CN109676128A - A kind of preparation method and application of four vulcanization, three molybdenums cladding gold nanorods - Google Patents

A kind of preparation method and application of four vulcanization, three molybdenums cladding gold nanorods Download PDF

Info

Publication number
CN109676128A
CN109676128A CN201910149785.1A CN201910149785A CN109676128A CN 109676128 A CN109676128 A CN 109676128A CN 201910149785 A CN201910149785 A CN 201910149785A CN 109676128 A CN109676128 A CN 109676128A
Authority
CN
China
Prior art keywords
molybdenums
gold nanorods
vulcanization
solution
zearalenone
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910149785.1A
Other languages
Chinese (zh)
Other versions
CN109676128B (en
Inventor
黄昊文
花欣怡
汪志芳
阳秀梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan University of Science and Technology
Original Assignee
Hunan University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan University of Science and Technology filed Critical Hunan University of Science and Technology
Priority to CN201910149785.1A priority Critical patent/CN109676128B/en
Publication of CN109676128A publication Critical patent/CN109676128A/en
Application granted granted Critical
Publication of CN109676128B publication Critical patent/CN109676128B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F1/00—Metallic powder; Treatment of metallic powder, e.g. to facilitate working or to improve properties
    • B22F1/16—Metallic particles coated with a non-metal
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F1/00—Metallic powder; Treatment of metallic powder, e.g. to facilitate working or to improve properties
    • B22F1/05—Metallic powder characterised by the size or surface area of the particles
    • B22F1/054—Nanosized particles
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B22—CASTING; POWDER METALLURGY
    • B22F—WORKING METALLIC POWDER; MANUFACTURE OF ARTICLES FROM METALLIC POWDER; MAKING METALLIC POWDER; APPARATUS OR DEVICES SPECIALLY ADAPTED FOR METALLIC POWDER
    • B22F9/00—Making metallic powder or suspensions thereof
    • B22F9/16—Making metallic powder or suspensions thereof using chemical processes
    • B22F9/18—Making metallic powder or suspensions thereof using chemical processes with reduction of metal compounds
    • B22F9/24—Making metallic powder or suspensions thereof using chemical processes with reduction of metal compounds starting from liquid metal compounds, e.g. solutions
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y40/00—Manufacture or treatment of nanostructures
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
    • G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry

Landscapes

  • Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Engineering & Computer Science (AREA)
  • Nanotechnology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • General Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Manufacturing & Machinery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Inorganic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of preparation method and applications based on four vulcanization three molybdenums cladding gold nanorods.Preparation method is gold nanorods and hypo solution, molybdenum pentachloride solution reaction 4~8 hours, is obtained with Mimetic Peroxidase active four vulcanization three molybdenums cladding gold nanorods.Gained four vulcanizes the content that three molybdenums cladding gold nanorods analogue enztme is applied to detection mycotoxin zearalenone.The characteristic of hydrogen peroxide is catalytically decomposed using four vulcanization three molybdenums cladding gold nanorods by the present invention, specific binding according to antigen and antibody again, zearalenone is coated into the zearalenone aptamers specific effect of gold nanorods with four three molybdenums of vulcanization have been modified, and then achievees the purpose that detect zearalenone；The present invention detects zearalenone using four vulcanization three molybdenums cladding gold nanorods, and high sensitivity, phenomenon is obvious, easy to operate, can effectively and accurately measure the concentration of zearalenone in crop.

Description

A kind of preparation method and application of four vulcanization, three molybdenums cladding gold nanorods
Technical field
The invention belongs to chemical-biological sensing and technical field of biological, and in particular to one kind is based on four three molybdenums of vulcanization Coat the preparation method and application of gold nanorods.
Background technique
Enzyme be to vital movement it is indispensable, many reactions of human body require enzyme catalysis carry out, it can be reduced Activation energy is chemically reacted, chemical reaction rate, control chemical reaction degree etc. are accelerated.Native enzyme is a kind of by raw in organism Produce, and with high efficiency, specificity, diversity, the protein that the properties such as specific reaction can be generated with substrate, nucleic acid or its Complex is widely used in food, industrial or agricultural, medical numerous areas.But there is also many shortcomings for native enzyme.Such as External environment condition (strong acid, highly basic, high temperature) is to the sensitivity effects of catalytic activity, stability is poor, mutability inactivation, difficulty mention It is pure, it is not easy the problems such as storing and is expensive.Thus, it is found that and preparing, there is the enzyme of low-cost high-efficiency benefit to need researcher Carry out in-depth study.At the same time, analogue enztme comes into being.Analogue enztme is a kind of artificial synthesized non-proteinaceous molecule, tool There is the features such as structure is simple, chemical property is stable, cheap and easy to get.
Nanometer analogue enztme is the special performance of a kind of existing nano material, and has the analogue enztme of catalysis.Nanometer simulation Enzyme itself is a kind of nano material, such as specific surface height, has the physicochemical properties such as special light, electricity, magnetic.Exactly these are unique Property, nano material analogue enztme bio-sensing, it is biomedical with imaging in terms of etc. fields show advantageous advantage. Gold nanorods are a kind of bar-shaped gold nano grain of scale from several nanometers to up to a hundred nanometers, and the surface plasma of gold nanorods is total Vibration wave length can change with its length-width ratio, be continuously adjusted from 550nm to 1550nm.By gold nanorods and sodium thiosulfate and phosphoric Molybdenum preparation four vulcanization three molybdenums cladding gold nanorods remain gold nanorods chemically and physically characteristic while also have peroxide Compound enzymatic property.It is anti-using the Mimetic Peroxidase property and antigen and antibody specific of four vulcanization three molybdenums cladding gold nanorods It answers, can be used for detecting zearalenone, enterotoxin, vomiting mycin etc., contribute for food safety.
Zearalenone (Zearalenone) is also known as F-2 toxin, mainly pollutes corn, wheat, rice, barley, millet It is the metabolite of Gibberella zeae bacterium with the cereal such as oat.
Zearalenone has estrogen action, mainly acts on reproductive system, can make domestic animal, poultry and experiment mice Generate the hyperfunction disease of estrogen.Gravidic animal (including people), which eats the food containing zearalenone, can cause miscarriage, stillborn foetus And monster.The wheaten food of the edible production of flour containing Gibberella saubinetii can also cause the poisoning symptom of central nervous system, such as nausea, hair Cold, headache, mind depression and incoordination etc..These substances once enter human body, can make one poisoning and at present to animal corn Zeranol poisoning there is no specific drug to treat.Food poisoning is a global public health problem, is either pass by or existing In flourishing industrialized country and developing country, is poisoning by food and all often occurring.The etesian such poisoning thing in China Part is also very more, and there are report in all parts of the country, is the disease of prevention and control of diseases department emphasis monitoring.It is a large amount of it turns out that, Food-safety problem seriously affects people's lives, and urgent need is established a kind of hypersensitivity for zearalenone and quickly divided Analysis method.
Research shows that four vulcanization three molybdenums cladding gold nanorods have certain catalytic capability, Jenner is coated in four three molybdenums of vulcanization In the presence of rice stick, H2O2It is decomposed by quick catalysis, hydrogen peroxide generates hydroxyl radical free radical, hydroxyl radical free radical oxidation by catalytic decomposition Different colors is presented in the oxidation state TMB of TMB, various concentration.Based on this, we establish a kind of new method of bimodulus detection, both Visualization half-quantitative detection carried out to determinand using color change, and can be by the size of absorbance to the standard of determinand True content carries out quantitative detection.
Summary of the invention
The purpose of the present invention is to provide one kind four to vulcanize the preparation method and application that three molybdenums coat gold nanorods analogue enztme, Preparation is simple, easy to operate, adapts to universal.
The purpose of the present invention is to achieve the following:
It is a kind of four vulcanization three molybdenums cladding gold nanorods analogue enztme preparation method, which is characterized in that gold nanorods with it is thio Metabisulfite solution, molybdenum pentachloride solution reaction 4~8 hours are obtained with Mimetic Peroxidase three molybdenum packets of active four vulcanization Cover gold nanorods.
Further, gold nanorods the preparation method comprises the following steps: into conical flask be added CTAB solution, under agitation first plus Enter AgNO3Solution adds HAuCl4Solution, continues stirring 2~5 minutes, and ascorbic acid is then added dropwise until solution takes off Color, CTAB solution, AgNO3Solution, HAuCl4And the ratio between amount of substance of ascorbic acid is 260-320:0.7-0.9:2.5-3.5: 0.2-0.4 stands 2~3 hours up to gold nanorods.
Further, the concentration of CTAB solution is 0.1~0.2mol/L, AgNO3The concentration of solution be 0.008~ 0.014mol/L, HAuCl4The concentration of solution is 0.015~0.025mol/L, the concentration of ascorbic acid is 0.008~ 0.012mol/L。
Further, gold nanorods, hypo solution and molybdenum pentachloride solution sequentially add, and the volume ratio of three is 4~6:0.01~0.03:0.03~0.05, the concentration of hypo solution are 0.08~0.12mol/L, molybdenum pentachloride solution Concentration be 0.08~0.12mol/L, it is worth noting that, meeting quantitative relation in sodium thiosulfate and molybdenum pentachloride is 1:1 On the basis of the more i.e. molybdenum pentachlorides of the molybdenum pentachloride amount that is added it is excessive more, four three molybdenum clads of vulcanization are thicker.
The four vulcanization three molybdenums cladding gold nanorods analogue enztmes that above-mentioned preparation method obtains are applied to detection mycotoxin corn The content of zeranol.
Further, application specifically: first vulcanize three molybdenums cladding gold nanorods by golden sulfide linkage for four and have sulfydryl Zearalenone DNA aptamers, that is, ZEN-aptamer is connected, then according to ZEN-aptamer and zearalenone Specific binding is added zearalenone into the four vulcanization three molybdenums cladding gold nanorods for being connected to ZEN-aptamer, reacts 15~30 minutes, then hydrogen peroxide, 3,3', 5,5'- tetramethyl benzidines, that is, TMB solution, according to Gibberella zeae are added into system The concentration of ketenes is different, and it is different to cover the area that golden stick-four vulcanizes three molybdenums, causes the TMB (Ox-TMB) for generating oxidation state to be in Existing color is different, further according to the relationship of the Ox-TMB absorbance value at wavelength 652nm and zearalenone concentration, thus The content of zearalenone in sample to be tested is calculated.
Further, ZEN-aptamer base sequence are as follows:
5’-GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAACTTAGTAGGA TCCCGAA-3’。
Further, three molybdenums of the vulcanization of ZEN-aptamer and four cladding gold nanorods are added with the volume ratio of 4.9~5.2:4, Reaction 8~12 hours uses revolving speed to be centrifuged 8~15min gained for 10000~12000r/min.
Further, in TMB development step, the hydrogen peroxide concentration of addition is 80~120mmol/L, TMB concentration is 3~ 7mmol/L, the volume ratio of two kinds of solution are 1:1.
The beneficial effects of the present invention are:
The characteristic of hydrogen peroxide is catalytically decomposed using four vulcanization three molybdenums cladding gold nanorods by the present invention, then according to antigen and antibody Specific binding, by zearalenone with modified four vulcanization three molybdenums cladding gold nanorods zearalenone aptamers Specific effect, and then achieve the purpose that detect zearalenone；The present invention is using four vulcanization three molybdenums cladding gold nanorods inspections Zearalenone is surveyed, high sensitivity, phenomenon is obvious, and it is easy to operate, it can effectively and accurately measure zearalenone in crop Concentration.
It is highly sensitive technology that the present invention, which detects zearalenone, it can rapidly and accurately zearalenone, make four Vulcanize three molybdenums cladding gold nanorods successfully replace traditional Enzyme-linked Immunosorbent Assay react in biological enzyme.Gold nanorods, price, Stability etc. has the advantages that biological enzyme macromolecular is incomparable, it is often more important that, four three molybdenum gold nanorods of vulcanization are not deposited The problem of losing bioactivity is easy in bio protease.On the other hand, it introduces under TMB different conditions and shows different colours, Visual retrieval is established, in addition, for this detection method to provide high detection sensitive for the high extinction coefficient of gold nanoparticle Degree, compared with traditional enzyme-linked adsorption method, significantly improves the sensitivity and stability of detection.
It handles by means of the present invention, the TMB solution of different colours can be obtained, the color change of this nano particle can Regulated and controled according to the concentration of hydrogen peroxide, the ultra trace to zearalenone has been reached by the variation of color or absorbance value Detection, compared with prior art, the method for the present invention is simple, and at low cost, high sensitivity can be realized and fast and accurately detect, and And all there is highly important reference to be worth the detection of other large biological molecules and disease, before very wide application Scape.
Detailed description of the invention
Fig. 1 is the TEM figure that gold nanorods and four three molybdenums of vulcanization coat gold nanorods, wherein a is gold nanorods, and b is four sulphur Change three molybdenums cladding gold nanorods.
Fig. 2 is the ultraviolet-visible absorption spectroscopy figure of gold nanorods, four vulcanization three molybdenums cladding gold nanorods.
Fig. 3 is the XRD diagram that four three molybdenums of vulcanization coat gold nanorods.
Fig. 4 is the colour developing picture verified four vulcanization three molybdenums cladding gold nanorods and have Mimetic Peroxidase property.
Fig. 5 is under condition of different pH, and four vulcanization three molybdenums cladding gold nanorods catalysis hydrogen peroxide, which generate hydroxyl radical free radical, to be made TMB is oxidized change indigo plant, absorbance line chart of the Ox-TMB at 652nm.
Color change figure when Fig. 6 is detection of the embodiment of the present invention to zearalenone standard solution.
Fig. 7 is the linear equation of zearalenone concentration and the TMB absorbance at 652nm.
Fig. 8 is synthetic sample colour developing figure.
Specific embodiment
Following embodiment is intended to illustrate invention rather than limitation of the invention further.
Embodiment 1
The preparation of four vulcanization three molybdenums cladding gold nanorods
5mL gold nanorods are taken, 0.1mmol/L Na is first added2S2O320 μ L, add 0.1mmol/L Mocl540 μ L, Reaction 6 hours uses revolving speed to be centrifuged 10min for 10000r/min, coats gold nano with secondary water dispersion to get four three molybdenums of vulcanization Stick, form as shown in Figure 1, completely remain the form of gold nanorods and form one layer of shell-like structure on golden stick surface, And longitudinal plasma absorption peak blue shift of gold nanorods is compared at longitudinal plasma absorption peak of the compound, as shown in Fig. 2, This is because four three molybdenums of vulcanization change the refractive index on golden stick surface with golden stick effect, spread out in conjunction with the powder crystal of Fig. 3 It penetrates as a result, showing that four vulcanizations, three molybdenum is to be coated on gold nanorods surface with crystal form.Show that four vulcanizations, three molybdenum coats shown in Fig. 4 Gold nanorods can be catalyzed hydrogen peroxide oxidation TMB and become blue, that is, demonstrate,proving four vulcanization three molybdenums cladding gold nanorods has Mimetic Peroxidase Property, and catalytic is most strong under the conditions of pH=6, as shown in Figure 5.
Embodiment 2
Four vulcanization three molybdenums cladding gold nanorods Mimetic Peroxidase properties are used for the detection of zearalenone:
300 μ L tetra- are added in centrifuge tube first and vulcanize three molybdenums cladding gold nanorods, add 500 μ L 1.0 × 10-13μ The DNA aptamers ZEN-aptamer of mol/L zearalenone after connecting ZEN-aptamer, is rushed with the PBS of 0.01mol/L It washes three times, adds various concentration zearalenone solution, react 20 minutes, after being flushed three times with secondary distilled water, be added The hydrogen peroxide solution that concentration is 50mmol/L reacts 30 minutes, adds the TMB solution that concentration is 5mmol/L.After 30 minutes, Color change has added 0,10 as shown in fig. 6, being followed successively by from left to right in figure-7、10-6、10-5、10-4、10-3、10-2The jade of mmol/L Zearlenone, as seen from the figure, zearalenone concentration are higher, and TMB colour developing is more shallow.Existed according to the oxidation state TMB of colour developing Relationship between absorbance at 652nm and zearalenone concentration can get the good standard curve of linear relationship, such as Fig. 7 It is shown, the content of zearalenone in unknown sample can be calculated according to linear equation.
Above-mentioned base sequence is ZEN-aptamer
5’-GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAAC TTAGTAGGATCCCGAA-3’。
Sample treatment and determination of recovery rates
Corn 1.0g, the rice 0.5g bought from supermarket is weighed, is respectively placed in centrifuge tube, is separately added into 4mL 10ng/ ML, 5ng/mL zearalenone solution, ultrasound 20 minutes, centrifugation take supernatant again within 3 hours for mixing.
In 12 centrifuge tubes, each be added makees make good use of four vulcanization three molybdenums cladding gold nanorods, Xiang Qi with ZEN-aptamer In 500 μ L are separately added into 6 centrifuge tubes through corn and the processed zearalenone solution of rice, every kind of corn and rice Respectively it is one group, totally two groups, every group 3, after reacting 30 minutes, is separately added into 500 μ L 10ng/ in remaining 6 centrifuge tubes again ML, 500 μ L 5ng/mL zearalenone standard solution react 30 minutes.Finally, this 18 centrifuge tubes are separately added into 100 μL50mmol/L H2O2With 100 μ L 5mmol/L TMB, after twenty minutes TMB colour developing it is basicly stable, as shown in figure 8, survey its Absorbance at 652nm can acquire corresponding zearalenone concentration according to standard curve.By calculating, corn, rice The rate of recovery be 101.2%, 99.21% respectively, show that this detection method systematic error is small, accuracy is high.

Claims (9)

1. the preparation method that one kind four vulcanizes three molybdenums cladding gold nanorods analogue enztme, which is characterized in that gold nanorods and thio sulphur Acid sodium solution, molybdenum pentachloride solution reaction 4~8 hours are obtained with Mimetic Peroxidase active four vulcanization three molybdenums cladding Gold nanorods.
2. the preparation method of four vulcanization according to claim 1, three molybdenums cladding gold nanorods analogue enztme, which is characterized in that gold Nanometer rods the preparation method comprises the following steps: into conical flask be added CTAB solution, AgNO is first added under agitation3Solution adds HAuCl4Solution, continues stirring 2~5 minutes, and ascorbic acid is then added dropwise until solution decolourization, CTAB solution, AgNO3It is molten Liquid, HAuCl4And the ratio between amount of substance of ascorbic acid is 260-320:0.7-0.9:2.5-3.5:0.2-0.4, and it is small to stand 2~3 When up to gold nanorods.
3. the preparation method of four vulcanization according to claim 1, three molybdenums cladding gold nanorods analogue enztme, which is characterized in that The concentration of CTAB solution is 0.1~0.2mol/L, AgNO3The concentration of solution is 0.008~0.014mol/L, HAuCl4Solution Concentration is 0.015~0.025mol/L, and the concentration of ascorbic acid is 0.008~0.012mol/L.
4. the preparation method of four vulcanization according to claim 1, three molybdenums cladding gold nanorods analogue enztme, which is characterized in that gold Nanometer rods, hypo solution and molybdenum pentachloride solution sequentially add, and the volume ratio of three is 4~6:0.01~0.03: 0.03~0.05, the concentration of hypo solution is 0.08~0.12mol/L, the concentration of molybdenum pentachloride solution is 0.08~ 0.12mol/L。
5. the four vulcanization three molybdenums cladding gold nanorods analogue enztmes that the described in any item preparation methods of Claims 1-4 obtain are being examined Survey the application in the content of mycotoxin zearalenone.
6. application according to claim 5, which is characterized in that the application, specifically: first by four vulcanization three molybdenums claddings Gold nanorods are connected by golden sulfide linkage with the zearalenone DNA aptamers, that is, ZEN-aptamer for having sulfydryl, then according to According to the specific binding of ZEN-aptamer and zearalenone, to the four vulcanization three molybdenums cladding gold for being connected to ZEN-aptamer Zearalenone is added in nanometer rods, reacts 15~30 minutes, then hydrogen peroxide, 3,3', 5,5'- tetramethyls are added into system Benzidine, that is, TMB solution, different according to the concentration of zearalenone, the area for covering three molybdenums of the golden vulcanization of stick-four is different, leads The color for causing the TMB, that is, Ox-TMB for generating oxidation state to present is different, further according to absorbance value of the Ox-TMB wavelength 652nm at and The relationship of zearalenone concentration, so that the content of zearalenone in sample to be tested be calculated.
7. application according to claim 6, which is characterized in that ZEN-aptamer base sequence are as follows:
5’-GGAATTCTTGATGTTGCCTGGGATTGTTTGGGCCTTGTGTTTTCTTCCGTTCCAACTTAGTAGGATCCC GAA-3’。
8. application according to claim 6, which is characterized in that three molybdenums of vulcanization of ZEN-aptamer and four coat gold nanorods Be added, reacted 8~12 hours with the volume ratio of 4.9~5.2:4, use revolving speed be 10000~12000r/min be centrifuged 8~ Obtained by 15min.
9. application according to claim 6, which is characterized in that in TMB development step, the hydrogen peroxide concentration of addition is 80~ 120mmol/L, TMB concentration are 3~7mmol/L, and the volume ratio of two kinds of solution is 1:1.
CN201910149785.1A 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods Active CN109676128B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910149785.1A CN109676128B (en) 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910149785.1A CN109676128B (en) 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods

Publications (2)

Publication Number Publication Date
CN109676128A true CN109676128A (en) 2019-04-26
CN109676128B CN109676128B (en) 2021-05-04

Family

ID=66197329

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910149785.1A Active CN109676128B (en) 2019-02-28 2019-02-28 Preparation method and application of molybdenum trisulfide coated gold nanorods

Country Status (1)

Country Link
CN (1) CN109676128B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117664887A (en) * 2024-01-29 2024-03-08 云南伦扬科技有限公司 Method for rapidly detecting lead and zearalenone by using phenolic coordination polymer nano enzyme group

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101077526A (en) * 2007-06-29 2007-11-28 湖南科技大学 Adjustable plasma wave gold nano bar preparation method
CN103645315A (en) * 2013-12-18 2014-03-19 国家纳米科学中心 Platinum-based alloy structured nanorod simulation enzyme solution and application thereof in ELISA (Enzyme-Linked Immunosorbent Assay)
CN104525938A (en) * 2014-12-23 2015-04-22 国家纳米科学中心 Molybdenum disulfide/gold nanorod composite, preparation method and application
CN105543345A (en) * 2015-12-17 2016-05-04 湖南科技大学 Method and kit for detecting zearalenone
CN105713966A (en) * 2016-01-24 2016-06-29 湖南科技大学 Method for rapidly detecting zearalenone
CN205506834U (en) * 2015-09-25 2016-08-24 江苏美正生物科技有限公司 Short -term test aflatoxin B1 and zearalenone's colloidal gold test paper
CN109239064A (en) * 2018-10-26 2019-01-18 湖南科技大学 A kind of preparation method and application of cupric nanometer rods compound quick detection kit

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101077526A (en) * 2007-06-29 2007-11-28 湖南科技大学 Adjustable plasma wave gold nano bar preparation method
CN103645315A (en) * 2013-12-18 2014-03-19 国家纳米科学中心 Platinum-based alloy structured nanorod simulation enzyme solution and application thereof in ELISA (Enzyme-Linked Immunosorbent Assay)
CN104525938A (en) * 2014-12-23 2015-04-22 国家纳米科学中心 Molybdenum disulfide/gold nanorod composite, preparation method and application
CN205506834U (en) * 2015-09-25 2016-08-24 江苏美正生物科技有限公司 Short -term test aflatoxin B1 and zearalenone's colloidal gold test paper
CN105543345A (en) * 2015-12-17 2016-05-04 湖南科技大学 Method and kit for detecting zearalenone
CN105713966A (en) * 2016-01-24 2016-06-29 湖南科技大学 Method for rapidly detecting zearalenone
CN109239064A (en) * 2018-10-26 2019-01-18 湖南科技大学 A kind of preparation method and application of cupric nanometer rods compound quick detection kit

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117664887A (en) * 2024-01-29 2024-03-08 云南伦扬科技有限公司 Method for rapidly detecting lead and zearalenone by using phenolic coordination polymer nano enzyme group
CN117664887B (en) * 2024-01-29 2024-04-12 云南伦扬科技有限公司 Method for rapidly detecting lead and zearalenone by using phenolic coordination polymer nano enzyme group

Also Published As

Publication number Publication date
CN109676128B (en) 2021-05-04

Similar Documents

Publication Publication Date Title
Weerathunge et al. Ultrasensitive colorimetric detection of murine norovirus using NanoZyme aptasensor
Chen et al. Fluorescent nanobiosensors for sensing glucose
Ling et al. A potentiometric formaldehyde biosensor based on immobilization of alcohol oxidase on acryloxysuccinimide-modified acrylic microspheres
Rai et al. Emerging nanotechnology for detection of mycotoxins in food and feed
Gerdan et al. Recent advances of optical sensors for copper ion detection
Ni et al. Enhanced performance of an electrochemical aptasensor for real-time detection of vascular endothelial growth factor (VEGF) by nanofabrication and ratiometric measurement
Arshad et al. Nanozyme-based sensors for detection of food biomarkers: a review
Yan et al. Recent advances in aflatoxins detection based on nanomaterials
Duong et al. Development of a ratiometric fluorescent glucose sensor using an oxygen-sensing membrane immobilized with glucose oxidase for the detection of glucose in tears
Chen et al. Nanobody-based label-free photoelectrochemical immunoassay for highly sensitive detection of SARS-CoV-2 spike protein
CN104122215B (en) The preparation of a kind of renewable Photometric probe and application
Zare-Shehneh et al. Recent advances in carbon nanostructure-based electrochemical biosensors for environmental monitoring
Duong et al. Ratiometric fluorescent biosensors for glucose and lactate using an oxygen-sensing membrane
Zhang et al. A sandwich-type electrochemical immunosensor using trimetallic nanozyme as signal amplification for NT-proBNP sensitive detection
Qileng et al. Machine learning: Assisted multivariate detection and visual image matching to build broad-specificity immunosensor
Majer-Baranyi et al. Biosensors for deoxynivalenol and zearalenone determination in feed quality control
Silva et al. A label and probe-free zika virus immunosensor prussian blue@ carbon nanotube-based for amperometric detection of the ns2b protein
CN109676128A (en) A kind of preparation method and application of four vulcanization, three molybdenums cladding gold nanorods
Fu et al. An analytical method based on electrochemical sensor for the assessment of insect infestation in flour
Li et al. Gold nanoparticles-based dual-channel colorimetric array sensors for discrimination of metal ions
Yao et al. On-signal amplification of silver nanosol RRS/SERS aptamer detection of ultratrace urea by polystyrene nanosphere catalyst
CN104148626B (en) Calixarene and functionalized gold nano grain and preparation method thereof
Ni et al. Research progress of sensors based on molecularly imprinted polymers in analytical and biomedical analysis
Xu et al. Electrochemical immunosensor based on antibody-oriented probe for the detection of AFB1 in rice bran oil
Zhao et al. Ultrasensitive photoelectrochemical immunoassay strategy based on Bi2S3/Ag2S for the detection of the inflammation marker procalcitonin

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant