CN109666627A - The method that small molecule inducing umbilical cord mesenchymal stem is divided into interstitial glands - Google Patents

The method that small molecule inducing umbilical cord mesenchymal stem is divided into interstitial glands Download PDF

Info

Publication number
CN109666627A
CN109666627A CN201910117913.4A CN201910117913A CN109666627A CN 109666627 A CN109666627 A CN 109666627A CN 201910117913 A CN201910117913 A CN 201910117913A CN 109666627 A CN109666627 A CN 109666627A
Authority
CN
China
Prior art keywords
day
umbilical cord
mesenchymal stem
proliferation
inducing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910117913.4A
Other languages
Chinese (zh)
Other versions
CN109666627B (en
Inventor
郭晓令
褚茂平
李超
葛仁山
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Original Assignee
Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University filed Critical Second Affiliated Hospital and Yuying Childrens Hospital of Wenzhou Medical University
Priority to CN201910117913.4A priority Critical patent/CN109666627B/en
Publication of CN109666627A publication Critical patent/CN109666627A/en
Application granted granted Critical
Publication of CN109666627B publication Critical patent/CN109666627B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0681—Cells of the genital tract; Non-germinal cells from gonads
    • C12N5/0683—Cells of the male genital tract, e.g. prostate, epididymis; Non-germinal cells from testis, e.g. Leydig cells, Sertoli cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/05—Inorganic components
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/135—Platelet-derived growth factor [PDGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/30—Hormones
    • C12N2501/31—Pituitary sex hormones, e.g. follicle-stimulating hormone [FSH], luteinising hormone [LH]; Chorionic gonadotropins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/999—Small molecules not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1346—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells
    • C12N2506/1369—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from mesenchymal stem cells from blood-borne mesenchymal stem cells, e.g. MSC from umbilical blood

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Reproductive Health (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention provides a kind of small molecule method that induction source of people umbilical cord mesenchymal stem cells are divided into interstitial glands and includes the following steps: 1. to obtain the source of people umbilical cord mesenchymal stem cells from people's umbilical cord, uses source of people umbilical cord mesenchymal stem cells described in differential medium culture.2. adding early differentiation inducer into differential medium carries out early differentiation induction.3. adding proliferation-inducing agent into differential medium carries out early stage rush proliferation-inducing.4. adding mid-term differentiating inducer into differential medium carries out mid-term induction.Promote proliferation-inducing 5. adding the proliferation-inducing agent into differential medium and carrying out mid-term.6. adding mature differentiating inducer into differential medium carries out advanced stage maturation induction.7. rejecting non-interstitial glands like cell manually.8. remaining cell enriched medium is continued to cultivate after rejecting interstitial glands like cell, it is final to obtain target interstitial glands.

Description

The method that small molecule inducing umbilical cord mesenchymal stem is divided into interstitial glands
Technical field
The present invention relates to field of medicaments more particularly to a kind of small molecule inducing umbilical cord mesenchymal stem to be divided between testis The method of cell plastid.
Background technique
The function that male reproductive health be unable to do without reproductive system is sound.Currently, the treatment method of hypoandrogenism is only stopped Stay in androgen replacement therapy.However, long-term androgen in treating can cause hepatic and renal function damage, immunity to reduce, water sodium pool The complication such as stay, and not by the regulation of itself circadian rhythm.Although interstitial glands (Leydig cell, LCs) transplanting can To avoid the certain complication of exogenous androgen replacement therapy bring, but interstitial glands source is insufficient and heteroplastic transplantation It may cause host immune rejection reaction and limit the application of interstitial glands clinically.
Currently, it is in solution generally acknowledged in the world that inducing adult stem cell, which is divided into interstitial glands as donor graft, State the breach of problem.Umbilical cord mesenchymal stem cells (UMSCs) itself have multi-lineage potential, under certain conditions, energy It is enough induced to differentiate into including osteoblast, cartilage cell, fat cell, the various kinds of cell including nerve cell.In addition, UMSCs also has the characteristic of low immunogenicity, can reduce the generation of immunological rejection, and UMSCs materials are relatively easy in addition, and will not Form tumour.Therefore interstitial glands are induced to differentiate to form with huge clinical value by UMSCs.
In the prior art, do not occur through small molecule that umbilical cord mesenchymal stem cells are induced to differentiate into interstitial tissue[of testis] is thin also The method of born of the same parents.Therefore, the present inventor proposes the technical solution of the application to this.
Summary of the invention
The present invention is based oneself upon using source of people UMSCs, and using small molecule rather than method of gene introduction induction UMSCs is divided into function The mature LCs (ALCs) of energy.
The method that small molecule inducing umbilical cord mesenchymal stem is divided into interstitial glands, the umbilical cord mesenchyma are dry thin Born of the same parents are source of people umbilical cord mesenchymal stem cells, and abductive approach includes the following steps:
1. obtaining the source of people umbilical cord mesenchymal stem cells from people's umbilical cord, cultivated using differential medium UMSC-DIM The source of people umbilical cord mesenchymal stem cells.Include DMEM-F12 in the differential medium, 5mM insulin, transferrin and The mixture of selenium, 10ng/mL interstitialcellstimulating hormone (ICSH), 0.2 μM of SAG, 2 μM of 22R-OHC and 5mM lithium chlorides.
2. adding early differentiation inducer into differential medium carries out early differentiation induction, the early differentiation inducer Including 0.5 μM of DHH agonist SAG, 2 μM of 22R-OHC and 10mM lithium chlorides.Preferably, differentiating inducer added one every 2 days It is secondary.
3. adding proliferation-inducing agent into differential medium carries out early stage rush proliferation-inducing, the proliferation-inducing agent includes 10ng/mL platelet derived growth factor AA and 10ng/mL fibroblast growth factor 2.Preferably, the proliferation-inducing agent every Addition in 1 day is primary.
4. adding mid-term differentiating inducer into differential medium carries out mid-term induction, the mid-term differentiating inducer Including 10ng/mL platelet derived growth factor AA, 5ng/mL activin A and 20 μM of male sex hormones.Preferably, mid-term differentiating inducer It is primary every addition in 2 days
Promote proliferation-inducing 5. adding the proliferation-inducing agent into differential medium and carrying out mid-term.Preferably, proliferation-inducing Agent is primary every addition in 1 day
6. adding mature differentiating inducer into differential medium carries out advanced stage maturation induction, the mature differentiation is lured Leading agent includes 20ng/mL interstitialcellstimulating hormone (ICSH) and 0.5 μM of SAG.Preferably, mature differentiating inducer is primary every addition in 2 days
7. rejecting non-ALC like cell manually.
8. remaining cell enriched medium is continued to cultivate after rejecting the non-ALC like cell, the enrichment culture Base periodic replacement, it is final to obtain target interstitial glands.Include in enriched medium DMEM-F12,1% fetal calf serum, 0.1% Sodium Pyruvate, 0.1%Glutamax, 1%P/S.
Further, defining the time that differential medium is added in the source of people umbilical cord mesenchymal stem cells is the 0th day.
Step 2. in, the early differentiation induction time is the 0th day to the 7th day, and the differentiating inducer addition time is 0th day, the 3rd day, the 4th day, the 6th day.
Step 3. in, early stage increment induction time is the 7th day to the 9th day, and the proliferation-inducing agent addition time is 7th day and the 8th day.
Step 4. in, the mid-term induction time be the 9th day to the 16th day, the mid-term differentiating inducer add when Between be the 9th day, the 11st day, the 13rd day, the 15th day.
Step 5. in, it is the time the 16th day to the 18th day that the mid-term, which promotees proliferation-inducing, when the proliferation-inducing agent is added Between be the 16th day, the 17th day.
Step 6. in, the advanced stage maturation induction time be the 18th day to the 21st day, it is described maturation differentiating inducer Adding the time is the 18th day, the 20th day.
Further, for the culture of source of people umbilical cord mesenchymal stem cells from human umbilical cord's sample, specific cultural method includes as follows Step:
The umbilical cord sample is impregnated and rinses using the PBS containing 1% gentamicin, the navel rejected on the umbilical cord sample is dynamic The umbilical cord sample is divided into lamellar structure block after arteries and veins.
With 0.1% clostridiopetidase A II to the lamellar structure block shaking table digestion 2 hours under the conditions of 37 DEG C, then carry out 2000rpm is centrifuged the supernatant that discards after twenty minutes, then with 0.25% trypsase resuspension cell in 37 DEG C of shaking tables again After digestion 30 minutes, the DMEM/F12+10% fetal calf serum+1%P/S that 1:1 is added terminates digestion, obtains digestive juice.
Liquid will be discarded supernatant after digestive juice filtering, centrifugation, then by remaining liq DMEM/F12+10% fetal calf serum + 1%P/S piping and druming mix after again be centrifuged after discard supernatant liquid, by remaining liquid with DMEM/F12+10% fetal calf serum+ 1%P/S is planted in culture bottle after being resuspended.
When the cell Proliferation in culture bottle is fused to 80%~90%, the pancreatin for containing 0.25% ethylenediamine tetra-acetic acid is used Secondary culture is carried out after digestion.
After such method, it is not introduced into foreign gene in cell differentiation procedure, is induced, is mentioned using small molecule completely The high safety of future clinical application；Small molecule Induction Process is flexibly controllable, avoids excessive induction, improves induction effect Rate；Abductive approach strong operability, it is reproducible, the interstitial glands for inducing energy Testosterone Secretion can be stablized, thus more suitable For future clinical application.
After such method, umbilical cord mesenchymal stem cells can be successfully induced to differentiate into the testis of energy Testosterone Secretion Ball interstitial cell, thus in future clinical practice, using the umbilical cord mesenchymal stem cells in autologous patient cell reprogramming source The interstitial glands of differentiation provide cell origin to carry out the diseases such as cellular transplantation therapy sexual disorder.
The present invention is further described in detail below in conjunction with attached drawing.
Detailed description of the invention
Fig. 1 is separation and culture umbilical cord mesenchymal stem cells (UMSCs): A is the UMSCs (P0) of originally culture；B is one Be commissioned to train feeding UMSCs (P1)；C is commissioned to train feeding UMSCs (P2) for two；D is the UMSCs (P3) of three generations's culture.
Fig. 2 is the expression of the flow cytometer showed UMSCs surface antigen of umbilical cord mesenchymal stem cells (UMSCs).
Fig. 3 is that histogram counts umbilical cord mesenchymal stem cells (UMSCs) flow cytometer showed datagram.
Fig. 4 is identifying at rouge osteogenic induction for umbilical cord mesenchymal stem cells (UMSCs): A is without adipogenic induction culture The UMSCs negative control group of base processing；B is UMSCs of the oil red O stain by the differentiation processing of adipogenic induction culture medium into the positive (at black arrow).
Fig. 5 be umbilical cord mesenchymal stem cells (UMSCs) osteogenic induction identification: A be without Osteogenic Induction Medium at The UMSCs negative control group of reason；B is UMSCs of the alkaline phosphatase staining by Osteogenic Induction Medium differentiation processing into the positive (at black arrow).
Fig. 6 is the induction differentiation schematic diagram that UMSCs is induced to differentiate into ALCs in differentiation liquid UMSC-DIM.
Fig. 7 is different time points induction differentiation during UMSCs is induced to differentiate into ALCs in breaking up liquid UMSC-DIM Target cell light field form.
Fig. 8 is measured by radioimmunoassay UMSCs (negative control), UMSC-ALCs (differentiation group) after LH is stimulated 3 hours With testosterone levels in ALCs (positive control) culture medium supernatant.
Fig. 9 is the target cell (UMSC-ALCs) of reverse transcription PCR (RT-PCR) identification induction differentiation: 100bp DNA Marker。
Figure 10 is that RT-PCR detects UMSCs (negative control), ALCs (positive control) and UMSC-ALCs (experimental group) base Because Lhcgr, Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3, Scarb1, Sf-1, CD29, CD44 and CD105 are expressed As a result.
Specific embodiment
In the following, being specifically described by illustrative embodiment to the present invention.It should be appreciated, however, that not chatting further In the case where stating, original part, structure and features in an embodiment can also be advantageously incorporated into other embodiments.
Hereinafter, interstitial glands are referred to as UMSC-ALC；Umbilical cord mesenchymal stem cells are referred to as UMSCs；Alkalinity at Fibroblast growth factor is referred to as bFGF；Li refers to lithium chloride (lithium chloride)；The derivative growth of human blood platelets because Sub- AA is referred to as PDGF-AA；Fibroblast growth factor 2 is referred to as FGF-2；Androgen is referred to as Androgen；Promote corpus luteum to generate Element is referred to as LH；Fetal calf serum is referred to as FBS；Sodium pyruvate refers to Sodium Pyruvate；SAG refers to the agonist of DHH； ITS includes: insulin, transferrin and selenium, i.e. insulin, transferrins and selenium mixture；Matrigel Refer to matrigel；EDTA is the abbreviation of ethylenediamine tetra-acetic acid；Gelatin refers to gelatin.
Hereinafter, providing embodiment to illustrate method described in the scheme of the invention.
Embodiment:
S1, source of people umbilical cord mesenchymal stem cells (UMSCs) is obtained:
It is required in strict accordance with sterile working, sterile umbilical cord sample (boy) will be taken out in operating room in superclean bench, It is immersed in the PBS containing 1% gentamicin to handle 30 minutes, then umbilical cord is transferred in culture dish with tweezers, is cut with scalpel Except the ligation of two sides surgical thread and extravasated blood part, the PBS containing 1% gentamicin is inhaled with 20mL syringe and rinses umbilical duct lumen, punching It washes twice, removes blood stains.
Remaining connective tissue is placed on containing in 1% gentamicin PBS after rejecting navel arteriovenous, umbilical cord is divided into 4~5 Part, average every part are about 3~4cm.Every sub-fraction is separated along longitudinal direction, umbilical cord tissue tubulose is made to become sheet. Sheet umbilical cord tissue is further separated, 2~3mm is cut into3The tissue block of size.
It is digested 2 hours with 0.1% clostridiopetidase A II in 37 DEG C of shaking tables, supernatant is abandoned in then 2000rpm centrifugation after twenty minutes, is used Cell is resuspended after 37 DEG C of shaking tables digest 30 minutes again in 0.25% trypsase, and 1:1 DMEM/F12+10%FBS+1% is added P/S terminates digestion.Digestive juice is filled into culture dish in 200 mesh filter screens, with 50mL centrifuge tube collect, 2000 revs/min from The heart 15 minutes.Supernatant is abandoned, is blown and beaten and is mixed with DMEM/F12+10%FBS+1%P/S, is put into a 50mL centrifuge tube, 2000 Rev/min centrifugation 15 minutes.Supernatant is abandoned, is planted in culture bottle after being resuspended with DMEM/F12+10%FBS+%P/S.It is changed after 3 days Liquid changed liquid every 2 days later, under the microscope.When cell Proliferation is fused to 80%~90%, pancreatin containing 0.25%EDTA is used Secondary culture is carried out after digestion, UMSCs needed for obtaining.
As shown in Figure 1, UMSCs can be extracted smoothly from umbilical cord tissue by II Collagenase Type digestion method.One As for, after incubation the 5th day, pass through and continuously changed the haemocyte that liquid removal suspends every 2 days, it is as shown in Figure 1A, most of The primary UMSCs (P0) of adherent growth can show good long Fusoid cells form.Cell continues to cultivate, and can be proliferated reach quickly To 80-90% Fusion Strain.Such as Figure 1B, shown, the first generation of secondary culture is obtained using 0.25%EDTA trypsin digestion UMSCs(P1)；As shown in Figure 1 C, the second generation UMSCs (P2) of acquisition；As shown in figure iD, the third generation UMSCs (P3) of acquisition.
Experimental example 1: flow cytometry umbilical cord mesenchymal stem cells
The UMSCs obtained of secondary culture in S1 is subjected to flow cytometry, concrete operations are as follows: by UMSCs Cell is with 1 × 106The density in a/hole is inoculated on 6 well culture plates, after cell covers with.With trypsase containing 0.25%EDTA Vitellophag, 1500 revs/min of centrifugations, 5 minutes collection UMSCs.PBS is cleaned 1 time, is then consolidated for 500 microlitre 4% 4 DEG C of paraformaldehyde Fixed to abandon fixer overnight, 2 milliliters of PBS concussions are resuspended, and supernatant is abandoned in centrifugation.10 points are closed with 2 milliliter 5% of FBS-PBS room temperature Clock, supernatant is abandoned in centrifugation, while Isotype control group is arranged.Fluorescence antibody FITC-CD29, FITC-CD44, FITC- is added by 1:50 (every 100 microlitres of 5 microlitres of antibody of 100 microlitres of CD59, FITC-CD90, PE-CD105, PE-CD166 and FITC-CD34 working solution Cell volume), room temperature is protected from light incubation 20 minutes, and supernatant is removed in centrifugation, and 500 microlitres of PBS are added and clean 3 times, finally with 200 microlitres PBS is resuspended, filtering and upper machine testing.
As shown in Fig. 2, P1 is shown for UMSCs streaming surface antigen testing result, the expression that isolated UMSCs can be positive CD29, CD44, CD59, CD90 and CD105, low expression level CD166, feminine gender expression CD34.And quantitative analysis is carried out to data After map, as a result as shown in Figure 3.
Experimental example 2, umbilical cord mesenchymal stem cells break up at rouge:
The UMSCs obtained of secondary culture in S1 is carried out into rouge Analytical Chemical Experiment, whether observation UMSCs, which can break up, is positive Normal fat cell.
By UMSCs cell with 1 × 106The density in a/hole is inoculated on 6 well culture plates.It is added after UMSCs cell is adherent Adipogenic induction culture medium carries out 2 weeks Fiber differentiations.Adipogenic induction culture medium main component include: P/S containing 100U/mL and The DMEM/LG of 10%FBS, 10 μM of insulin, 0.5mM isobutyl methylxanthine, 1 μM of dexamethasone and 200 μM of Indomethacins.
Then PBS is washed cell 3 times, and the formaldehyde room temperature for being added 10% fixes 30 minutes.Then PBS is washed 3 times cell again, is added The oil red O solution room temperature for entering 2% dyes 10 minutes.Finally bat is observed under 70% ethanol washing dyeing liquor and inverted microscope According to.
As shown in Figure 4 B, by 2 weeks adipogenic inductions, the lipochondrion formed after induction can dye red by oil red O, say Bright UMSCs is successfully induced to differentiate into fat cell.
The Osteoblast Differentiation of experimental example 3, umbilical cord mesenchymal stem cells:
The UMSCs obtained of secondary culture in S1 is subjected to Osteoblast Differentiation experiment, whether observation UMSCs, which can break up, is positive Normal osteocyte.
By UMSCs cell with 1 × 106The density in a/hole is inoculated on 6 well culture plates, and after cell is adherent, skeletonization is added Induced medium carries out induction 2 weeks.Osteogenic Induction Medium main component includes: P/S containing 100U/mL and 10%FBS DMEM/LG, 50 μM of ascorbyl phosphates, 1 μM of dexamethasone and 100 μM of glycerophosphates.
PBS is washed target cell 3 times, and the paraformaldehyde room temperature for being added 4% fixes 10 minutes.Then PBS washes 3 to cell again Time, it is added 37 DEG C of alkaline phosphatase enzyme solutions and dyes 15 minutes.It is finally washed with deionized under dyeing liquor and inverted microscope and sees It examines and takes pictures.
As shown in Figure 5 B, by 2 weeks osteogenic inductions, cell secretion generates the ECM rich in collagen of calcification after induction, leads to Parlkaline phosphatase is coloured to positive aobvious blue, illustrates that UMSCs is successfully induced to differentiate into osteocyte.
S2, small molecule inducing umbilical cord mesenchymal stem are divided into interstitial glands (UMSC-ALC):
By UMSCs cell with 1 × 105The density in a/hole is inoculated on 12 well culture plates, is covered with wait cultivate 5 days cells.Training Feeding base changes differential medium UMSC-DIM:DMEM-F12,5mM ITS (insulin, transferrin and selenium) into, 10ng/mL LH, 0.2 μM of SAG, 2 μM of 22R-OHC and 5mM Li (lithium chloride), this time point are defined as minute Change the 0th day.
Then in differentiation the 0th to 7 day, every 2 days additional 0.5 μM of SAG (DHH agonist) into differentiation liquid, 2 μM of 22R- OHC and 10mM Li carries out early differentiation induction.
Differentiation the 7th to 9 day, every 1 day to differentiation liquid in additional 10ng/mL PDGF-AA and 10 ng/mL FGF2, into Row early stage promotees proliferation-inducing.
In differentiation the 9th to 16 day, every 2 days additional 10ng/mL PDGF-AA, 5ng/mL Activin into differentiation liquid A, and 20 μM of Androgen carry out mid-term induction.
Differentiation the 16th to 18 day, every 1 day to differentiation liquid in additional 10ng/mL PDGF-AA and 10 ng/mL FGF2, It carries out mid-term and promotees proliferation-inducing.
Advanced stage was carried out every 2 days additional 20ng/mL LH and 0.5 μM of SAG into differentiation liquid in differentiation the 18th to 21 day Mature induction.
UMSCs changes 1 fresh differentiation liquid UMSC-DIM for every 2 days and (now matches coinduction 21 days in differentiation liquid UMSC-DIM It is current).After induction differentiation 21 days, non-ALC like cell is rejected using self-control glass cell scraper manually under the microscope, it is remaining adherent Cell is enriched with for centrifugation 5 minutes using 1000 revs/min after 0.25%EDTA digestion, using enriched medium Enrichment Medium:DMEM-F12+1% FBS+1 × Sodiumpyruvate+1 × Glutamax+1%P/S is transferred in advance after being resuspended Enrichment culture 7 days, i.e., the 28th day in the 6 orifice plates of 1%Matrigel Coating processing (37 DEG C be incubated for 1 hour or more).Then Break up obtained target cell and carries out subsequent identification and analysis.Specific experiment step is as shown in Figure 6.
Differentiation the 0th day is defined as when UMSCs culture medium UMSC Medium is changed to differential medium UMSC-DIM, this When cell be in fine and close shuttle shape structure, growth conditions are good.
In induction differentiation the 16th day, significant changes occurred for cellular morphology, were in ovarian follicle shape, and refractivity is strong.
As shown in fig. 7, induction differentiation the 21st day, cellular morphology is oval and shuttle shape admixture, refractivity decline.
By the UMSC-ALCs of manual enrichment after induction differentiation, 100ng/ml LH (maximal stimulation is added in the medium Concentration) culture 3 hours, culture medium is collected, measures culture medium supernatant testosterone, specific steps are as shown in experimental example 4.
Experimental example 4, radioimmunoassay measure serum testosterone
Prepare TBS-G solution: 1g gelatin, 4.4g Trizma HCl, 2.65g Trizma Base, 5.84NaCl 1L distilled water is dissolved in 1g Na Azide.
Add 500 microlitres of TBS-G in label TC pipe (not having to activated carbon adsorption, survey complete emittance value).
Add 500 microlitres of TBS-G in label NBS pipe (antibody being not added, for measuring non-specific binding value).
Add 200 microlitres of TBS-G and 100 microlitre of samples in label sample cell.
Label standard quality control 300 microlitres of various concentrations of Guan Zhongjia standard items (pik/100 microlitre 10-2000,8 Concentration).
In addition to TC pipe and NBS pipe, every pipe adds 200 microlitres of testosterone antibody.Every pipe adds 300 microlitres of Tracer (3H- testosterones- TBS-G solution), oscillation, 4 DEG C are overnight.In addition to TC pipe, every pipe adds 200 microlitres of activated carbon/dextrans (for absorption and antibody In conjunction with testosterone) and place 20 minutes, oscillation, 1800g be centrifuged 10 minutes.Supernatant is carefully added into and dodges liquid containing 5 milliliters of liquid In bottle, notice that not allowing activated carbon to enter liquid dodges bottle, mixing of then turning upside down in the process.Liquid dodges measurement.It imitates the inside of detection It should be 15% with external effect difference.
As shown in figure 8, UMSC-ALCs can be with Testosterone Secretion, and it is higher than negative control UMSCs, but is below positive control ALCs。
Gene expression identification is carried out to differentiation target cell (UMSC-ALCs), detects interstitial glands correlating markings gene Lhcgr, Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3, Scarb1, Sf-1 and umbilical cord mesenchymal stem cells (UMSCs) surface specific marker's PROTEIN C D29, CD44, the expression of CD105.Concrete operations are as shown in experimental example 5.
Reverse transcription PCR (RT-PCR) detection of experimental example 5, cell
The total RNA of group of cells is extracted using Trizol (Invitrogen, the U.S.), and measures OD, guarantees to extract each group RNA OD260/OD280Value is between 1.8 and 2.1, to guarantee its purity.Then total serum IgE using Reverse Transcriptase kit (Japan spin, Japan) reverse transcription is carried out into cDNA, reaction system and response procedures referring to product description.CDNA is used to do RT-PCR, primer Sequence uses:
Lhcgr-F:CACATAACCACCATACCAGGAAA；
Lhcgr-R:AAGTCAGTGTCGTCCCATTGA；
Star-F:CAGGACCTTGGCTCCGGATT；
Star-R:GGGAGTGGAACCCCAATGTC；
Cyp11a1-F:GCAGTGTCTCGGGACTTCG；
Cyp11a1-R:GGCAAAGCGGAACAGGTCA；
Hsd3b1-F:CACATGGCCCGCTCCATAC；
Hsd3b1-R:GTGCCGCCGTTTTTCAGATTC；
Cyp17a1-F:TATGGCCCCATCTATTCGGTT；
Cyp17a1-R:GCGATACCCTTACGGTTGTTG；
Hsd17b3-F:GTCAACAATGTCGGAATGCTTC；
Hsd17b3-R:TGATGTTACAATGGATGAGGCTC；
Scarb1-F:GTCGCAGGCATTGGACAAAC；
Scarb1-R:CAGGACCTTGGCTCCGGATT；
Sf-1-F:GGAGGCTTGCGAAGGAGAAG；
Sf-1-R:AGCTTACCCAACGGCGTG；
CD29-F:GGAGTCGCGGAACAGCA；
CD29-R:AGCAAACACACAGCAAACTGAA；
CD44-F:CTGCCGCTTTGCAGGTGTA；
CD44-R:CATTGTGGGCAAGGTGCTATT；
CD105-F:TGCACTTGGCCTACAATTCCA；
CD105-R:AGCTGCCCACTCAAGGATCT；
GADPH-F:ACAACTTTGGTATCGTGGAAGG；
GADPH-R:GCCATCACGCCACAGTTTC。
Wink from rear upper machine, 95 DEG C initial denaturation 3 minutes, react (95 DEG C, 10 seconds of 35 circulations；60 DEG C, 30 seconds).After reaction It is analyzed according to Ct Data-Statistics, draws standard curve, using based on Ct (2-ΔΔCt) method progress quantitative analysis.
Reverse transcription PCR (RT-PCR) testing result such as Fig. 9, Figure 10 show that induction differentiation target cell UMSC-ALCs can be positive Express interstitial glands mark of correlation gene Lhcgr, Star, Cyp11a1, Hsd3b1, Cyp17a1, Hsd17b3, Scarb1 And Sf-1, feminine gender expression umbilical cord mesenchymal stem cells correlation mark gene C D29, CD44 and CD105 (Fig. 5).This experimental result mentions Show, on the basis of breaking up liquid UMSC-DIM, additional SAG, 22R-OHC, Li, PDGF-AA, FGF2, Activin A, Androgen, LH small molecule successfully can induce UMSCs to be divided into ALCs
This specific embodiment is only explanation of the invention, is not limitation of the present invention, those skilled in the art Member can according to need the modification that not creative contribution is made to the present embodiment after reading this specification, but as long as at this All by the protection of Patent Law in the scope of the claims of invention.

Claims (6)

1. the method that small molecule inducing umbilical cord mesenchymal stem is divided into interstitial glands, it is characterised in that: the umbilical cord Mescenchymal stem cell is source of people umbilical cord mesenchymal stem cells, and abductive approach includes the following steps:
1. the source of people umbilical cord mesenchymal stem cells are obtained from people's umbilical cord, using between source of people umbilical cord described in differential medium culture Mesenchymal stem cells；
2. adding early differentiation inducer into differential medium carries out early differentiation induction, the early differentiation inducer includes 0.5 μM of DHH agonist SAG, 2 μM of 22R-OHC and 10mM lithium chlorides；
3. adding proliferation-inducing agent into differential medium carries out early stage rush proliferation-inducing, the proliferation-inducing agent includes 10ng/ ML platelet derived growth factor AA and 10ng/mL fibroblast growth factor 2；
4. adding mid-term differentiating inducer into differential medium carries out mid-term induction, the mid-term differentiating inducer includes 10ng/mL platelet derived growth factor AA, 5ng/mL activin A and 20 μM of male sex hormones；
Promote proliferation-inducing 5. adding the proliferation-inducing agent into differential medium and carrying out mid-term；
6. adding mature differentiating inducer into differential medium carries out advanced stage maturation induction, the maturation differentiating inducer Including 20ng/mL interstitialcellstimulating hormone (ICSH) and 0.5 μM of SAG；
7. rejecting non-interstitial glands like cell manually；
8. remaining cell enriched medium is continued to cultivate after rejecting the non-interstitial glands like cell, it is final to obtain Target interstitial glands.
2. the method that small molecule inducing umbilical cord mesenchymal stem according to claim 1 is divided into interstitial glands, It is characterized by: step 1. described in include DMEM-F12 in differential medium, 5mM insulin, transferrin and selenium it is mixed Close object, 10ng/mL interstitialcellstimulating hormone (ICSH), 0.2 μM of SAG, 2 μM of 22R-OHC and 5mM lithium chlorides.
3. the side that small molecule inducing umbilical cord mesenchymal stem according to claim 1 or 2 is divided into interstitial glands Method, it is characterised in that: include DMEM-F12,1% fetal calf serum, 0.1% Sodium Pyruvate, 0.1% in the enriched medium Glutamax, 1%P/S.
4. the method that small molecule inducing umbilical cord mesenchymal stem according to claim 3 is divided into interstitial glands, It is characterized by: step 2. in, the differentiating inducer is primary every addition in 2 days；Step 3. in, the proliferation-inducing agent every Addition in 1 day is primary；Step 4. in, the mid-term differentiating inducer is primary every addition in 1 day；Step 5. in, the proliferation-inducing Agent is primary every addition in 1 day；Step 6. in, the maturation differentiating inducer is primary every addition in 2 days.
5. the method that small molecule inducing umbilical cord mesenchymal stem according to claim 4 is divided into interstitial glands, It is characterized by: the time that differential medium is added in the source of people umbilical cord mesenchymal stem cells is the 0th day by definition；
Step 2. in, the early differentiation induction time is the 0th day to the 7th day, and the differentiating inducer addition time is the 0th It, the 2nd day, the 4th day, the 6th day；
Step 3. in, early stage increment induction time is the 7th day to the 9th day, and the proliferation-inducing agent addition time is the 7th day With the 8th day；
Step 4. in, the mid-term induction time is the 9th day to the 16th day, and the mid-term differentiating inducer addition time is 9th day, the 11st day, the 13rd day, the 15th day；
Step 5. in, it is the time the 16th day to the 18th day that the mid-term, which promotees proliferation-inducing, and the proliferation-inducing agent addition time is 16th day, the 17th day；
Step 6. in, the advanced stage maturation induction time be the 18th day to the 21st day, it is described maturation differentiating inducer addition Time is the 18th day, the 20th day.
6. the method that small molecule inducing umbilical cord mesenchymal stem according to claim 5 is divided into interstitial glands, It is characterized in that, the culture of source of people umbilical cord mesenchymal stem cells, from human umbilical cord's sample, specific cultural method includes the following steps:
The umbilical cord sample is impregnated and rinses using the PBS containing 1% gentamicin, after rejecting the arteria umbilicalis on the umbilical cord sample The umbilical cord sample is divided into lamellar structure block；
With 0.1% clostridiopetidase A II to the lamellar structure block shaking table digestion 2 hours under the conditions of 37 DEG C, then carry out 2000rpm is centrifuged the supernatant that discards after twenty minutes, then with 0.25% trypsase resuspension cell in 37 DEG C of shaking tables again After digestion 30 minutes, the DMEM/F12+10% fetal calf serum+1% dual anti-(P/S) that 1:1 is added terminates digestion, obtains digestive juice；
Liquid will be discarded supernatant after digestive juice filtering, centrifugation, then by remaining liq DMEM/F12+10% fetal calf serum+1% P/S piping and druming discards supernatant liquid after being centrifuged again after mixing, by remaining liquid DMEM/F12+10% fetal calf serum+1%P/S It is planted in culture bottle after resuspension；
When the cell Proliferation in culture bottle is fused to 80%~90%, digested using the pancreatin containing 0.25% ethylenediamine tetra-acetic acid After carry out secondary culture.
CN201910117913.4A 2019-02-15 2019-02-15 Method for inducing umbilical cord mesenchymal stem cells to differentiate into testicular interstitial cells by using small molecules Active CN109666627B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910117913.4A CN109666627B (en) 2019-02-15 2019-02-15 Method for inducing umbilical cord mesenchymal stem cells to differentiate into testicular interstitial cells by using small molecules

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910117913.4A CN109666627B (en) 2019-02-15 2019-02-15 Method for inducing umbilical cord mesenchymal stem cells to differentiate into testicular interstitial cells by using small molecules

Publications (2)

Publication Number Publication Date
CN109666627A true CN109666627A (en) 2019-04-23
CN109666627B CN109666627B (en) 2023-01-17

Family

ID=66152005

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910117913.4A Active CN109666627B (en) 2019-02-15 2019-02-15 Method for inducing umbilical cord mesenchymal stem cells to differentiate into testicular interstitial cells by using small molecules

Country Status (1)

Country Link
CN (1) CN109666627B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103589683A (en) * 2013-08-12 2014-02-19 北京东方华辉生物医药科技有限公司 Separation method and culture method for umbilical cord mesenchymal stem cells
CN106282104A (en) * 2016-07-29 2017-01-04 中卫华医（北京）生物科技有限公司 The method of effective acquisition mescenchymal stem cell from umbilical cord tissue
CN106929466A (en) * 2015-12-30 2017-07-07 中国医学科学院基础医学研究所 Inducing mesenchymal stem cell directed differentiation is method of Leydig cells and application thereof
CN108486039A (en) * 2018-04-04 2018-09-04 温州医科大学附属第二医院、温州医科大学附属育英儿童医院 The method that small molecule induction human adipose-derived stem cell is divided into interstitial glands
CN108588004A (en) * 2018-04-09 2018-09-28 深圳市莱利赛生物科技有限公司 The method of induction differentiation interstitial glands and its application in sexual function recovery
CN108795843A (en) * 2018-06-01 2018-11-13 温州医科大学附属第二医院、温州医科大学附属育英儿童医院 The method that small molecule induction induced multipotent stem cell is divided into interstitial glands

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103589683A (en) * 2013-08-12 2014-02-19 北京东方华辉生物医药科技有限公司 Separation method and culture method for umbilical cord mesenchymal stem cells
CN106929466A (en) * 2015-12-30 2017-07-07 中国医学科学院基础医学研究所 Inducing mesenchymal stem cell directed differentiation is method of Leydig cells and application thereof
CN106282104A (en) * 2016-07-29 2017-01-04 中卫华医（北京）生物科技有限公司 The method of effective acquisition mescenchymal stem cell from umbilical cord tissue
CN108486039A (en) * 2018-04-04 2018-09-04 温州医科大学附属第二医院、温州医科大学附属育英儿童医院 The method that small molecule induction human adipose-derived stem cell is divided into interstitial glands
CN108588004A (en) * 2018-04-09 2018-09-28 深圳市莱利赛生物科技有限公司 The method of induction differentiation interstitial glands and its application in sexual function recovery
CN108795843A (en) * 2018-06-01 2018-11-13 温州医科大学附属第二医院、温州医科大学附属育英儿童医院 The method that small molecule induction induced multipotent stem cell is divided into interstitial glands

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HERVÉ LEJEUNE等: "Stimulating effect of both human recombinant inhibin A and activin A on immature Leydig cell functions in vitro", 《ENDOCRINOLOGY》 *
XIAOYU XING等: "Differentiation of human umbilical cord mesenchymal stem cells into steroidogenic cells in vitro", 《EXPERIMENTAL AND THERAPEUTIC MEDICINE》 *

Also Published As

Publication number Publication date
CN109666627B (en) 2023-01-17

Similar Documents

Publication Publication Date Title
JP4971787B2 (en) Use of adipose tissue-derived cells in the treatment of cardiovascular disease
US11098280B2 (en) Serum-free culture medium and preparation method and application therefor
EP3307341B1 (en) Mechanical apparatus and method for isolating stromal vascular fraction
CN109749986A (en) A method of broken up by human pluripotent stem cells and obtains diabetes and beta Cell of islet
CN104762257B (en) A kind of method preparing mescenchymal stem cell from umbilical cord
CN105219707B (en) A kind of method of recovery fat mesenchymal stem cell
CN110885786B (en) Application of cytokine in promoting secretion of dental pulp stem cells into exosome
US20100310527A1 (en) Liposome mediated delivery of lineage determining factors
JP6781752B2 (en) Composition that rapidly separates fatty stromal cells
CN108685948A (en) A kind of preparation method of new medical cell repair agent
CN108795843A (en) The method that small molecule induction induced multipotent stem cell is divided into interstitial glands
CN109837239A (en) A kind of human adipose-derived stem cell originally culture and the multidirectional method of inducing differentiation of serum-free
CN107217028A (en) A kind of organization engineering skin containing appendicle and preparation method thereof
CN105062970B (en) A kind of derivant and induction differentiation complete medium that mescenchymal stem cell is induced to neuroblast
Taha et al. Adipose-derived stem/progenitor cells from lipoaspirates: A comparison between the Lipivage200-5 liposuction system and the Body-Jet liposuction system
CN108486039A (en) The method that small molecule induction human adipose-derived stem cell is divided into interstitial glands
CN101629164A (en) Method for obtaining mesenchyma stromal cells from connective tissue
CN109666627A (en) The method that small molecule inducing umbilical cord mesenchymal stem is divided into interstitial glands
WO2019237812A1 (en) Adipose tissue digestive juice and method for rapidly obtaining stromal vascular fraction cells
CN106591230A (en) Human umbilical cord mesenchymal stem cell culture solution and culture method thereof
Aljitawi et al. Generating CK19-positive cells with hair-like structures from Wharton's jelly mesenchymal stromal cells
CN113403272B (en) Culture medium of primary umbilical cord mesenchymal stem cells and application thereof
BR112020004517A2 (en) stem cells derived from newborn pig and process for their preparation
CN115637252A (en) Human umbilical cord mesenchymal stem cell chondrogenic induced differentiation culture medium, preparation method and application thereof
CN106318979A (en) Method for inducing transdifferentiation of mesenchymal stem cells into skin stem cells

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant