, and AgNO3The concentration of the solution is 0.008-0.014 mol/L, and HAuCl4The concentration of the solution is 0.015 to E0.025mol/L and the concentration of ascorbic acid is 0.008-0.012 mol/L.
Further, adding the gold nanorods, a sodium thiosulfate solution and a molybdenum pentachloride solution in sequence, wherein the volume ratio of the gold nanorods to the sodium thiosulfate solution to the molybdenum pentachloride solution is 4-6: 0.01-0.03: 0.03-0.05, the concentration of the sodium thiosulfate solution is 0.08-0.12 mol/L, and the concentration of the molybdenum pentachloride solution is 0.08-0.12 mol/L, and it is worth explaining that the more molybdenum pentachloride is added on the basis that the metering relation between the sodium thiosulfate and the molybdenum pentachloride is 1:1, namely the more molybdenum pentachloride is added, the thicker the molybdenum tetrasulfide coating layer is.
The molybdenum trisulfide-coated gold nanorod mimic enzyme obtained by the preparation method is applied to detecting the content of mycotoxin zearalenone.
Further, the application is specifically as follows: firstly, connecting molybdenum trisulfide coated gold nanorods with a zearalenone DNA aptamer with a sulfhydryl group, namely a ZEN-aptamer, through a gold-sulfur bond, then adding zearalenone into the molybdenum trisulfide coated gold nanorods connected with the ZEN-aptamer according to the specific combination of the ZEN-aptamer and the zearalenone, reacting for 15-30 minutes, then adding hydrogen peroxide, 3',5,5' -tetramethylbenzidine, namely TMB solution into the system, according to the difference of the concentration of zearalenone, the areas covering the gold nanorods and the molybdenum trisulfide are different, so that the colors of TMB (Ox-TMB) in oxidation states are different, and according to the relation between the absorbance value of the Ox-TMB at the wavelength of 652nm and the concentration of zearalenone, calculating to obtain the content of zearalenone in a sample to be detected.
Further, the ZEN-aptamer base sequence is as follows:
5’-GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAACTTAGTAGGATCCCGAA-3’。
further, the gold nanorods coated by the ZEN-aptamer and the molybdenum tetrasulfide are coated by a method of coating the gold nanorods with a molecular weight ratio of 4.9-5.2: 4, reacting for 8-12 hours, and centrifuging for 8-15 min at the rotating speed of 10000-12000 r/min.
Further, in the TMB color development step, the concentration of added hydrogen peroxide is 80-120 mmol/L, the concentration of TMB is 3-7 mmol/L, and the volume ratio of the two solutions is 1: 1.
the invention has the beneficial effects that:
according to the invention, by utilizing the characteristic that gold nanorods coated with molybdenum tetrasulfide are catalyzed and decomposed by hydrogen peroxide, and according to the specific combination of an antigen and an antibody, zearalenone and a zearalenone aptamer modified with the gold nanorods coated with molybdenum tetrasulfide are subjected to specific action, so that the purpose of detecting zearalenone is achieved; the method for detecting the zearalenone by adopting the molybdenum trisulfide coated gold nanorods has the advantages of high sensitivity, obvious phenomenon and simple and convenient operation, and can effectively and accurately determine the concentration of the zearalenone in crops.
The invention relates to a high-sensitivity technology for detecting zearalenone, which can quickly and accurately detect the zearalenone, so that the gold nanorods coated with molybdenum tetrasulfide successfully replace biological enzymes in the traditional enzyme-linked immunosorbent assay. The gold nanorods have the advantages of price, stability and the like which are incomparable with biological enzyme macromolecules, and more importantly, the gold nanorods with the molybdenum trisulfide do not have the problem that biological protease easily loses biological activity. On the other hand, different colors are shown in different states of the introduced TMB, visual detection is established, in addition, the high extinction coefficient of the gold nanoparticles provides extremely high detection sensitivity for the detection method, and compared with the traditional enzyme-linked adsorption method, the detection sensitivity and stability are obviously improved.
The TMB solution with different colors can be obtained by the treatment of the method, the color change of the nano-particles can be regulated according to the concentration of hydrogen peroxide, and the ultra-trace detection of the zearalenone can be realized through the change of the color or the absorbance value.
Drawings
FIG. 1 is a TEM image of gold nanorods and tri-molybdenum tetrasulfide coated gold nanorods, wherein a is the gold nanorods, and b is the tri-molybdenum tetrasulfide coated gold nanorods.
FIG. 2 is a diagram of the ultraviolet-visible absorption spectra of gold nanorods and molybdenum trisulfide coated gold nanorods.
FIG. 3 is an XRD pattern of molybdenum trisulfide coated gold nanorods.
FIG. 4 is a color picture for verifying that the tri-molybdenum tetrasulfide coated gold nanorods have peroxide-mimetic enzyme properties.
FIG. 5 is a line graph showing that under different pH conditions, TMB is oxidized to blue by catalyzing hydrogen peroxide to generate hydroxyl radicals through molybdenum trisulfide coated gold nanorods, and the absorbance of Ox-TMB at 652nm is changed.
FIG. 6 is a graph showing the color change of a zearalenone standard solution in accordance with an embodiment of the present invention.
FIG. 7 is a linear equation of zearalenone concentration versus TMB absorbance at 652 nm.
FIG. 8 is a color rendering of the synthesized sample.
Detailed Description
The following examples are intended to illustrate the invention without further limiting it.
Example 1
Preparation of molybdenum tetrasulfide coated gold nanorods
Taking 5mL of gold nanorod, and adding 0.1mmol/L of Na2S2O320 μ L, then add 0.1mmol/L Mocl 540 mu L, reacting for 6 hours, centrifuging for 10 minutes at the rotating speed of 10000r/min, dispersing with secondary water to obtain the molybdenum trisulfide coated gold nanorod, wherein the shape of the molybdenum trisulfide coated gold nanorod is as shown in figure 1, the shape of the gold nanorod is completely reserved, a layer of shell-shaped structure is formed on the surface of the gold nanorod, and the longitudinal plasma absorption peak of the composite is blue-shifted compared with the longitudinal plasma absorption peak of the gold nanorod, as shown in figure 2, because the refractive index of the surface of the gold nanorod is changed under the action of the molybdenum trisulfide and the gold nanorod, and the molybdenum trisulfide is coated on the surface of the gold nanorod in a crystal form according to the diffraction result of the powder crystal of figure 3. Fig. 4 shows that the tri-molybdenum tetrasulfide coated gold nanorods can catalyze the oxidation of TMB by hydrogen peroxide to blue, i.e., the tri-molybdenum tetrasulfide coated gold nanorods have peroxide mimic enzyme properties and have the strongest catalytic performance under the condition that the pH is 6, as shown in fig. 5.
Example 2
The properties of the trimolybdenum tetrasulfide-coated gold nanorod peroxide mimic enzyme are used for detecting zearalenone:
firstly, 300 mu L of molybdenum tetrasulfide coated gold nanorods are added into a centrifuge tube, and then 500 mu L of 1.0 multiplied by 10 gold nanorods are added-13The DNA aptamer ZEN-aptamer of the zearalenone with the concentration of mu mol/L is connected with the ZEN-aptamer, washed with PBS with the concentration of 0.01mol/L for three times, then added with zearalenone solutions with different concentrations, reacted for 20 minutes, washed with distilled water for three times, added with hydrogen peroxide solution with the concentration of 50mmol/L for reaction for 30 minutes, and then added with TMB solution with the concentration of 5 mmol/L. After 30 minutes, the color change is shown in FIG. 6, which is sequentially increased by 0 and 10 from left to right-7、10-6、10-5、10-4、10-3、10-2As can be seen from the graph, the higher the concentration of zearalenone in mmol/L, the lighter the TMB color development. A standard curve with a good linear relation can be obtained according to the relation between the absorbance of the developed oxidation state TMB at 652nm and the concentration of the zearalenone, and as shown in FIG. 7, the content of the zearalenone in an unknown sample can be calculated according to a linear equation.
The above base sequence is ZEN-aptamer
5’-GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAAC TTAGTAGGATCCCGAA-3’。
Sample processing and recovery determination
Weighing 1.0g of corn and 0.5g of rice purchased from a supermarket, respectively placing the corn and the rice into a centrifuge tube, respectively adding 4mL of 10ng/mL and 5ng/mL zearalenone solutions, mixing for 3 hours, carrying out ultrasonic treatment for 20 minutes, centrifuging, and taking supernatant.
Adding molybdenum trisulfide coated gold nanorods which have good effect with ZEN-aptamer into 12 centrifugal tubes respectively, adding 500 mu L of zearalenone solution treated by corn and rice into 6 centrifugal tubes respectively, wherein each group of corn and rice is divided into two groups, 3 groups are provided, after reacting for 30 minutes, adding 500 mu L of 10ng/mL and 500 mu L of 5ng/mL zearalenone standard solution into the remaining 6 centrifugal tubes respectively, and reacting for 30 minutes. Finally, the 18 centrifuge tubes were added separately100μL50mmol/L H2O2After 20 minutes, the color development of TMB was substantially stabilized with 100. mu.L of 5mmol/L TMB, and as shown in FIG. 8, the absorbance at 652nm was measured, and the corresponding zearalenone concentration was determined from the standard curve. Through calculation, the recovery rates of the corn and the rice are 101.2 percent and 99.21 percent respectively, which shows that the detection method has small system error and high accuracy.

Claims (6)

1. An application of molybdenum trisulfide coated gold nanorods in detecting the content of mycotoxin zearalenone is characterized in that the molybdenum trisulfide coated gold nanorods are connected with a zearalenone DNA aptamer with a sulfhydryl group, namely a ZEN-aptamer, through a gold-sulfur bond, then according to the specific combination of the ZEN-aptamer and zearalenone, zearalenone is added into the molybdenum trisulfide coated gold nanorods connected with the ZEN-aptamer, the reaction is carried out for 15-30 minutes, hydrogen peroxide, 3',5,5' -tetramethylbenzidine, namely TMB solution is added into the system, according to the different concentrations of zearalenone, the areas covering the molybdenum trisulfide coated gold nanorods are different, so that TMB in an oxidation state, namely Ox-TMB, are different in color, and according to the relation between the absorbance value of the Ox-TMB at the wavelength of 652nm and the concentration of zearalenone, thereby calculating the content of the zearalenone in the sample to be detected;
the preparation method of the molybdenum trisulfide coated gold nanorod comprises the following steps: and (3) reacting the gold nanorods with a sodium thiosulfate solution and a molybdenum pentachloride solution for 4-8 hours to obtain the molybdenum tetrasulfide coated gold nanorods with the activity of the peroxide mimic enzyme.
2. Use according to claim 1, characterized in that the ZEN-aptamer base sequence is:
5’-GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAACTTAGTAGGATCCCGAA-3’。
3. the use according to claim 1, wherein the ZEN-aptamer is reacted with the tri-molybdenum tetrasulfide coated gold nanorods for 8-12 hours, and centrifuged at 10000-12000 r/min for 8-15 min.
4. The application of the method as claimed in claim 1, wherein in the TMB color development step, the concentration of the added hydrogen peroxide is 80-120 mmol/L, the concentration of the TMB is 3-7 mmol/L, and the volume ratio of the two solutions is 1: 1.
5. the application of claim 1, wherein the preparation method of the gold nanorods comprises the following steps: adding CTAB solution into an erlenmeyer flask, and firstly adding AgNO under the condition of stirring3Adding HAuCl into the solution4Continuously stirring the solution for 2-5 minutes, then dropwise adding ascorbic acid until the solution fades, and adding a CTAB solution and AgNO3Solution, HAuCl4And ascorbic acid in a ratio of 260-320: 0.7-0.9: 2.5-3.5: 0.2-0.4, standing for 2-3 hours to obtain the gold nanorods.
6. The use according to claim 5, wherein the CTAB solution has a concentration of 0.1-0.2 mol/L, AgNO3The concentration of the solution is 0.008-0.014 mol/L, and HAuCl4The concentration of the solution is 0.015-0.025 mol/L, and the concentration of the ascorbic acid is 0.008-0.012 mol/L.
CN201910149785.1A 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods Active CN109676128B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910149785.1A CN109676128B (en) 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910149785.1A CN109676128B (en) 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods

Publications (2)

Publication Number Publication Date
CN109676128A CN109676128A (en) 2019-04-26
CN109676128B true CN109676128B (en) 2021-05-04

Family

ID=66197329

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910149785.1A Active CN109676128B (en) 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods

Country Status (1)

Country Link
CN (1) CN109676128B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117664887B (en) * 2024-01-29 2024-04-12 云南伦扬科技有限公司 Method for rapidly detecting lead and zearalenone by using phenolic coordination polymer nano enzyme group

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101077526A (en) * 2007-06-29 2007-11-28 湖南科技大学 Adjustable plasma wave gold nano bar preparation method
CN103645315A (en) * 2013-12-18 2014-03-19 国家纳米科学中心 Platinum-based alloy structured nanorod simulation enzyme solution and application thereof in ELISA (Enzyme-Linked Immunosorbent Assay)
CN104525938A (en) * 2014-12-23 2015-04-22 国家纳米科学中心 Molybdenum disulfide/gold nanorod composite, preparation method and application
CN105543345A (en) * 2015-12-17 2016-05-04 湖南科技大学 Method and kit for detecting zearalenone
CN105713966A (en) * 2016-01-24 2016-06-29 湖南科技大学 Method for rapidly detecting zearalenone
CN205506834U (en) * 2015-09-25 2016-08-24 江苏美正生物科技有限公司 Short -term test aflatoxin B1 and zearalenone's colloidal gold test paper
CN109239064A (en) * 2018-10-26 2019-01-18 湖南科技大学 A kind of preparation method and application of cupric nanometer rods compound quick detection kit

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101077526A (en) * 2007-06-29 2007-11-28 湖南科技大学 Adjustable plasma wave gold nano bar preparation method
CN103645315A (en) * 2013-12-18 2014-03-19 国家纳米科学中心 Platinum-based alloy structured nanorod simulation enzyme solution and application thereof in ELISA (Enzyme-Linked Immunosorbent Assay)
CN104525938A (en) * 2014-12-23 2015-04-22 国家纳米科学中心 Molybdenum disulfide/gold nanorod composite, preparation method and application
CN205506834U (en) * 2015-09-25 2016-08-24 江苏美正生物科技有限公司 Short -term test aflatoxin B1 and zearalenone's colloidal gold test paper
CN105543345A (en) * 2015-12-17 2016-05-04 湖南科技大学 Method and kit for detecting zearalenone
CN105713966A (en) * 2016-01-24 2016-06-29 湖南科技大学 Method for rapidly detecting zearalenone
CN109239064A (en) * 2018-10-26 2019-01-18 湖南科技大学 A kind of preparation method and application of cupric nanometer rods compound quick detection kit

Also Published As

Publication number Publication date
CN109676128A (en) 2019-04-26

Similar Documents

Publication Publication Date Title
Zhou et al. Emerging strategies to develop sensitive AuNP-based ICTS nanosensors
Tian et al. An electrochemical dual-aptamer biosensor based on metal-organic frameworks MIL-53 decorated with Au@ Pt nanoparticles and enzymes for detection of COVID-19 nucleocapsid protein
Jia et al. Recent advances on immunosensors for mycotoxins in foods and other commodities
Wei et al. Using bimetallic Au@ Pt nanozymes as a visual tag and as an enzyme mimic in enhanced sensitive lateral-flow immunoassays: Application for the detection of streptomycin
Wan et al. Manganese oxide nanowire-mediated enzyme-linked immunosorbent assay
Huang et al. Reusable ring-like Fe3O4/Au nanozymes with enhanced peroxidase-like activities for colorimetric-SERS dual-mode sensing of biomolecules in human blood
Wei et al. A photoelectrochemical/colorimetric immunosensor for broad-spectrum detection of ochratoxins using bifunctional copper oxide nanoflowers
Ling et al. A potentiometric formaldehyde biosensor based on immobilization of alcohol oxidase on acryloxysuccinimide-modified acrylic microspheres
Sheng et al. Emerging electrochemical biosensing approaches for detection of allergen in food samples: A review
Guan et al. Colorimetric detection of cholesterol based on peroxidase mimetic activity of GoldMag nanocomposites
Li et al. SERS and fluorescence dual-mode sensing trace hemin and K+ based on G-quarplex/hemin DNAzyme catalytic amplification
Chen et al. An eco-friendly near infrared fluorescence molecularly imprinted sensor based on zeolite imidazolate framework-8 for rapid determination of trace trypsin
Shen et al. An electrochemical sandwich immunosensor based on signal amplification technique for the determination of alpha-fetoprotein
Zhao et al. Chiroplasmonic assemblies of gold nanoparticles as a novel method for sensitive detection of alpha-fetoprotein
Hong et al. Trends in the development of immunoassays for mycotoxins and food allergens using gold and carbon nanostructured material
Wu et al. Advances in gold nanoparticles for mycotoxin analysis
Chen et al. Nanobody-based label-free photoelectrochemical immunoassay for highly sensitive detection of SARS-CoV-2 spike protein
CN106018819B (en) A kind of ELISA detection method based on the nano enzyme with peroxidase activity
Li et al. A surface enhanced Raman scattering quantitative analytical platform for detection of trace Cu coupled the catalytic reaction and gold nanoparticle aggregation with label-free Victoria blue B molecular probe
CN114047341B (en) Biological probe and biological immunosensor for detecting bungarus venosus and method for detecting bungarus venosus based on proportional signal
CN109676128B (en) Preparation method and application of molybdenum trisulfide coated gold nanorods
Hou et al. The application of nanoparticles in point-of-care testing (POCT) immunoassays
CN104122215B (en) The preparation of a kind of renewable Photometric probe and application
CN105911278B (en) A kind of ELISA detection method based on the nano enzyme with catalase activity
Yao et al. On-signal amplification of silver nanosol RRS/SERS aptamer detection of ultratrace urea by polystyrene nanosphere catalyst

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant