CN109666754A - Taqman-MGB detection method of the Plasmopara viticola to carboxylic acyloxy amine fungicide resistance - Google Patents
Taqman-MGB detection method of the Plasmopara viticola to carboxylic acyloxy amine fungicide resistance Download PDFInfo
- Publication number
- CN109666754A CN109666754A CN201811413582.0A CN201811413582A CN109666754A CN 109666754 A CN109666754 A CN 109666754A CN 201811413582 A CN201811413582 A CN 201811413582A CN 109666754 A CN109666754 A CN 109666754A
- Authority
- CN
- China
- Prior art keywords
- carboxylic acyloxy
- resistance
- taqman
- plasmopara viticola
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the 1105th coding mutation detection method of 3 gene of Plasmopara viticola cellulose synthase and its application in carboxylic acyloxy amine fungicide resistance monitoring, the primer pair and probe sequence for detecting the mutational site are specifically disclosed.Fluorescence PCR is carried out by the primer and probe of design, and a step can judge that the bacterial strain to the sensibility of carboxylic acyloxy amine fungicide, and can distinguish the heterozygosis of sensitive strain and homozygous.The molecular diagnosis method that detection Pseudoperonospora cubensis provided by the invention develops drug resistance to carboxylic acyloxy amine medicament, high sensitivity, stability are good, detection cycle is short, it can be used for high-throughout monitoring field Plasmopara viticola to the resistance generation of carboxylic acyloxy amine medicament, development, it realizes early warning of the Pseudoperonospora cubensis to carboxylic acyloxy amine drug resistance, is of great significance to the development for timely and effectively controlling Plasmopara viticola drug resistance.
Description
(1) technical field
" Taqman-MGB detection method of the Plasmopara viticola to carboxylic acyloxy amine fungicide resistance " of the invention, it is dedicated
Cause P. viticola to carboxylic acyloxy amine fungicide resistance in detection, belong to liquefaction resistance technical field, is examined with molecule
Survey technology is related.
(2) background technique
Plasmopara viticola [Plasmopara Viticola (Berk et Curtis) Ber.et de Toni] belongs to ovum
Bacterium door grape Plasmopara, is a kind of obligate parasite.It is to endanger the weight of grape in the world by the microbial downy mildew of garpe
Major disease, the disease are epidemic diseases, are almost present in all grape production gardens in China, seriously affect China's grape industry
Development.For gas transmissibility epidemic disease, chemical prevention is one of means mostly important in disease prevention and control.However, with
Continuous, the frequent use of fungicide, P. viticola drug resistance gradually generate, and fungicide preventive effect is caused to decline.The inspection of drug resistance
It surveys and lays the foundation for the prevention and treatment of downy mildew, provide scientific basis for the reasonable employment of pesticide.
Carboxylic acyloxy amine fungicide (CAA) is one of the primary chemical medicament for preventing and treating downy mildew, is that one kind acts on fiber
The chemical pesticide, including dimethomorph, flumorph in single target site etc. of plain synthase 3 (CesA3).It is put into from the eighties in last century
Since market, successively the states such as France, Italy have found dimethomorph resistant strain (Gisi et al., 2007；Wong et
Al., 2000；You et al., 2008)；China detect for the first time within 2017 resistant strain presence (Zhang et al.,
2017).2010, the discovery such as Blum, drug resistance and its Cellulose-synthase gene of the Plasmopara viticola to dimethomorph
Homozygous mutation of the PvCesA3 at 1105 is related (Blum et al., 2010).
Plasmopara viticola generallys use leaf disk method (Wong et al., 2000) the Resistance detecting method of fungicide, but
This method the disadvantages of there are detection cycle length, low efficiency, poor heavy workload and stability.P. viticola is as a kind of obligate
Bacterial parasite, condition of culture is more harsh, therefore with its fastness frequency of traditional technique in measuring, both expended the time and its result vulnerable to
The influence of condition of culture and pharmacy quality.Therefore, with the further investigation to pathogen drug resistance mechanism, a large amount of Molecular Detection skills
Art gradually developed (Aoki et al., 2011；Aoki et al., 2013；Zhang et al., 2017).2017,
Zhang etc. establishes corresponding Tetra-primers ARMS PCR detection technique according to the mutational site PvCesA3G1105, should
Technology can fast and accurately distinguish the homozygote and heterozygote gene of resistant strain, sensitive strain in a reaction.But by
In using two pairs of primers in same reaction, there are certain mismatch rate and false positives.
TaqMan fluorescence probe is a kind of oligonucleotide probe, and 5 ' ends connect fluorophor, and 3 ' ends, which are connected with, to be quenched
Group.When probe is complete, unstressed configuration is accumulated；When PCR reacts progress, probe is because by 5 ' -3 ' 5 prime excision enzyme activity enzyme of Taq enzyme
It cuts and degrades and lost integrity, reporter group and quenching group is caused to separate, fluorescent molecule is accumulated with the amplification of DNA chain,
To realize signal accumulation formed with product it is synchronous.TaqMan-MGB probe for real-time fluorescence PCR detection technique is Taqman
Technology advanced optimizes, which will can be connected to by quenching group with the MGB molecule of DNA minor groove binding, visits Taqman
The combination of needle and complementary DNA double-strand is more special, can be identified (Francisco et to the variation of base single in DNA chain
Al., 2005), there is preferable specificity, repeatability and sensitivity, it is easy to operate, as a result accurately.
(3) summary of the invention
Technical problem the purpose of the present invention is design can in specificity identification Plasmopara viticola group dimethomorph it is anti-
The primer and probe of property bacterial strain, establishes fast and accurate dimethomorph liquefaction resistance method.
The present invention is implemented as follows: its cellulose synthase 3 after being developed drug resistance based on P. viticola to dimethomorph
The principle that base replacement occurs at 1105th site of gene, designs the primer (Cesa3F/Cesa3R) and probe of specificity
(Cesa3pR/Cesa3pS) mutational site is detected, to realize Plasmopara viticola to dimethomorph fastness frequency
Fast and efficiently detect.
Technical solution
Taqman-MGB PCR method for Plasmopara viticola dimethomorph liquefaction resistance, comprising:
1) strains tested
Plasmopara viticola dimethomorph resistant strain YQ and sensitive strain PV are for establishing Taqman round pcr.
2) DNA is extracted
Use OMEGA'sFungal genomic DNA extracts kit (D1090-02) carries out mentioning for bacterial strain DNA
It takes.
3) design primer
After being developed drug resistance according to P. viticola to dimethomorph, the 1105th of Cellulose-synthase gene PvCesA3 the
The principle (Blum et al., 2010) that base replacement can occur at codon devises amplification and includes the mutational site segment
Pair of primers, i.e. Cesa3F/Cesa3R, and a pair of Taqman-MGB probe Cesa3pR/Cesa3pS (table 1).
1 primer of table and probe sequence
4) foundation of Taqman-MGB PCR detection technique
According to the primer of design, establishes Taqman-MGB technology reaction system and optimize, PCR reaction system (20 μ L),
The reaction solution of respective volume is added in PCR pipe:
PCR reaction condition is as follows:
5) verifying of Taqman-MGB PCR
The testing result of Taqman-MGB PCR is further verified using direct Sequencing and traditional leaf disk method.
A. sequence verification
Include 3 gene of cellulose synthase in the mutational site G1105 using standard PCR amplification, amplified fragments are sequenced.Tool
The amplimer of body, reaction system and program are as follows:
Primer sequence: PVcesa3F, sequence 5 ' -3 ': CCGATTTACGCTCGTGGTACCA；PVcesa3R, sequence 5 '-
3 ': CTACGTCACAGTCGTGGCAGCA
PCR reaction system (20 μ L):
PCR reaction condition:
B. leaf disk method is verified
Identifying concentration (Sun et al., 2010) using the dimethomorph of 1.6 μ g/ml as drug resistance, to carry out leaf disk method real
It tests.The above-mentioned dimethomorph solution of 20ml is added in each 9cm culture dish, the leaf dish that 15 diameters are 15mm is placed, with clear
Water compares.The water droplet of 20 μ L is instilled in leaf dish center, mycelia is linked into water droplet, is placed in 21 DEG C, relative humidity 100%
Incubator in dark processing for 24 hours；The liquid for being inoculated with leaf dish excess surface is sopped up with the filter paper of sterilizing；It is put in relatively wet
Degree is 100%, and temperature is 21 DEG C, is cultivated in the illumination box that illumination condition is L//D=16h//8h.Each processing three
A repetition.The upgrowth situation of bacterial strain is observed after 7d.
6) sensitivity determination of Taqman-MGB PCR
Template is used as after diluting the DNA of resistant strain YQ and sensitive strain PV respectively using gradient dilution method, in use
The Taqman round pcr for stating foundation carries out the detection of sensitivity.
Beneficial effect
The present invention devises drawing for a pair of of specificity according to the principle that Plasmopara viticola generates dimethomorph drug resistance
Object and probe are only reacted by single PCR, can simply, quickly and reliably identify resistant strain.With domestic and international similar side
Method is compared, and the present invention has technical advantage below:
1) simple and convenient for operation, efficient；
2) sensitivity is higher, high specificity, and false positive is low；
3) at low cost；This method DNA is extracted and PCR agents useful for same is conventional reagent, cheap.
Therefore this method is practical, can meet the needs of field bacterial strain liquefaction resistance.
(4) Detailed description of the invention
The Taqman PCR amplification result of Fig. 1 dimethomorph resistance allele, sensitive alleles and heterozygous genes.
(A) resistance allele；(B) sensitive alleles；(C) heterozygous genes.
Testing result of Fig. 2 Taqman-MGB technology to dilution the dimethomorph resistance and sensitive strain of 10 times of gradients.(A)
The amplification of resistant strain difference DNA concentration: 1. 12.6ng；2. 1.26ng；3. 0.126ng；4. 0.0126ng；
5.ddH2O positive control；(B) amplification of sensitive strain difference DNA concentration: 1. 205ng；2. 20.5ng；3.
2.05ng；4. 0.205ng；5. 0.0205ng；6. 0.00205ng；7.ddH2O positive control.
(5) specific embodiment
Have detected that pick up from 2227 plants of Plasmopara viticolas of the 8 grape main producing regions in China anti-to dimethomorph using this method
Property it is horizontal.
1) collection of bacterial strain
Collect the verifying for picking up from 50 plants of the Plasmopara viticola progress Taqman technologies in China, Wei County, Hebei；In addition Portugal is acquired
The main cultivation of grape regional Shanxi Province Qingxu County, Yunnan Province Binchuan County and Yongren County, Hubei Province Gongan County, Hebei province Wei County, Shandong Province are fluffy
The downy mildew sample of Lai Shi, Hunan Province's Huaihua City ground after moisturizing culture, carry out single sporangiophore separation, expand on fresh grape leave
After numerous, mycelia is collected, is saved in -80 DEG C.
2) DNA is extracted
With reference to Xin etc. (2013) method carry out DNA rapidly extracting, the specific steps are as follows: a. sterilize toothpick or
Person's dissecting needle is placed in PCR pipe in the blade disease portion suitable downy mildew of garpe mycelia of picking, and is numbered；B. to each PCR
It is each in pipe that 50 μ L Buffer solution As are added, mycelia is all submerged in solution；C., the PCR pipe of Buffer solution A will be housed
It is placed in 95 DEG C of incubation 10min in PCR instrument；D. 50 μ L Buffer B solutions are added after PCR pipe being taken out, are put in whirlpool oscillator
On gently oscillation mix, which then contains P. viticola genomic DNA, solution is placed under 12000rpm and is centrifuged 15min,
Its supernatant is then used as the template in quantitative fluorescent PCR reaction.
3) design, synthetic primer primer and probe and establish Taqman reaction technology system
Corresponding specificity amplification primer is designed and synthesized according to the mutational site Pseudoperonospora cubensis PVcesa3R gene G1105
Cesa3F/Cesa3R (Cesa3F:GCACAAACACGACAATGTAGACAA；Cesa3R:CGGCTGCTACCTTTACGGCAAA)；
Devise a pair of of Taqman-MGB probe Cesa3pR/Cesa3pS also according to the mutational site, respectively using FAM and VIC as
Report bioluminescence gene (Cesa3pR:FAM-AGCAACGAGCTGAA-MGB；Cesa3pS:VIC-CAGCAACGAGCCGA-MGB)；
Shanghai Sheng Gong bioengineering Co., Ltd is transferred to synthesize above-mentioned sequence.
Respectively using the hybrid dna of the DNA and the two of dimethomorph resistant strain YQ and sensitive strain PV as template, successively
The reaction solution of respective volume is added in PCR pipe:
By following reaction condition at 7500 fluorescence quantitative PCR instrument of ABI (Applied Biosystems, Carlsbad, CA)
Middle progress:
Amplification was as shown in Figure 1, sensitive Taqman-MGB Cesa3pS probe in conjunction with PV gene, as the result is shown should
Bacterial strain is sensitive strain；And the Taqman-MGB Cesa3pR probe of resistance is then in conjunction with YQ gene, the results showed that the bacterial strain is
Resistant strain；When genomic DNA is the heterozygous genes as made of the DNA mixed in equal amounts of PV and YQ, responsive probe and resistance are visited
Needle can be expanded in conjunction with genomic DNA, illustrate that the technology can successfully distinguish resistance, the sensitive bacteria of dimethomorph
Strain, and distinguish sensitive heterozygote and homozygote bacterial strain.
4) verifying of Taqman-MGB technology
The dimethomorph resistance for 50 plants of Pseudoperonospora cubensis for picking up from Hebei Wei County is detected using above-mentioned Taqman reaction,
And the result of Taqman-MGB PCR is verified using direct sequencing and leaf disk method.The result table of Taqman PCR detection
There are 33 plants in bright 50 plants of Pseudoperonospora cubensis for resistant strain, 17 plants are sensitive strain, and wherein there are 3 plants of heterozygosis bacterium in sensitive strain
Strain.PCR amplification is carried out to 50 plants of bacterial strains with primer PVcesa3F, primer PVcesa3R, finds that Taqman PCR is shown after sequencing
Base replacement has occurred for the bacterial strain of resistance, and base mutation does not occur for the base at 1105 codons of sensitive strain.Benefit
The result obtained with traditional leaf disk method is consistent with its (table 2).The above results show that Taqman-MGB technology can be used for oenin
Resistance detecting of the mould to dimethomorph.
Resistance detecting of the 2 Hebei province Wei County P. viticola of table to dimethomorph
5) sensitivity determination of Taqman-MGB technology
Respectively using the DNA of resistant strain YQ and sensitive strain PV as template, the technical antagonism bacterial strain and sensitivity are measured
The sensitivity of bacterial strain.Above-mentioned DNA is diluted respectively using gradient dilution method, wherein the template concentrations of resistant strain are respectively 12.6
μg/ml,1.26μg/ml,0.126μg/ml,0.0126μg/ml,0.00126μg/ml；The template concentrations of sensitive strain are respectively
20.5μg/ml,2.05μg/ml,0.205μg/ml,0.0205μg/ml,0.00205μg/ml.1 μ L genome is added in each reaction
DNA carries out PCR detection.
As a result as shown in Fig. 2, under each concentration conditions, corresponding gene can be detected, therefore to dimethomorph resistance
The detection line of bacterial strain resistance allele is 0.126ng, and is 0.00205ng to the detection line of sensitive alleles.
6) China grape main producing region Pseudoperonospora cubensis is detected to the resistance level of dimethomorph using Taqman-MGB technology
By Beizhen City, Liaoning Province, Shanxi Province Qingxu County, Hebei province Wei County, penglai City, shangdong Province city, Hubei Province Gongan County, Hunan
The P. viticola that province's Huaihua City, Yunnan Province Binchuan County, the area of Yunnan Province Yongren County 8 acquire extracts its DNA after pure culture,
Taqman PCR reaction is carried out, to detect the sensitive case of the bacterial strain group to dimethomorph in above-mentioned area.
The results are shown in Table 3, has 1084 plants of resistant strains in 2227 Plasmopara viticolas being collected into, 1040 plants quick
Feel bacterial strain, total fastness frequency is 51.1%.Wherein, the grape downy mildew in Beizhen City, Liaoning Province, penglai City, shangdong Province city, Hebei province Wei County
Bacterium is higher to the fastness frequency of dimethomorph, higher than 80%, and Shanxi Province Qingxu County, Binchuan city, Yunnan Province, Hunan Province's Huaihua City
Bacterial strain it is lower to the fastness frequency of dimethomorph, be lower than 20%.
Drug resistance result of the main viny region downy mildew in 3 China of table to dimethomorph
Claims (5)
1. a kind of for detecting Plasmopara viticola to the Taqman primer of carboxylic acyloxy amine fungicide resistance, feature exists
In: the specific primer Cesa3F/ at the 1105th codon comprising its Cellulose-synthase gene of pair for amplification PvCesA3
Cesa3R and a pair of Taqman MGB probe Cesa3pR/Cesa3pS, sequence are respectively as follows:
Cesa3F:5 '-GCACAAACACGACAATGTAGACAA-3 '
Cesa3R:5 '-CGGCTGCTACCTTTACGGCAAA-3 '
Cesa3pR:5 '-FAM-AGCAACGAGCTGAA-MGB-3 '
Cesa3pS:5 '-VIC-CAGCAACGAGCCGA-MGB-3 '
2. using Plasmopara viticola to the Taqman-MGB detection method of carboxylic acyloxy amine fungicide resistance to grape downy mildew
The drug resistance of sick pathogen is used for quickly detecting, and step includes:
1) DNA for extracting tested bacterium, prepares DNA sample；
2) primer and probe shown in claim 1 carries out PCR amplification to the DNA sample in step 1).
3) amplification curve obtained according to step 2) judges the germ to the sensibility of carboxylic acyloxy amine fungicide: if the bacterial strain
DNA only with resistance probe (Cesa3pR) combine, then the bacterial strain be resistant strain；If only being tied with responsive probe (Cesa3pS)
It closes, is then sensitive homozygous bacterial strain；If all being combined with two kinds of probes, for sensitive heterozygosis bacterial strain.
3. downy mildew according to claim 2 is to the method for detecting specificity of carboxylic acyloxy amine fungicide resistance, wherein
PCR step include:
1) amplification reaction system: including 1 μ L template DNA in 20 μ l reaction solutions, 0.4 μ L Cesa3F, 0.4 μ L Cesa3R, and 10
μ L Probe qPCR Mix, 2 μ L Cesa3pF, 2 μ L Cesa3pR, 0.2 μ L PoX Reference Dye II, 4 μ L
ddH2O。
2) PCR amplification program are as follows: 60 DEG C, 1min；95 DEG C, 10min；95 DEG C, 15s, 60 DEG C, 1min, 40 circulations, last 60
DEG C, 1min.
4. primer and probe described in claim 1 in Plasmopara viticola to answering in carboxylic acyloxy amine fungicide Resistance detecting
With.
5. the method for claim 2 and 3 is in Plasmopara viticola to the application in carboxylic acyloxy amine fungicide Resistance detecting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811413582.0A CN109666754B (en) | 2018-11-26 | 2018-11-26 | Taqman-MGB detection method for drug resistance of plasmopara viticola to carboxylic acid amide bactericides |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811413582.0A CN109666754B (en) | 2018-11-26 | 2018-11-26 | Taqman-MGB detection method for drug resistance of plasmopara viticola to carboxylic acid amide bactericides |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109666754A true CN109666754A (en) | 2019-04-23 |
| CN109666754B CN109666754B (en) | 2021-03-12 |
Family
ID=66142772
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811413582.0A Active CN109666754B (en) | 2018-11-26 | 2018-11-26 | Taqman-MGB detection method for drug resistance of plasmopara viticola to carboxylic acid amide bactericides |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109666754B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313177A (en) * | 2014-11-11 | 2015-01-28 | 南京农业大学 | Molecular detection method for rapidly identifying carbendazim-resistant genotype-F200Y botrytis cinerea strain |
| CN108018374A (en) * | 2017-12-29 | 2018-05-11 | 华中农业大学 | For detecting drug-fast kit of the Botrytis cinerea to benzimidazole germicide |
-
2018
- 2018-11-26 CN CN201811413582.0A patent/CN109666754B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104313177A (en) * | 2014-11-11 | 2015-01-28 | 南京农业大学 | Molecular detection method for rapidly identifying carbendazim-resistant genotype-F200Y botrytis cinerea strain |
| CN108018374A (en) * | 2017-12-29 | 2018-05-11 | 华中农业大学 | For detecting drug-fast kit of the Botrytis cinerea to benzimidazole germicide |
Non-Patent Citations (2)
| Title |
|---|
| BLUM M 等: "A single point mutation in the novel PvCesA3 gene confers resistance to the carboxylic acid amide fungicide mandipropamid in Plasmopara viticola", 《FUNGAL GENET BIOL.》 * |
| ZHANG H 等: "Tetra-primer ARMS PCR for rapid detection and characterisation of Plasmopara viticola phenotypes resistant to carboxylic acid amide fungicides", 《PEST MANAG SCI.》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109666754B (en) | 2021-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| CN102453762B (en) | Kit and method for detecting porcine proliferative enteropathy (PPE) pathogenic bacteria Lawsonia Intracellularis | |
| CN106520977A (en) | Primers and method for detecting alfalfa root rot fungi by virtue of loop-mediated isothermal amplification | |
| CN102534010A (en) | Primers for molecular detection of nontoxic genes of Magnaporthe grisea and application thereof | |
| CN102108398B (en) | Fluorescent quantitative PCR detection method for Mycobacterium tuberculosis | |
| CN108893557A (en) | A kind of method of three kinds of wheat rhizome portion diseases of quick detection | |
| CN102344953B (en) | Primer for detecting peach-derived component in sample, method and kit | |
| CN102329879A (en) | Rapid identification method of Brucellosis aerosol by using fluorescent quantitative PCR (polymerase chain reaction) | |
| CN104232782A (en) | PCR (polymerase chain reaction) primer for detecting tobacco soil-borne fungal pathogens as well as application and method of PCR primer | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN102344951A (en) | Primer, method and kit for detecting pear-derived components in sample | |
| CN107828912A (en) | A kind of dosporium cucumerinumand LAMP detection primer and detection method | |
| CN109666754A (en) | Taqman-MGB detection method of the Plasmopara viticola to carboxylic acyloxy amine fungicide resistance | |
| CN103555824B (en) | Molecule detection method for puccinia striiformis f.sp.tritici No.17 physiological race | |
| CN106434990B (en) | A kind of clover phytophthora nested PCR detection method | |
| CN102329885B (en) | Kit for detecting polymorphism of VKORC1 and CYP2C9 genes | |
| CN101985652B (en) | High-throughput molecular detection of Fusarium graminearum on carbendazim medicament-resistant gene frequency | |
| CN105063040B (en) | Phytophthora infestans germ PCR detection primers, kit and detection method | |
| CN104404151A (en) | Kit for detecting blackstem bacteria of sunflowers | |
| CN104685068B (en) | The detection method of mycobacterium avium subspecies mycobacterium paratuberculosis | |
| CN101985653A (en) | Molecule detection method of Fusarium graminearum to medium resistance level bacterial strain of carbendazim | |
| CN113005218A (en) | LAMP (loop-mediated isothermal amplification) detection primer, kit and detection method for fusarium solani | |
| CN109706258A (en) | Taqman-MGB detection method of the Plasmopara viticola to methoxy acrylate (QoI) class fungicide resistance | |
| CN104059968B (en) | A kind of primer for detecting pomegranate dry rot germ and utilize the detection method of its detection pomegranate dry rot germ | |
| CN1771331B (en) | stn gene oligonucleotide primers for detecting salmonella species and detection process using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |