CN109666715A - A kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously - Google Patents
A kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously Download PDFInfo
- Publication number
- CN109666715A CN109666715A CN201910022950.7A CN201910022950A CN109666715A CN 109666715 A CN109666715 A CN 109666715A CN 201910022950 A CN201910022950 A CN 201910022950A CN 109666715 A CN109666715 A CN 109666715A
- Authority
- CN
- China
- Prior art keywords
- coli
- chiral
- gdh
- amino alcohols
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/001—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by metabolizing one of the enantiomers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/001—Amines; Imines
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/006—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by reactions involving C-N bonds, e.g. nitriles, amides, hydantoins, carbamates, lactames, transamination reactions, or keto group formation from racemic mixtures
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01184—Carbonyl reductase (NADPH) (1.1.1.184)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/99—Oxidoreductases acting on the CH-OH group of donors (1.1) with other acceptors (1.1.99)
- C12Y101/9901—Glucose dehydrogenase (acceptor) (1.1.99.10)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y206/00—Transferases transferring nitrogenous groups (2.6)
- C12Y206/01—Transaminases (2.6.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to field of biotechnology, a kind of method for providing Whole Cell Biocatalysis while preparing chiral vicinal amino alcohols and chiral diol, with recombination bacillus coliE.coli(TAm)、E.coli(CR) andE.coli(GDH) full cell is that biocatalyst reacts in phosphate buffer using racemic vicinal amino alcohols as substrate, while realizing the pure and mild vicinal amino alcohols of synthesis of chiral pure two.Cascade catalysis reaction includes that 2 kinds of enzyme catalysts are catalyzed two-step reaction, and the first step carries out Kinetic Resolution to racemic vicinal amino alcohols by transaminase, obtains the vicinal amino alcohols and hydroxyl ketone of a kind of chiral purity；Second step glycol by carbonyl reductase that hydroxyl ketone asymmetric reduction synthesis of chiral is pure.Two pure and mild vicinal amino alcohols of chiral purity can be prepared simultaneously using method of the present invention catalysis racemic vicinal amino alcohols, there is high catalytic efficiency, and reaction condition is mild, and reaction process is simple and low power consumption and other advantages, meets green chemistry principles.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of Whole Cell Biocatalysis prepares chiral vicinal amino alcohols simultaneously
With the method for chiral diol.
Background technique
Chiral vicinal amino alcohols and chiral diol are a kind of highly important compounds.It is living that it can not only participate in multinomial life
It is dynamic, it can also be used as very important chiral building block and chiral intermediate, in medicine, chemical industry, food, agricultural and functional material etc.
Field plays the role of very important.(S)-benzene glycinol can be used for synthesizing (4S,5S) -2- phenyl -4-(methoxycarbonyl group) -5- is different
Propyl oxygen oxazoline, it is a kind of useful chiral auxiliary for synthesizing neurotrophic agents；(R)-benzene glycinol can be used for synthesizing phosphoric acid
Inositol dependent protein kinase inhibitor；(R)-benzoglycols can be used for preparing (R)-fluorobenzene Xi Ting, (R)-Prozac and β-are interior
Amides antibiotic, the various metabolic problems such as treatment abalienation；Ethambutol is effective anti-tubercular drug, for anti-through other
The invalid case of tuberculosis medicine treatment, often with other anti-tubercular drug use in conjunction, to heighten the effect of a treatment and delay the production of bacterial drug resistance
It is raw, and (S) -2- amino-n-butyl alcohol be synthesize ethambutol key intermediate.(R, R) -2,3- butanediol be synthesis prevention and
The intermediate for treating ischemic heart disease, anginal important drugs aspirin；(S) -1,2- pentanediol can be used for synthesizing agriculture
With chemicals universal bactericide propiconazole；In other catalyst preparations, the fields chiral diol such as functional material synthesis
Vital effect, such as computer are played, it is different that the liquid crystal material that the electronics technologies product such as mobile phone uses adds single mapping
The chiral diol of structure body can shorten the response time of liquid crystal display.
Chemical method synthesis of chiral vicinal amino alcohols and vicinal diamines need harsh reaction condition, complicated blocking group and valuableness
Metallic catalyst, due to the high efficiency of biocatalyst, it is highly selective, reaction condition is mild and environmentally protective the advantages that, at
For the method for a kind of ideal synthesis of chiral vicinal amino alcohols and vicinal diamines.But bioanalysis also has its limitation, it is chiral
The Dynamic Kinetic Resolution of vicinal amino alcohols, maximum yield only has 50%, and the intermediate hydroxyl ketone generated is dropped again, and raw material utilizes
Rate is low；α-hydroxyl ketone asymmetric reduction synthesis of chiral vicinal diamines have the limitation of substrate cost again in actual production.
Summary of the invention
The present invention provides a kind of methods that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously, should
Method belongs to treat different things alike transaminase and carbonyl reductase cascade catalysis reaction, can prepare chiral vicinal amino alcohols and chirality two simultaneously
Alcohol.This invention simplifies reaction process, avoid the loss of intermediate product, and high catalytic efficiency is suitble to the work of cascade catalyst system
Industry application.
The present invention is achieved by the following technical solutions: a kind of Whole Cell Biocatalysis prepares chiral vicinal amino alcohols simultaneously
With the method for chiral diol, with recombination bacillus coliE. coli(TAm)、E. coli(CR) andE. coli(GDH) full cell is
Biocatalyst reacts in phosphate buffer using racemic vicinal amino alcohols as substrate, while realizing the pure glycol of synthesis of chiral
And vicinal amino alcohols.
Recombination bacillus coli in reaction systemE. coli(TAm) it is for expression S type transaminaseSThe full cell of-TAm, reaction
Product afterwards isS-The vicinal amino alcohols of configuration；Recombination bacillus coli in reaction systemE. coliIt (TAm) is expression R type transaminase
I.e.RThe full cell of-Tam, the product after reaction areRThe vicinal amino alcohols of configuration.
Recombination bacillus coli in reaction systemE. coli(CR) it is for S type carbonyl reductaseSThe full cell of-CR, after reaction
Product beSThe glycol of configuration；Recombination bacillus coli in reaction systemE. coli(CR) it is for R type carbonyl reductaseR- CR's
Full cell, the product after reaction areRThe glycol of configuration.
Specific steps are as follows:
(1) engineered strain of building coexpression carbonyl reductase BDHA and glucose dehydrogenase GDHE. coli(BDHA-GDH),
Co-express the engineered strain of carbonyl reductase GoSCR and glucose dehydrogenase GDHE. coli(GoSCR-GDH), is recombinated
Bacterial strainE. coli(BDHA-GDH) andE. coliThe cell of (GoSCR-GDH)；
(2) recombinant bacterial strain is constructedE. coli (MVTA)、E. coli (CV2025)、E. coli(PpbauA), high efficient expression
(R)-transaminase MVTA, (S)-Transaminase C V2025 and (S)-transaminase PpbauA, obtain recombinant bacterial strainE. coli(MVTA),E. coli (CV2025) andE. coli(PpbauA) cell；
(3) by recombinant bacteriumE. coli(BDHA-GDH),E. coli(GoSCR-GDH),E. coli (MVTA) andE. coli
(CV2025) proportionally 1:1 mixing is used as biocatalyst to four kinds of combinations of cell point, and the cell dosage of biocatalyst is
10-15 g cdw/L, is added the substrate of final concentration of 10-60 mM, and the Sodium Pyruvate of final concentration of 10-60 mM is final concentration of
The glucose of 10-60 mM, the PLP of final concentration of 0.01-1.0 mM, concentration are that the sodium phosphate buffer that 0.1 M, pH is 7.0 is made
For phosphate buffer, reaction temperature is 25 DEG C, reacts 1-24 h, passes through whole-cell catalytic synthesis of chiral vicinal amino alcohols and chirality
Glycol；
(4) it the separation of reaction solution: after reaction, adjusts reaction solution pH to pH < 2, glycol is extracted with ethyl acetate out, then will reaction
Liquid pH is adjusted to pH > 10, and chiral aminoalcohol is extracted with ethyl acetate out.
(S)-transaminase PpbauA from pseudomonasputidasp (Pseudomonas putida NBRC
14164), (S)-Transaminase C V2025 from chromobacterium violaceum (Chromobacterium. violaceum), (R)-transaminase
MVTA from mycobacterium tuberculosis (Mycobacterium vanbaalenii)；Carbonyl reductase GoSCR comes from oxidizing glucose
Bacillus (Gluconobacter oxydans), carbonyl reductase BDHA from bacillus subtilis (Bacillus subtilis), glucose dehydrogenase GDH from bacillus subtilis (Bacillus subtilis)；Recombinant bacteriumE. coli
(BDHA-GDH) andE. coli(GoSCR-GDH) is respectively intended to coexpression carbonyl reductase and glucose dehydrogenase.
The substrate is racemization benzene glycinol or racemization 1- hydroxyl -2- butanol.The whole-cell catalytic synthetic reaction is being stirred
It mixes and carries out under the conditions of 200 rpm of revolving speed.
The reaction step of application of the present invention is explained by taking racemic benzene glycinol (substrate) as an example below:
Step 1, the engineered strain of building coexpression BDHA and GDHE. coli(BDHA-GDH), building coexpression GoSCR and
The engineered strain of GDHE. coli(GoSCR–GDH);Then recombinant bacterial strain is picked from the plateE. coli(BDHA-GDH) andE. coliThe single colonie of (GoSCR-GDH), is seeded to that receive chloramphenicol resistance and 100 mg/L ampicillins containing 50 mg/L cards anti-
Property LB culture medium in, 37 DEG C, 180 revs/min of 8 h of shaken cultivation, by 2% inoculum concentration access equipped with containing 50 mg/L cards receive it is mould
In 50 mL TB culture mediums of plain resistance and 100 mg/L amicillin resistances, culture solution is worked as in 37 DEG C, 180 revs/min of cultures
OD600It is added the IPTG of final concentration of 0.1 mM when reaching 0.6,20 DEG C, 180 revs/min of 12 h of induction.4 DEG C, 8000 revs/min
5 min of Zhongli's heart, collection obtain recombinant bacterial strainE. coli(BDHA-GDH) andE. coliThe cell of (GoSCR-GDH).
Step 2, recombinant bacterial strain is constructed respectivelyE. coli (MVTA)、E. coli (CV2025)、E. coli
(PpbauA) it is used for high efficient expression transaminase MVTA, CV2025 and PpbauA, single colonie is then picked from the plate, is seeded to and contains
50 mg/L cards receive chloramphenicol resistance LB culture medium in, 37 DEG C, 180 r shaken cultivation, 8 h, by 2% inoculum concentration access contain 50
Mg/L card receive chloramphenicol resistance 50 mL TB culture mediums in, 37 DEG C, 180 revs/min culture, as the OD of culture solution600Reach 0.6
When be added the IPTG of 0.1 mM, 20 DEG C, 180 revs/min of 12 h of induction.4 DEG C, 8000 revs/min of 5 min of centrifugation are collected, and are obtained
Recombinant bacterial strainE. coli(MVTA),E. coli (CV2025) andE. coli(PpbauA) cell.
Step 3, by recombinant bacteriumE. coli(BDHA-GDH),E. coli(GoSCR-GDH),E. coli (MVTA) andE. coli (CV2025) proportionally 1:1 is mixed four kinds of combinations of cell point, and substrate racemic benzene glycinol (10-60 is added
MM), Sodium Pyruvate (10-60 mM), glucose (10-60 mM), PLP(0.01 mM), it is pure by whole-cell catalytic synthesizing optical
Benzoglycols and benzene glycinol.
It is characterized in that co-expressing BDHA and GDH engineered strain in step 1 in the above methodE. coli (BDHA–GDH),
Co-express GoSCR and GDH engineered strainE. coli The construction step of (GoSCR-GDH) are as follows:
Carbonyl reductase BDHA gene, which is connected on expression vector pET28a structure, builds plasmid pET28a-BDHA, then by glucose dehydrogenation
Enzyme GDH gene is connected to building plasmid pETDuet-GDH on expression vector pETDuet；Then by plasmid pET28a-BDHA and plasmid
PETDuet-GDH is imported simultaneouslyE.coliIn the competent cell of BL21, screening positive clone, acquisition can express carbonyl simultaneously
The recombination bacillus coli of reductase BDHA and glucose dehydrogenase GDHE. coli (BDHA–GDH);Carbonyl reductase GoSCR
Gene is connected to construction recombination plasmid pET28a-GoSCR on expression vector pET28a, then glucose dehydrogenase GDH gene is connected to
Construction recombination plasmid pETDuet-GDH on expression vector pETDuet；Then by plasmid pET28a-GoSCR and plasmid pETDuet-
GDH is imported simultaneouslyE.coliIn the competent cell of BL21, screening positive clone, acquisition can express carbonyl reductase simultaneously
The recombination bacillus coli of GoSCR and glucose dehydrogenase GDHE.coli (GoSCR–GDH)。
It is characterized in that step 2 building is overexpressed the bacterial strain of MVTA in the above methodE. coli (MVTA), CV2025
Bacterial strainE. coli (CV2025) method is: transaminase MVTA gene and CV2025 gene are respectively coupled to expression vector
The upper construction recombination plasmid pET28a-MVTA and pET28a-CV2025 of pET28a, by recombinant plasmid pET28a-MVTA and pET28a-
CV2025 is directed respectively intoE. coliIn the competent cell of BL21, screening positive clone, acquisition can express transaminase MVTA's
Recombination bacillus coliE. coli (MVTA) and the recombination bacillus coli of Transaminase C V2025 can be expressedE. coli (CV2025)。
It is carried out under the conditions of 25 DEG C, 200 rpm of speed of agitator in the above method it is characterized in that being catalyzed reaction in step 3.
The present invention uses the vicinal diamines treated different things alike enantioselectivity for racemic vicinal amino alcohols while being converted into enantiomer-pure
And vicinal amino alcohols, reaction efficiency is both increased, the loss of intermediate product is in turn avoided.
Using transaminase of the present invention and carbonyl reductase cascade catalytically synthesizing chiral vicinal amino alcohols and vicinal diamines, with biography
The chemical method of system is compared, and has high selectivity and conversion ratio, and reaction condition is mild, no pollution to the environment, with other biological
Method is compared, and cascade catalysis avoids the loss of intermediate product, reduces production cost, adjacent ammonia chiral for medicine and chemical field
Efficient, the green syt of the pure and mild chiral diol of base are of great significance.
Detailed description of the invention
Fig. 1 is that cascade catalysis racemic vicinal amino alcohols generate optical voidness vicinal amino alcohols and glycol route map；
Fig. 2 is influence result of study schematic diagram of the benzene glycinol to transaminase activity；In figure: a is benzene glycinol to MVTA enzyme activity
Influence, b be influence of the benzene glycinol to CV2025 enzyme activity；
Fig. 3 is influence result of study schematic diagram of the Sodium Pyruvate to transaminase activity；In figure: a is Sodium Pyruvate to MVTA enzyme activity
Influence, b be influence of the Sodium Pyruvate to CV2025 enzyme activity；
Fig. 4 is influence result of study schematic diagram of the alanine to transaminase activity；In figure: a is shadow of the alanine to MVTA enzyme activity
It rings, b is influence of the alanine to CV2025 enzyme activity；
Fig. 5 is influence result of study schematic diagram of the 2- hydroxy acetophenone to transaminase activity；In figure: ◆ it is 2- hydroxy acetophenone pair
The influence of MVTA enzyme activity, ■ are influence of the 2- hydroxy acetophenone to CV2025 enzyme activity；
Fig. 6 is benzene glycinol influence result of study schematic diagram active on carbonyl reductase；In figure: a is benzene glycinol to BDHA
The influence of enzyme activity, b are influence of the benzene glycinol to GoSCR enzyme activity.
Specific embodiment
With reference to the accompanying drawing, presently preferred embodiments of the present invention is provided, and is described in detail.
SanPrep pillar PCR product purification kit (SK8141) is purchased from the limited public affairs of raw work bioengineering (Shanghai) share
Department.The a small amount of extraction agent boxes of SanPrep pillar Plasmid DNA (SK8192) are purchased from the limited public affairs of raw work bioengineering (Shanghai) share
Department；PCR amplification reagent dNTP, Buffer, Taq enzyme are purchased from Sangon Biotech (Shanghai) Co., Ltd.；Restriction enzyme
EnzymeBamHI、XhoI、HindIII、NdeI、 NcoI is purchased from Takara；Ligase and ligation buffer are purchased from
SCIENTIFIC；PCR primer is purchased from Sangon Biotech (Shanghai) Co., Ltd.；DNA sample-loading buffer, DNA standard scores
Son amount Marker is purchased from Sangon Biotech (Shanghai) Co., Ltd.；The double dyeing Marker of albumen are purchased from raw work bioengineering
(Shanghai) limited liability company.
Test method without specific conditions in following implementation, usually according to normal condition.
In following embodiments of the invention, the Escherichia coli culture medium preparation method used is as follows:
(1) 10.0 g NaCl, 10.0 g tryptones, the leaching of 5.0 g yeast LB culture medium: are added in the LB liquid medium of 1L
Powder after constant volume to 1 L, detects its pH with pH meter, then general aobvious acidity slowly adjusts pH to 7.0 with the NaOH of 5 mol/L.
If configuring solid medium, agar powder can be added by 1.5% content on the basis of the fluid nutrient medium prepared.It is sealed
Afterwards, with high-pressure steam sterilizing pan at 121 DEG C, sterilize 30 min, is placed in 4 DEG C of low temperature refrigerators and is saved for use after cooling.
(2) TB culture medium: following component is dissolved in 0.9 L water: 12 g of tryptone, yeast extract 24 g are sweet
4 mL of oil.High pressure sterilization after each component is dissolved.60 DEG C are cooled to, the sterilized phosphate buffer (2.31 of 100 mL is added
The K2HPO4 of the KH2PO4 of g and 12.54 g are dissolved in 100 mL water).
The detection method of product glycol content and ee value: by reaction solution with concentrated hydrochloric acid be acidified (pH < 2), add sodium chloride to satisfy
With with being extracted in equal volume containing internal standard (dodecane) ethyl acetate, take organic phase anhydrous sodium sulfate dry, in gas phase color
It is analyzed on spectrometer, chiral column (0.32 mm x of CP-Chirasil-Dex CB, 25 m x, 0.25 m;Agilent Technologies
Company), testing conditions: 250 DEG C of injection port, 250 DEG C of detector, temperature programming is raised at 100 DEG C with 2 DEG C per minute
120 DEG C, then it is raised to 160 DEG C per minute with 5 DEG C, retain 10 min.
The detection method of product vicinal amino alcohols content: by reaction solution with sodium hydroxide solution tune pH to be greater than 12, chlorination
Sodium takes organic phase anhydrous sodium sulfate dry to saturation with being extracted in equal volume containing internal standard (dodecane) ethyl acetate,
It is analyzed on gas chromatograph, HP-5 pillar (30 m x, 0.32 mm x, 0.25 m;Agilent Technologies), detector bar
Part: 250 DEG C of injection port, 250 DEG C of detector, 120 DEG C of column temperature, retain 10 min.
The detection method of product benzene glycinol enantiomeric excess value (ee): needing to derive sample before detection, will be anti-
It answers liquid sodium hydroxide solution tune pH to being greater than 12, adds sodium chloride to saturation, extracted, taken organic with isometric ethyl acetate
It is mutually dry with anhydrous sodium sulfate, organic phase is fetched into 1.5 new mL centrifuge tubes, 0.1 mL is added and contains 50 mg/mL 4-
The acetic acid anhydride solution of dimethylamino naphthyridine (DMAP) adds 0.5 mL saturation after reacting 4 h at 40 DEG C, 700 rpm again
NH4Mixing fullys shake in Cl solution, and simultaneously anhydrous Na is added in centrifuging and taking organic phase2SO4It is dried to carry out gas-chromatography survey
Amount.Testing conditions: 250 DEG C of injector temperature, 270 DEG C of detector temperature, column temperature is temperature programming, at 120 DEG C, with 2 DEG C
It is raised to 160 DEG C per minute, retention time is 20 min.
The calculation formula of the enantiomeric excess value of substrate are as follows:；Wherein [R], [S] difference
Represent substrate R and S configuration corresponding body peak area size various in gas chromatogram.
Experimental example 1: building recombinant expression carrier:
According to gene order (PpbauA, CV2025, BDHA, GoSCR, GDH) design primer, the transaminase MVTA gene order
Such as the nucleotide sequence as shown in SEQ IDNO:1；The Transaminase C V2025 gene order such as the core as shown in SEQ IDNO:2
Nucleotide sequence；The transaminase PpbauA gene order such as the nucleotide sequence as shown in SEQ IDNO:3；The carbonyl reduction
Enzyme BDHA gene order such as the nucleotide sequence as shown in SEQ IDNO:4；The carbonyl reductase GoSCR gene order is as such as
Nucleotide sequence shown in SEQ IDNO:5.
MVTA upstream region of gene primer is GGGAATTCCATATGGGCATCGACACTGGCACCT, downstream primer CCGCTC GAGGTACTGAATCGCTTCAATCAGTG；Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd., underscore portion
It is divided intoNdeI andXhoI restriction enzyme site, then with mycobacterium tuberculosisMycobacterium vanbaaleniiGenome is template
PCR amplification obtains MVTA gene；PpbauA upstream region of gene primer is CGCGGATCCATGAACATGCCCGAAACCGCTCC, downstream
Primer is CCCCTCGAGTCAGTCGATCAGGTTCAGGTTTTCG；Primer is by Sangon Biotech (Shanghai) Co., Ltd.
Synthesis, underscore part isBamHI andXhoI restriction enzyme site, then with pseudomonas putidaPseudomonas putidaGenome
PpbauA gene is obtained for template PCR amplifications；CV2025 upstream region of gene primer is CGCGGATCCATGCAGAAGCAACGTACGA
CCAGC, downstream primer CCCAAGCTTCTAAGCCAGCCCGCGCGCCTTCAGC；Primer is by giving birth to work bioengineering (Shanghai) stock
The synthesis of part Co., Ltd, underscore part isBamHI andHindIII digestion site, then with chromobacterium violaceumChromobacterium violaceumGenome is that template PCR amplifications obtain CV2025 gene；BDHA upstream region of gene primer is
CGCGGATCCATGAAGGCAGCAAGATGGCATAACC, downstream primer CCCAAGCTTTTAGTTAGGTCTAACAAGGATT
TTG；Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..Underscore part isBamHI andHindIII digestion position
Point, then with bacillus subtilisBacillus subtilisGenome is that template PCR amplifications obtain BDHA gene；GoSCR gene
Upstream primer is CGCGGATCCATGTACATGGAAAAACTCCGCCTC, downstream primer CCCCTCGAGTCACCAGACGGTG
AAGCCCGCATC；Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..Underscore part isBamHI andXhoI
Restriction enzyme site, then with Gluconobacter oxvdansGluconobacter oxydansGenome obtains for template PCR amplifications
GoSCR gene；GDH upstream region of gene primer is CATGCCATGGGCATGTATCCGGATTTAAAAG, downstream primer CCGCTCG AGTTAACCGCGGCCTGCCTGGAATG；Primer is synthesized by Sangon Biotech (Shanghai) Co., Ltd..Underscore part
ForNcoI andXhoI restriction enzyme site, then obtained using bacillus subtilis Bacillus subtilis genome as template PCR amplifications
GDH gene.PCR amplification system are as follows: 40 51 μ L of μ L, dNTP of μ L, 10 xTaq plus buffer of sterile purified water, template
1 μ L, upper 1 μ L of primer, lower 1 μ L, Taq DNApolymerase of primer, 1 μ L.PCR condition is as follows: in 95 DEG C in PCR instrument
Preheating 5 minutes, is denaturalized template DNA sufficiently, subsequently into amplification cycles.In each circulation, 45 are kept prior to 94 DEG C
Second make template denaturation, then reduces the temperature to renaturation temperature 60 C and kept for 4 seconds, primer is made sufficiently to anneal with template；72
DEG C keep 1.5 minutes, extend primer in template, synthetic DNA complete one circulation.It repeats such circulation 30 times, makes to expand
The DNA fragmentation of increasing is largely accumulated.Finally, being kept for 10 minutes at 72 DEG C, extend product complete.Agarose gel electrophoresis results table
The gene size that bright amplification obtains is consistent with theoretical value.By the MVTA of recycling, PpbauA, CV2025, BDHA, GoSCR and matter
Grain pET28a, GDH gene and the pETDuet-1 corresponding restriction enzyme of above-mentioned restriction enzyme site digestion 2 in 37 DEG C of water-baths
Hour, 50 μ L reaction system of double digestion are as follows: 15 5 μ L of μ L, 10 x buffer of target gene/expression vector, restriction endonuclease each 1
μ L, 28 μ L of sterile purified water.The target fragment and plasmid of purified recycling ambient temperature overnight under the action of T4 ligase connect,
Enzyme disjunctor system are as follows: 3 μ L of carrier after digestion, 7 μ L of target gene after digestion, 1 μ L of buffer, 4 μ L of ligase, sterilizing are steamed
5 μ L of distilled water.Obtain recombinant expression carrier pET28a-MVTA, pET28a- PpbauA, pET28a-CV2025, pET28a-
BDHA, pET28a-GoSCR, pETDuet-GDH.Using thermal shock method by recombinant expression carrier pET28a-MVTA, pET28a-
PpbauA, pET28a-CV2025, pET28a-BDHA, pET28a-GoSCR, pETDuet-GDH are transferred to bacillus coli DH 5 alpha sense
By in state cell, it is coated with the LB solid medium of (50 μ g/mL) containing kanamycin or ampicillin (100 μ g/mL)
On plate, 37 DEG C of overnight incubations.After growing bacterium colony, monoclonal transformant in random picking resistant panel, in containing corresponding anti-
In the LB fluid nutrient medium of raw element, in 37 DEG C of shaking table culture 6-7 h, plasmid is extracted, carries out plasmid PCR and double digestion verifying.
Recombinant expression carrier is converted, the recombinant expression transformants are made into host microorganism.The host microorganism
It can be the various common host microorganisms of this field, as long as the voluntarily duplication recombinant expression carrier that the microorganism can be stable,
And can be of the invention entrained by effectively expressing MVTA, CV2025, BDHA, GoSCR, GDH gene.It is used in the present invention
Escherichia coliE. coli BL21 (DE3) is used as host microorganism.
Experimental example 2: the expression of Escherichia coli recombinant strain
Select following methods for the coli strain present invention: the bacterial strain that will be built in embodiment 1 is seeded to containing Ka Na's
In LB culture medium, 37 DEG C, 180 rpm shaken cultivation, 8 h, the shaking flask of 50 mL TB culture mediums is housed by 2% inoculum concentration access
In, 37 DEG C, 180 rpm culture, as the OD of culture solution600It is added the IPTG of final concentration of 0.1 mM when reaching 0.6,20 DEG C, 180
Rpm induces 12 h.4 DEG C, 8000 rpm are centrifuged 5 min and collect thallus, and with 100 mM, the sodium phosphate buffer that pH is 7.0 is washed
Twice.By the thallus of acquisition with 100 mM, the sodium phosphate buffer that pH is 7.0 suspends, and ultrasonication in ice bath is collected by centrifugation
Supernatant, as crude enzyme liquid.
Co-express recombinant bacteriumE. coli (BDHA-GDH) andE. coli The expression of (GoSCR-GDH), from constructing successfully
Recombinant bacterium in extract recombinant plasmid respectively, by recombinant plasmid pET28a-BDHA and pETDuet-GDH, pET28a-GoSCR and
PETDuet-GDH is transferred in e. coli bl21 competent cell jointly respectively by thermal shock method, is respectively coated on containing 100
On the plate of μ g/mL ammonia benzyl mycin and 50 μ g/mL kanamycins, 37 DEG C are incubated overnight.After growing bacterium colony, pick them separately flat
Single bacterium on plate falls within containing culture in dual anti-culture medium (100 μ g/mL ammonia benzyl mycins and 50 μ g/mL kanamycins) and lures
Expression is led, crude enzyme liquid is further prepared to its broken wall by ultrasonic cell disruptor, carries out SDS-PAGE electrophoretic analysis egg
White expression of results simultaneously measures its enzyme activity.
Embodiment 3: the influence of substrate and product to enzyme activity in reaction
(1) influence measurement of the benzene glycinol to transaminase activity: taking the benzene glycinol (10-100 mM) of various concentration respectively, and 50
The Sodium Pyruvate of mM draws enzyme activity with the change curve of benzene glycinol concentration, compares and turn under different benzene glycinol concentration conditions
The size of adnosine deaminase enzyme activity determines the most suitable catalysis substrate concentration of transaminase.Experimental result is as shown in Figure 2.Fig. 2 show for
MVTA, with the increase of benzene glycinol concentration, enzyme activity is also increasing, to benzene glycinol concentration be 50 mM when, just observe enzyme activity
Start to inhibit, after concentration is more than 50 mM, MVTA enzyme activity is begun to decline, but declines unobvious, and concentration reaches its enzyme activity of 70 mM
Still there is the 80% of highest enzyme activity；For CV2025, when benzene glycinol concentration is 40 mM, enzyme activity is suppressed, and with concentration
It continues growing, suppression is more and more obvious, and when benzene glycinol concentration is 60 mM, enzyme activity only has the 30% of highest enzyme activity.
(2) influence measurement of the Sodium Pyruvate to transaminase activity: the Sodium Pyruvate (10-100 of various concentration is taken respectively
MM), the benzene glycinol of 50 mM is drawn enzyme activity with the change curve of Sodium Pyruvate concentration, is compared in different Sodium Pyruvate concentration items
The size of transaminase enzyme activity under part determines the most suitable catalysis substrate concentration of transaminase.Experimental result is as shown in Figure 3.Fig. 3 shows
For MVTA, when Sodium Pyruvate concentration is to 60 mM, the enzyme activity of transaminase MVTA is maximum, and increases to 100 mM and also remain
Higher activity；For CV2025, the increase with Sodium Pyruvate concentration is declining enzyme activity always, has dropped to 100 mM enzyme activity
About 50%.
(3) influence measurement of the alanine to transaminase activity: taking the alanine (0-300 mM) of various concentration respectively, and 50
The benzene glycinol of mM, the Sodium Pyruvate of 25 mM are drawn enzyme activity with the change curve of alanine concentration, are compared in different alanine
The size of transaminase enzyme activity under concentration conditions determines the most suitable catalysis substrate concentration of transaminase.Experimental result is as shown in Figure 4.Fig. 4
Show MVTA enzyme activity and CV2025 enzyme activity as the increase of alanine concentration is declining always, and after concentration increases to 70 mM,
Enzyme activity inhibits the phenomenon that more obvious, all loses when concentration increases to 300 mM enzyme activity.
(4) influence measurement of the 2- hydroxy acetophenone to transaminase activity: the 2- hydroxy acetophenone (0- of various concentration is taken respectively
20 mM), the benzene glycinol of 50 mM, the Sodium Pyruvate of 25 mM, draw enzyme activity with 2- hydroxy acetophenone concentration change curve,
The size for comparing the transaminase enzyme activity under different 2- hydroxy acetophenone concentration conditions determines that the most suitable catalysis substrate of transaminase is dense
Degree.Experimental result is as shown in Figure 5.Fig. 5 shows that the increase of 2- hydroxy acetophenone concentration is existing without significantly inhibition to MVTA enzyme activity
As in the presence of 20 mM2- hydroxy acetophenones, MVTA enzyme activity still maintains the 90% of maximum enzyme activity；For CV2025,2- hydroxyl
After acetophenone concentration is more than 10 mM, enzyme activity is decreased obviously, and in the presence of 20 mM2- hydroxy acetophenones, CV2025 enzyme activity is only initial
The 50% of enzyme activity.
(5) benzene glycinol influence measurement active on carbonyl reductase: the benzene glycinol (0-100 of various concentration is taken respectively
MM), enzyme activity is drawn with the change curve of benzene glycinol concentration, compares the carbonyl reductase enzyme under different benzene glycinol concentration conditions
Size living determines the most suitable catalysis substrate concentration of carbonyl reductase.Experimental result is as shown in Figure 6.Fig. 6 shows benzene glycinol
Have apparent suppression to carbonyl reductase, for BDHA, when benzene glycinol is more than 10 mM, reaction rate sharply under
It drops, BDHA enzyme activity has dropped 50% in the case of benzene glycinol is not added in the BDHA enzyme activity ratio under 40mM benzene glycinol concentration, 100 mM
Benzene glycinol BDHA is without activity；For GoSCR, when benzene glycinol is more than 40 mM, reaction rate sharply declines, and benzene is sweet
When ammonia determining alcohol increases to 60 mM, GoSCR enzyme activity has dropped about 50%.
Embodiment 4: transaminase (TAm), carbonyl reductase (CR), the cascade of three enzyme of glucose dehydrogenase (GDH) are catalyzed outer disappear
It revolves benzene glycinol and generates optically pure benzoglycols and benzene glycinol
Standard reaction system is the sodium phosphate buffer of the 100 mM pH 7.0 of 1 mL, contains the sweet ammonia of 20-40 mM racemization benzene
Alcohol, 0.1 mM PLP, 20-40 mM Sodium Pyruvate, 20-40 mM glucose, 0.002 mM NADH, (combination 1) 1 U/mL
+ 4 U/mL of+2 U/mL GDH of+10 U/mL BDHA of MVTA, (combination 2)+20 U/mL GoSCR of 1 U/mL MVTA
GDH, (combination 3)+10 U/mL BDHA of 10 U/mL CV2025+2 U/mL GDH, (combination 4) 10 U/mL CV2025
+ 20 U/mL GoSCR + 4 U/mL GDH.Reaction solution is placed in 1.5 mL centrifuge tubes, and 25 DEG C, 200 r oscillating reactions 1-8
H is sampled measurement conversion ratio and ee value every different time.500 μ L are extracted reaction solution, add sodium chloride to saturation, with containing in equal volume
There is internal standard (dodecane) ethyl acetate to be extracted, after mixing fullys shake, 12000 r are centrifuged 5 min, take organic phase with anhydrous
Sodium sulphate is dry, with the content of gas chromatograph for determination benzoglycols；500 μ L are extracted reaction solution, 100 μ L sodium hydroxides (10 are added
M it) adjusts pH to being greater than 12, adds sodium chloride to saturation, extracted with isometric ethyl acetate, after mixing fullys shake, 12000 r
It is centrifuged 5min, takes organic phase anhydrous sodium sulfate dry, with concentration of the 4-dimethylaminopyridine in acetic anhydride for 50 mg/mL
For derivating agent, while the derivative organic phase at 40 DEG C, 700 r, then be centrifuged after mixing with saturation chlorination amine aqueous solution, it takes organic
Phase is used for gas chromatograph for determination benzene glycinol ee value after anhydrous sodium sulfate is dry.Experimental result is as shown in table 1.Reaction result
Show that the conversion ratio of racemic benzene glycinol all reaches 50%, ee value greater than 99%, the yield of benzoglycols has also reached 48-
49%, ee value are greater than 99%.
Tri- enzyme of table 1:TAm, CR, GDH combination cascade catalytic racemization benzene glycinol generates optically pure benzoglycols and benzene
Glycinol
Embodiment 5: full cellE. coli (TAm) it combinesE. coli (CR-GDH) cascades catalytic racemization benzene glycinol and generates
Optically pure benzoglycols and benzene glycinol
Standard reaction system is the sodium phosphate buffer of the 100 mM pH 7.0 of 1 mL, contains the sweet ammonia of 20-60 mM racemization benzene
Alcohol, 0.1 mM PLP, 20-60 mM Sodium Pyruvate, 20-60 mM glucose, 0.002 mM NADH, (combination 1) 10 g CDW/LE. coli (MVTA) + 10 g CDW/L E. coli(BDHA-GDH), (combination 2) 10 g CDW/LE. coli
(MVTA) + 10 g CDW/L E. coli (GoSCR-GDH), (combination 3) 15 g CDW/LE. coli (CV2025) +
15 g CDW/L E. coli(BDHA-GDH), (combination 4) 15 g CDW/LE.coli (CV2025) + 15 g CDW/LE. coli (GoSCR-GDH), (combination 5) 15 g CDW/LE. coli (PpbauA) + 15 g CDW/L E. coli
(BDHA-GDH), (combination 6) 15 g CDW/LE.coli (PpbauA) + 15 g CDW/L E. coli (GoSCR-
GDH)。
Reaction solution is placed in 1.5 mL centrifuge tubes, and 25 DEG C, 200 r oscillating reactions 1-12 h are sampled every different time
Measure conversion ratio and ee value.Experimental result is as shown in table 2.
Table 2: full cellE. coli (TAm) it combinesE. coli (CR-GDH) cascade catalysis racemic vicinal amino alcohols generate
Optically pure chiral diol and chiral amino alcohol.
Substrate 1a: racemic benzene glycinol；Substrate 1b: racemic amino butanol.
Embodiment 6: full cellE. coli (TAm) it combinesE. coli(CR-GDH) cascade catalysis racemic 2- amino-
N-butyl alcohol generates optically pure 1,2- butanediol and 2- amino-n-butyl alcohol
Standard reaction system is the sodium phosphate buffer of the 100 mM pH 7.0 of 1 mL, contains 10 mM racemization 2- amino-fourth
Alcohol, 0.1 mM PLP, 20 mM Sodium Pyruvates, 20 mM glucose, 0.002 mM NADH, (combination 1) 10 g CDW/LE. coli (MVTA) + 10 g CDW/L E. coli(BDHA-GDH), (combination 2) 10 g CDW/LE. coli
(MVTA) + 10 g CDW/L E. coli (GoSCR-GDH), (combination 5) 15 g CDW/LE. coli (PpbauA) +
15 g CDW/L E. coli(BDHA-GDH), (combination 6) 15 g CDW/L E.coli (PpbauA) + 15 g CDW/LE. coli (GoSCR-GDH), reaction solution is placed in 1.5 mL centrifuge tubes, and 25 DEG C, 200 r oscillating reactions, 24 h, when different
Between be sampled measurement conversion ratio and ee value.Experimental result is as shown in table 2.Reaction result shows whole-cell catalytic racemic 2-
Amino-n-butyl alcohol conversion ratio has reached 52%, due to MVTA pairs of transaminaseR- 2- amino-n-butyl alcohol, PpbauA pairsS- 2- amino-
N-butyl alcohol has a faint activity, and conversion ratio has been more than that 50%, ee value is greater than the conversion ratio of 99%, 1.2- butanediol and has reached 50%, in
Between product 1- hydroxy-2-butanone be totally converted, do not remain,R- 1.2- butanediol ee value is greater than 99%,S-1.2- butanediol ee
Value 90%, it is not high to the selectivity of 1- hydroxy-2-butanone to be primarily due to carbonyl reductase GoSCR, generates microR- 1.2- fourth
Glycol.
Embodiment 7: full cellE. coli(TAm) it combinesE. coli(CR-GDH) cascade catalysis sweet ammonia of racemic benzene
Alcohol prepares optically pure benzoglycols and benzene glycinol
Standard reaction system is the sodium phosphate buffer of the 100 mM pH 7.0 of 50 mL, contains 50 mM racemization benzene glycinols,
0.1 mM PLP, 50 mM Sodium Pyruvates, 50 mM glucose, 0.002 mM NADH, (combination 1) 10 g CDW/LE. coli
(MVTA) + 10 g CDW/L E. coli(BDHA-GDH), (combination 2) 10 g CDW/LE. coli (MVTA) +
10 g CDW/L E. coli (GoSCR-GDH), (combination 3) 15 g CDW/LE. coli (CV2025) + 15 g
CDW/L E. coli(BDHA-GDH), (combination 4) 15 g CDW/LE.coli (CV2025) + 15 g CDW/L E. coli (GoSCR-GDH).Reaction solution is placed in 250 mL conical flasks, and 25 DEG C, 200 r oscillating reactions 3-12 h.In fully reacting
Afterwards, reaction solution is centrifuged at 8000 g and 10 min and then hydrochloric acid is used to be acidified reaction solution, make its pH < 2, then with acetic acid second
Ester repeats extraction and three times extracts the benzoglycols of generation.Then will react basified using the sodium hydroxide of 10 M makes it
PH > 11 add sodium chloride to being saturated, equally repeat extraction three times with ethyl acetate, unreacted benzene glycinol is extracted, will
The organic anhydrous sodium sulfate that is added to extracted is dried.Ethyl acetate is removed by decompression rotary evaporation after filtering, will
To solid be dried overnight in vacuum oven, obtain pure benzoglycols and benzene glycinol.Experimental result is as shown in table 3.Instead
Answer the result shows that, large scale preparation reflection under, the conversion ratio of racemic benzene glycinol has reached 50%, product benzoglycols
Conversion ratio has also reached 50%, and substrate ee value and product ee value all > 99%, by simply handling and purifying, also there is 40-42%
Separation yield.
Table 3: full cellE. coli (TAm) it combinesE. coli (CR-GDH) cascades the preparation of catalytic racemization benzene glycinol
Optically pure benzoglycols and benzene glycinol
1a: benzene glycinol;3a: benzoglycols
The present invention realizes the new cascade Biocatalysis method of one kind and is used for efficiently while preparing optically pure chiral vicinal amino alcohols
And chiral diol, and reaction condition is mild, product separation is easy, and has potential application value in actual production.
Sequence table
<110>Institutes Of Technology Of Taiyuan
<120>a kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1022
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
catatgggca tcgacactgg cacctcgaac ctggtggcgg tggagccggg ggcgattcgc 60
gaggacacac cggcaggcag cgtcatccag tattccgatt acgagattga ttacagctcg 120
ccgttcgcgg gcggcgtggc gtggattgag ggtgagtacc tgccggccga agatgcgaaa 180
attagcatct tcgacaccgg tttcggccac tcggacctga cctacacggt ggcgcacgtt 240
tggcacggca acattttccg cttgggcgat cacctggacc gcctgctcga cggcgcacgg 300
aagctccgcc tggacagcgg ctacaccaaa gacgagctcg ccgacatcac caagaagtgc 360
gtgagcctga gccagctgcg tgaaagcttc gtgaacctga ccatcacccg cgggtacggc 420
aagcgcaagg gggaaaagga cctgagcaag ctgacccacc aagtgtacat ttacgccatt 480
ccgtatctgt gggcgttccc cccggcggag cagatcttcg gcaccaccgc ggtggtgccg 540
cgccacgtgc gccgcgccgg ccgcaatacc gtggacccga ccatcaagaa ctaccagtgg 600
ggcgacctga ccgcggccag cttcgaggct aaggatcggg gcgcgcgcac cgccattctg 660
atggacgcgg acaactgcgt cgcggagggc ccgggattca acgtgtgcat tgtgaaggac 720
ggcaagctgg caagcccgtc ccgcaacgcg ctgccgggca tcacccgcaa gaccgtgttc 780
gagattgcgg gagccatggg aattgaagcg gcgctccgcg acgtgacctc ccatgagctg 840
tacgacgccg acgagattat ggcggtgacc accgcgggcg gcgtgacccc gattaacacc 900
ctggacggcg tgccgatcgg cgacggcgag ccgggtccgg tgaccgtggc gattcgcgac 960
cgcttctggg cgctgatgga cgagccgggg ccactgattg aagcgattca gtacgcggcc 1020
gc 1022
<210> 2
<211> 1380
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atgcagaagc aacgtacgac cagccaatgg cgcgaactgg atgccgccca tcacctgcat 60
ccgttcaccg ataccgcatc gctgaaccag gcgggcgcgc gcgtgatgac gcgcggagag 120
ggcgtctacc tgtgggattc ggaaggcaac aagatcatcg acggcatggc cggactgtgg 180
tgcgtgaacg tcggctacgg ccgcaaggac tttgccgaag cggcgcgccg gcagatggaa 240
gagctgccgt tctacaacac cttcttcaag accacccatc cggcggtggt cgagctgtcc 300
agcctgctgg ctgaagtgac gccggccggt ttcgaccgcg tgttctatac caattccggt 360
tccgaatcgg tggacaccat gatccgcatg gtgcgccgct actgggacgt gcagggcaag 420
ccggagaaga agacgctgat cggccgctgg aacggctatc acggctccac catcggcggc 480
gccagcctgg gcggcatgaa gtacatgcac gagcagggcg acttgccgat tccgggcatg 540
gcccacatcg agcagccttg gtggtacaag cacggcaagg acatgacgcc ggacgagttc 600
ggcgtggtgg ccgcgcgctg gctggaagag aagattctgg aaatcggcgc cgacaaggtg 660
gccgccttcg tcggcgaacc catccagggc gccggcggcg tgatcgtccc gccggccacc 720
tactggccgg aaatcgagcg catttgccgc aagtacgacg tgctgctggt ggccgacgaa 780
gtgatctgcg gcttcgggcg taccggcgaa tggttcggcc atcagcattt cggcttccag 840
cccgacctgt tcaccgccgc caagggcctg tcctccggct atctgccgat aggcgcggtc 900
tttgtcggca agcgcgtggc cgaaggcctg atcgccggcg gcgacttcaa ccacggcttc 960
acctactccg gccacccggt ctgcgccgcc gtcgcccacg ccaacgtggc ggcgctgcgc 1020
gacgagggca tcgtccagcg cgtcaaggac gacatcggcc cgtacatgca aaagcgctgg 1080
cgtgaaacct tcagccgttt cgagcatgtg gacgacgtgc gcggcgtcgg catggtgcag 1140
gcgttcaccc tggtgaagaa caaggcgaag cgcgagctgt tccccgattt cggcgagatc 1200
ggcacgctgt gccgcgacat cttcttccgc aacaacctga tcatgcgggc atgcggcgac 1260
cacatcgtgt cggcgccgcc gctggtgatg acgcgggcgg aagtggacga gatgctggcg 1320
gtggcggaac gctgtctgga ggaattcgag cagacgctga aggcgcgcgg gctggcttag 1380
<210> 3
<211> 1347
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
atgaacatgc ccgaaaccgc tcccgccggt atcgccagcc agctcaagct ggatgcccac 60
tggatgcctt acaccgccaa ccgcaacttc caccgcgacc cacggttgat cgtggcggcc 120
gaaggcaact acctggtcga tgaccagggg cgcaagatct ttgatgcgct gtctggcctg 180
tggacctgcg gcgccgggca cacccgcaag gaaattaccg atgcggtcac ccgtcagctg 240
agtaccctgg actattcccc ggcgttccag tttggccatc cgctgtcgtt ccagctggcg 300
gaaaagattg ctgatctggt tccaggcgat ctgaaccacg tcttttatac caactccggt 360
tccgagtgcg ccgacaccgc gctgaagatg gtgcgtgcct actggcgctt gaaaggccag 420
gcgaccaaga ccaagatcat cggccgtgcc cgcggctacc atggcgtgaa catcgccggt 480
accagcctgg gtggggtgaa cggtaaccgc aagatgttcg gccagttgct ggatgtcgac 540
cacctgcctc acaccgtgct gccggtgaac gccttctcca agggcatgcc ggaggagggc 600
ggtattgccc tggctgacga aatgctcaag ctgatcgagc tgcacgatgc ctccaacatc 660
gctgcggtga tcgtcgagcc gctggcgggg tctgccggtg tactgccgcc gcctaagggt 720
tacctgaagc gcctgcgtga aatctgcacc cagcacaaca tcctgctgat cttcgacgaa 780
gtgatcaccg gctttggccg catgggcgcg atgaccggtg ctgaagcctt cggcgtcacc 840
ccggacctga tgtgcatcgc caagcaggta accaacggcg ccatcccgat gggcgcggtg 900
attgccagca gtgagatcta ccacaccttc atgaaccagc cgacgccgga atacgccgtg 960
gaattcccgc acggctacac ctattcggcc cacccggtgg cctgcgccgc cggtatcgcc 1020
gcgctggacc tgctgcagaa ggaaaacctg gtgcagtccg ccgccgagct ggcgccgcac 1080
ttcgagaagc tgctgcacgg cgtgaagggc accaagaacg ttgtcgatat ccgtaactac 1140
ggcctggccg gcgccatcca gatcgccgcc cgtgacggtg atgccatcgt ccgcccgtac 1200
gaagtggcga tgaaattgtg gaaggcaggc ttctatgtac gcttcggtgg cgacaccctg 1260
cagttcggcc caacgttcaa caccacgccg caggaactgg atcgcttgtt cgacgccgtc 1320
ggcgaaaacc tgaacctgat cgactga 1347
<210> 4
<211> 1040
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
atgaaggcag caagatggca taaccaaaag gatatccgta ttgaacatat cgaagagcca 60
aaaacggagc cgggaaaagt aaagatcaaa gtcaaatggt gcggcatctg cggaagtgat 120
ttacacgaat atctgggcgg cccgatcttt attccggttg acaaaccgca cccattaaca 180
aatgaaacgg cacctgtcac aatggggcat gaattctccg gtgaagttgt cgaagtcgga 240
gaaggcgttg aaaattataa agttggagac cgcgttgtag tcgagccgat ttttgctaca 300
cacggccacc aaggcgccta caaccttgat gaacaaatgg gattcctcgg cttagccggc 360
ggaggcggcg gtttctctga atacgtctct gtggatgaag agcttttgtt caaacttcct 420
gatgaattat catatgaaca aggcgcgctc gttgaacctt ctgcagttgc tctatacgct 480
gtccgctcaa gcaaactcaa agcaggcgac aaagcggctg tattcggctg cggcccgatc 540
ggacttttgt cattgaagcg ctgaaggctg ccggtgcaac tgatatttac gctgttgagc 600
tttctcctga acgccagcaa aaagctgagg agcttggcgc gatcatcgtt gatccgtcta 660
aaacagacga tgtagtcgct gagattgcag aacgtacagg aggcggtgtt gacgtagcat 720
tcgaagtcac tggtgtccca gtggtgttac gacaagccat ccagtccact acaattgccg 780
gtgaaaccgt catcgtcagc atttgggaaa aaggtgctga aatccatccg aacgatatcg 840
taatcaaaga acgtacagta aaaggaatta tcggataccg cgacatcttc ccggctgtat 900
tgtcattaat gaaagaaggc tatttctcag ccgacaaact cgtaacgaaa aaaatcgtac 960
tagatgattt gatcgaggaa ggcttcgggg ctcttattaa agagaaaagc caagtcaaaa 1020
tccttgttag acctaactaa 1040
<210> 5
<211> 774
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
atgtacatgg aaaaactccg cctcgataac cgcgtcgcca tcgtcaccgg cggcgcacag 60
aacatcggtc tggcctgcgt caccgcactg gccgaggctg gcgcccgcgt catcatcgcc 120
gatctcgatg aagccatggc cacaaaagcc gtggaagacc tgcgcatgga aggccatgat 180
gtcagcagcg tcgtcatgga cgtcacgaat acagaaagtg tgcagaacgc tgtccgcagc 240
gttcatgaac aggaaggccg cgtggatatc ctggtcgcct gcgccggcat ctgtatttcc 300
gaggtgaagg ccgaggacat gacggatggc cagtggctca agcaggtcga tatcaacctg 360
aacggcatgt tccgctcctg tcaggccgtc gggcgcatca tgctcgaaca gaaacagggc 420
gtcattgtcg caatcggctc catgtccggc ctgatcgtca accgccctca gcagcaggcg 480
gcctataatg cgtcaaaagc cggcgttcac cagtatatcc gctcgctggc cgccgaatgg 540
gccccccatg gcatccgcgc caacgccgtt gcccccacct atatcgaaac gacgctcacc 600
cgcttcggca tggaaaagcc ggaactctac gacgcctgga tcgccggaac cccgatgggc 660
cgcgtaggcc agcccgacga agtcgcatcc gtcgtgcagt tcctggcgtc cgacgcagcc 720
agcctgatga ccggcgccat cgtaaatgtg gatgcgggct tcaccgtctg gtga 774
Claims (7)
1. a kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously, it is characterised in that: with weight
Group Escherichia coliE. coli(TAm)、E. coli(CR) andE. coli(GDH) full cell is biocatalyst, with racemic neighbour
Amino alcohol is substrate, is reacted in phosphate buffer, while realizing the pure and mild vicinal amino alcohols of synthesis of chiral pure two.
2. the side that a kind of Whole Cell Biocatalysis according to claim 1 prepares chiral vicinal amino alcohols and chiral diol simultaneously
Method, it is characterised in that: recombination bacillus coli in reaction systemE. coli(TAm) it is for expression S type transaminaseS- TAm's is complete thin
Born of the same parents, the product after reaction areS-The vicinal amino alcohols of configuration；Recombination bacillus coli in reaction systemE. coliIt (TAm) is expression R type
Transaminase isRThe full cell of-Tam, the product after reaction areRThe vicinal amino alcohols of configuration.
3. a kind of Whole Cell Biocatalysis according to claim 1 or 2 prepares chiral vicinal amino alcohols and chiral diol simultaneously
Method, it is characterised in that: recombination bacillus coli in reaction systemE. coli(CR) it is for S type carbonyl reductaseS- CR's is complete
Cell, the product after reaction areSThe glycol of configuration；Recombination bacillus coli in reaction systemE. coliIt (CR) is R type carbonyl reduction
Enzyme isRThe full cell of-CR, the product after reaction areRThe glycol of configuration.
4. the side that a kind of Whole Cell Biocatalysis according to claim 1 prepares chiral vicinal amino alcohols and chiral diol simultaneously
Method, it is characterised in that: specific steps are as follows:
(1) engineered strain of building coexpression carbonyl reductase BDHA and glucose dehydrogenase GDHE. coli(BDHA-GDH),
Co-express the engineered strain of carbonyl reductase GoSCR and glucose dehydrogenase GDHE. coli(GoSCR-GDH), is recombinated
Bacterial strainE. coli(BDHA-GDH) andE. coliThe cell of (GoSCR-GDH)；
(2) recombinant bacterial strain is constructedE. coli (MVTA)、E. coli (CV2025)、E. coli(PpbauA), high efficient expression
(R)-transaminase MVTA, (S)-Transaminase C V2025 and (S)-transaminase PpbauA, obtain recombinant bacterial strainE. coli(MVTA),E. coli (CV2025) andE. coli(PpbauA) cell；
(3) by recombinant bacteriumE. coli(BDHA-GDH),E. coli(GoSCR-GDH),E. coli (MVTA) andE. coli
(CV2025) proportionally 1:1 mixing is used as biocatalyst to four kinds of combinations of cell point, and the cell dosage of biocatalyst is
10-15 g cdw/L, is added the substrate of final concentration of 10-60 mM, and the Sodium Pyruvate of final concentration of 10-60 mM is final concentration of
The glucose of 10-60 mM, the PLP of final concentration of 0.01-1.0 mM, concentration are that the sodium phosphate buffer that 0.1 M, pH is 7.0 is made
For phosphate buffer, reaction temperature is 25 DEG C, reacts 1-24 h, passes through whole-cell catalytic synthesis of chiral vicinal amino alcohols and chirality
Glycol；
(4) separation of reaction solution: after reaction, adjusting reaction solution pH to pH < 2 with concentrated hydrochloric acid, adds sodium chloride to being saturated, with etc.
Volume of ethylacetate carries out extraction glycol, then reaction solution sodium hydroxide solution is adjusted pH to pH > 10, with isometric acetic acid second
Ester extracts chiral aminoalcohol.
5. the side that a kind of Whole Cell Biocatalysis according to claim 4 prepares chiral vicinal amino alcohols and chiral diol simultaneously
Method, it is characterised in that: (S)-transaminase PpbauA from pseudomonasputidasp (Pseudomonas putida
NBRC 14164), (S)-Transaminase C V2025 from chromobacterium violaceum (Chromobacterium. violaceum), (R)-
Transaminase MVTA from mycobacterium tuberculosis (Mycobacterium vanbaalenii)；Carbonyl reductase GoSCR carrys out autoxidation
Grape saccharobacillus (Gluconobacter oxydans), carbonyl reductase BDHA from bacillus subtilis (Bacillus subtilis), glucose dehydrogenase GDH from bacillus subtilis (Bacillus subtilis)；Recombinant bacteriumE. coli
(BDHA-GDH) andE. coli(GoSCR-GDH) co-expresses carbonyl reductase and glucose dehydrogenase respectively.
6. the side that a kind of Whole Cell Biocatalysis according to claim 4 prepares chiral vicinal amino alcohols and chiral diol simultaneously
Method, it is characterised in that: the substrate is racemization benzene glycinol or racemization 1- hydroxyl -2- butanol.
7. the side that a kind of Whole Cell Biocatalysis according to claim 4 prepares chiral vicinal amino alcohols and chiral diol simultaneously
Method, it is characterised in that: the whole-cell catalytic synthetic reaction carries out under the conditions of 200 rpm of speed of agitator.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910022950.7A CN109666715A (en) | 2019-01-10 | 2019-01-10 | A kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910022950.7A CN109666715A (en) | 2019-01-10 | 2019-01-10 | A kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109666715A true CN109666715A (en) | 2019-04-23 |
Family
ID=66150602
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910022950.7A Pending CN109666715A (en) | 2019-01-10 | 2019-01-10 | A kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109666715A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941045A (en) * | 2021-02-05 | 2021-06-11 | 南京红杉生物科技有限公司 | Recombinant transaminase and method for synthesizing L-phenylglycinol |
| CN112941124A (en) * | 2021-02-09 | 2021-06-11 | 江苏阿尔法药业股份有限公司 | Method for preparing eligerstrode intermediate through whole-cell catalysis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101857887A (en) * | 2010-06-13 | 2010-10-13 | 江南大学 | Method for preparing optically pure aryl alcohol with cell-free extracts of recombinant strains by catalytic asymmetric conversion |
| CN102241596A (en) * | 2011-04-20 | 2011-11-16 | 厦门大学 | O-aminoalcohol compounds, preparation method thereof and application thereof |
| US20170067084A1 (en) * | 2015-09-03 | 2017-03-09 | National University Of Singapore | Production of chiral 1,2-amino alcohols and alpha-amino acids from alkenes by cascade biocatalysis |
-
2019
- 2019-01-10 CN CN201910022950.7A patent/CN109666715A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101857887A (en) * | 2010-06-13 | 2010-10-13 | 江南大学 | Method for preparing optically pure aryl alcohol with cell-free extracts of recombinant strains by catalytic asymmetric conversion |
| CN102241596A (en) * | 2011-04-20 | 2011-11-16 | 厦门大学 | O-aminoalcohol compounds, preparation method thereof and application thereof |
| US20170067084A1 (en) * | 2015-09-03 | 2017-03-09 | National University Of Singapore | Production of chiral 1,2-amino alcohols and alpha-amino acids from alkenes by cascade biocatalysis |
Non-Patent Citations (1)
| Title |
|---|
| JIAN-WEI ZHAO等: "One pot simultaneous preparation of both enantiomer of β-amino alcohol and vicinal diol via cascade biocatalysis", 《BIOTECHNOL LETT》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941045A (en) * | 2021-02-05 | 2021-06-11 | 南京红杉生物科技有限公司 | Recombinant transaminase and method for synthesizing L-phenylglycinol |
| CN112941045B (en) * | 2021-02-05 | 2023-07-21 | 南京红杉生物科技有限公司 | Recombinant aminotransferase and method for synthesizing L-phenylglycinol |
| CN112941124A (en) * | 2021-02-09 | 2021-06-11 | 江苏阿尔法药业股份有限公司 | Method for preparing eligerstrode intermediate through whole-cell catalysis |
| CN112941124B (en) * | 2021-02-09 | 2023-12-29 | 江苏阿尔法药业股份有限公司 | Method for preparing irinotecan intermediate by whole cell catalysis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Um et al. | Sungsanpin, a lasso peptide from a deep-sea streptomycete | |
| Xu et al. | Analysis of intact and dissected fungal polyketide synthase-nonribosomal peptide synthetase in vitro and in Saccharomyces cerevisiae | |
| Simpson et al. | Microbiological transformations: 49. Asymmetric biocatalysed Baeyer–Villiger oxidation: improvement using a recombinant Escherichia coli whole cell biocatalyst in the presence of an adsorbent resin | |
| Luesch et al. | Biosynthesis of 4-Methylproline in Cyanobacteria: cloning of n osE and n osF genes and biochemical characterization of the encoded dehydrogenase and reductase activities | |
| JP2942574B2 (en) | Glycosidase inhibitor salbostatin and its preparation | |
| Samland et al. | The transaldolase family: new synthetic opportunities from an ancient enzyme scaffold | |
| US20020137152A1 (en) | Fermentation process for epothilones | |
| CN105579585A (en) | Method for producing ambrein | |
| Barredo et al. | Microbial enzymes and biotransformations | |
| WO2008046328A1 (en) | A levorotatory lactonohydrolase producing strain and its use for producing chiral oxyacid | |
| CN106591330B (en) | Trans-L-1,2-proline-4- '-hydroxylase gene, enzyme, carrier, engineering bacteria and application | |
| CN109666715A (en) | A kind of method that Whole Cell Biocatalysis prepares chiral vicinal amino alcohols and chiral diol simultaneously | |
| CN110172484A (en) | A method of cascade biocatalysis alkene asymmetric amine hydroxylation prepares chiral β-amino alcohols | |
| CN103168047A (en) | Polypeptide associated with the synthesis of 1-deoxynojirimycin, and a use therefor | |
| CN104152506A (en) | Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system | |
| CN106995808A (en) | One kind restructuring transaminase and its application | |
| Molloy et al. | Biological characterization of the hygrobafilomycin antibiotic JBIR-100 and bioinformatic insights into the hygrolide family of natural products | |
| JPH0415236B2 (en) | ||
| Shen et al. | Saccharochelins A–H, Cytotoxic Amphiphilic Siderophores from the Rare Marine Actinomycete Saccharothrix sp. D09 | |
| CN103403174B (en) | The enzyme' s catalysis of active pharmaceutical ingredient and its intermediate | |
| CN101215533A (en) | Hydantoin enzyme and carbamyl hydrolase producing strain, double enzyme gene and application for preparing L-amino acid | |
| CN100489095C (en) | Transformant for producing secondary metabolite modified with functional group and novel biosynthesis genes | |
| JPH10130269A (en) | Carboline derivative | |
| CN109762046B (en) | Cyclic peptide antibiotics, preparation method thereof and application thereof in preparation of anti-mycobacterium tuberculosis drugs | |
| CN111808893B (en) | Novel biological preparation method of amino alcohol drug intermediate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190423 |