CN109652540A - A kind of thyroid cancer early detection molecular marker and its application - Google Patents
A kind of thyroid cancer early detection molecular marker and its application Download PDFInfo
- Publication number
- CN109652540A CN109652540A CN201811572052.0A CN201811572052A CN109652540A CN 109652540 A CN109652540 A CN 109652540A CN 201811572052 A CN201811572052 A CN 201811572052A CN 109652540 A CN109652540 A CN 109652540A
- Authority
- CN
- China
- Prior art keywords
- carmil2
- fyb1
- thyroid cancer
- kit
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses a kind of thyroid cancer early detection molecular marker, the molecular marker is FYB1 and CARMIL2；The molecular marker is related to the generation of thyroid gland carninomatosis；And provide a kind of thyroid cancer detection kit, the expression that the kit passes through detection subject FYB1 and CARMIL2, it may determine that whether subject suffers from thyroid cancer or judge that subject whether there is the risk with thyroid cancer, so that clinician be instructed to provide prevention scheme or therapeutic scheme to subject.For the cause of disease pathogenesis for further studying thyroid cancer, the drug target for exploring thyroid cancer early prevention and treatment provides new direction.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to a kind of thyroid cancer early detection molecular marker and its answer
With.
Background technique
Thyroid gland is endocrine organ important in human body, secretion control heart rate, blood pressure, body temperature and weight etc. and metabolism phase
The hormone of pass.Thyroid cancer (thytoid carcinoma, TC) is that one kind made of being developed as thyroid follicular cells is common
The pernicious endocrine system carcinoma of incidence accounts for about the 3% of whole body Incidence sum, accounts for head-neck malignant tumor morbidity
First place is mainly in person between twenty and fifty, is common in 45-54 years old crowd, and 45 years old or more high-incidence, and women is common, and men and women's disease rates are about
1:3.The trend risen is presented in the morbidity of thyroid cancer in recent years, and 2012, there are about four Wan Duoming women and a Wan Duoming in the U.S.
Male is diagnosed as thyroid cancer, the disease incidence of thyroid cancer rise to Cancer Mortality from the 5th；In China, first shape
Gland cancer morbidity also shows increased trend year by year, and most for the female malignant rate of climb in the spectrum of Cancer in China in the past 20 years
Fast tumour.Thyroid cancer all has higher disease incidence in various regions, has become most common and disease incidence rapid increase
One of malignant tumour, histological type mainly includes papillary carcinoma (PCT), filter blocking cancer (FTC), cephaloma (MTC) and
Undifferentiated carcinoma (ATC).Wherein papillary carcinoma is the most common histological type in thyroid cancer, accounts for about 60%~80%.Although absolutely
Most of thyroid cancers can be treated by operation and iodine therapy, but still have 10%~20% patient because of low differentiation and progressivity
Tumour and it is dead.Medullary carcinoma of thyroid gland and undifferentiated carcinoma more after it is worse.Radiation and chemotherapy for thyroid cancer curative effect all compared with
Difference, or even without effect.
The clinical sign of thyroid cancer is main performance with the hard out-of-flatness of tubercle, while with cervical lymph node enlargement,
Patient often feels neck pressure symptom, and thyroid cancer early clinic symptom is unobvious, and disease progression is slow, and patient is mostly without conscious disease
Shape, terminal stage of a disease may occur in which a variety of symptoms, the performance including hoarseness, dysphagia and ear, neck, shoulder etc. pain.
As the fast development and the mankind of Protocols in Molecular Biology and immunological technique recognize thyroid cancer pathogenesis
It deepens continuously, the work that people study the molecular mechanism of thyroid cancer biological behaviour is increasingly goed deep into.Gene therapy by
Gradually become the important component in oncobiology treatment, good application value shown in the treatment of thyroid cancer,
And certain effect is achieved, a promising therapeutic choice is increasingly become.Researcher wants to find assistance diagnosis, control
It treats, the tumor markers of even judging prognosis, seeks new effectively treatment of thyroid carcinoma target spot and new treatment plan for clinic
Foundation is slightly provided.
Summary of the invention
The purpose of the present invention is to provide a kind of molecular markers and molecule mark that can be used for thyroid cancer early diagnosis
Will object is preparing the application in diagnosis of thyroid cancer product.
To achieve the goals above, the present invention adopts the following technical scheme:
First the present invention provides a kind of thyroid cancer early detection molecular marker, the molecular marker be FYB1 and
CARMIL2；The molecular marker is related to the generation of thyroid gland carninomatosis.
Preferably, FYB1 the and CARMIL2 gene expresses downward in human thyroid carcinoma.
Further, the present invention provides the molecular markers to prepare the application in diagnosis of thyroid cancer product.
Preferably, the product includes: miscellaneous by real-time PCR, Westernblot method, immune detection, original position
Hand over the expression of detection FYB1 and CARMIL2 gene and its expression product with the product of Diagnosis of Thyroid Carcinoma.
Preferably, the product includes preparation, chip or kit.
In the present invention, " chip ", " microarray ", " array " can be with equivalent substitutes, including but not limited to: the micro- battle array of DNA
Column (for example, cDNA microarray and oligonucleotide microarray), protein microarray, micro-array tissue, transfection or cell microarray,
Chemical compound microarray and Antibody microarray.The DNA microarray of commonly referred to as genetic chip, DNA chip or biochip is
The set of microcosmic DNA point, these points are connected on the surface of solids (for example, glass, plastics or silicon chip), are formed for thousands of
Kind gene carries out the array of expression pattern analysis or expression monitoring simultaneously.Fixed DNA fragmentation is known as probe, it is thousands of can
For in single DNA microarray.Microarray can be used for identifying disease by comparing the gene expression in disease and normal cell
Gene or transcript (for example, ncRNA).Multiple technologies can be used to be manufactured for microarray, including but not limited to: being printed with apicule needle
It brushes on glass slide, carries out photoetching using prefabricated mask, carries out photoetching, ink jet printing or microelectrode using dynamic micro mirror element
Electrochemical method on array.
In the present invention, " preparation " may include probe, primer.
" probe " refers to can be with the molecule in conjunction with the particular sequence of another molecule or subsequence or other parts.Unless another
It points out, term " probe " is often referred to match and another polynucleotides (often referred to as " target polynucleotide ") by complementary base
In conjunction with polynucleotide probes.Lack sufficient sequence complementarity according to the stringency of hybridization conditions, probe energy and with the probe
Target polynucleotide combines.Probe can make direct or indirect label, and range includes primer.Crossing system, including, but it is unlimited
In: solution phase, solid phase, mixed phase or in situ hybridization measuring method.
Further, the present invention provides a kind of thyroid cancer detection kit, the kit include detection FYB1 and
The reagent of CARMIL2 gene expression dose, and how to use the explanation of the kit.
Preferably, the kit includes the primer pair or probe for detecting FYB1 and CARMIL2 gene.
Preferably, the nucleotide sequence of the primer of the specific amplified FYB1 and CARMIL2 gene is as follows:
FYB1:
SEQID NO.1TCTTCGGGGTCATTGTGTGC；
SEQID NO.2GGCTGGCATTTCCTTGGTTG；
CARMIL2:
SEQID NO.3TCCTGAGCCGTCCTAACGTA；
SEQID NO.4GGGAGGCTGTTGGCTACAC。
Preferably, detect that the FYB1 conserved sequence is to detect that the CARMIL2 is conservative shown in SEQ ID NO:7
Sequence is shown in SEQ ID NO:8.
Further, the present invention provides FYB1 and/or CARMIL2 promotors in the drug for preparing treatment thyroid cancer
Application in composition.
Preferably, the promotor includes improving FYB1 and/or CARMIL2 gene or its expression product stability, up-regulation
The expression of FYB1 and/or CARMIL2 gene or its expression product increases FYB1 and/or CARMIL2 gene expression product
Activity.
In general, these promotors can be formulated in nontoxic, inert and pharmaceutically acceptable aqueous carrier medium,
Wherein pH is usually about 5-8, and preferably pH is about 6-8, although pH value can be with the property and disease to be treated for being formulated substance
Disease and be varied.Prepared pharmaceutical composition can be administered by conventional route, including (but being not limited to):
It is intramuscular, peritonaeum is interior, intravenous, subcutaneous, intradermal or local administration.
As a kind of preferred embodiment of the invention, the promotor of the FYB1 and/or CARMIL2 be a kind of FYB1 and/or
The expression vector of CARMIL2.The expression vector is usually also containing promoter, replication orgin and/or marker gene etc..
Method well-known to those having ordinary skill in the art can be used to construct the required expression vector of the present invention.These methods include
Recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc..The expression vector preferably includes one or more
Selected marker, to provide the phenotypic character for selecting the host cell of conversion, such as kalamycin, gentamicin, tide
Mycin, amicillin resistance.
In the present invention, be various carriers known in the art, such as commercially available carrier including plasmid, clay, bacteriophage,
Virus etc..It is poly- that electroporation, calcium phosphate method, liposome method, the Portugal DEAE can be used in importing of the expression vector into host cell
Sugared method, microinjection, virus infection, the known method such as combination of liposome transfection and cell-membrane permeable peptide.
In the present invention, " host cell " can be prokaryotic cell, such as bacterial cell；Or low eukaryocyte, such as ferment
Mother cell；Or higher eucaryotic cells, such as mammalian cell.Representative example has: Escherichia coli, and the bacterium of streptomyces is thin
Born of the same parents；Fungal cell's such as yeast；Plant cell；The insect cell of drosophila S2 or Sf9；The zooblast of CHO, COS or 293 cells
Deng.
It can be carried out with routine techniques well known to those skilled in the art with recombinant DNA conversion host cell.When host is original
When core biology such as Escherichia coli, the competent cell that can absorb DNA can harvest after exponential phase of growth, use CaCl2Method processing, institute
With the step of it is generally well-known in the art.Another method is using MgCl2.If desired, conversion can also use the side of electroporation
Method carries out.When host is eucaryote, following DNA transfection method can be selected: calcium phosphate precipitation, conventional mechanical methods are such as
Microinjection, electroporation, liposome packaging etc..
Preferably, described pharmaceutical composition includes the promotor of FYB1 and/or CARMIL2, and/or is matched with the promotor
5 its other medicine class and pharmaceutically acceptable carrier and/or auxiliary material.
Preferably, the pharmaceutically acceptable carrier and/or auxiliary material, including but not limited to diluent, adhesive, table
Face activating agent, Humectant, absorption carrier, lubricant, filler, disintegrating agent.
Pharmaceutical composition in the present invention can also include stabilizer, fungicide, buffer, isotonic agent, chelating agent, pH control
The additives such as preparation and surfactant.
Beneficial effect
It is described present invention finds a kind of new molecular marked compound FYB1 and CARMIL2 gene relevant to thyroid cancer
Marker expresses downward in human thyroid carcinoma.And study its application prospect in thyroid gland carninomatosis early detection.
Further, the invention discloses the molecular marked compound FYB1 and CARMIL2 gene detects thyroid cancer in preparation
Application in kit, the expression that the kit passes through detection subject FYB1 and CARMIL2, it can be determined that whether subject
With thyroid cancer or judge that subject whether there is the risk with thyroid cancer, to instruct clinician to tested
Person provides prevention scheme or therapeutic scheme.For the cause of disease pathogenesis for further studying thyroid cancer, it is early to explore thyroid cancer
The phase drug target of prevention and treatment provides new direction.
Detailed description of the invention
The expression of FYB1 (A) and CARMIL2 (B) gene in Fig. 1 thyroid cancer patients.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
Used in the conventional means that are well known to those skilled in the art of technological means.
The present invention carries out transcript profile sequencing to the RNA of human thyroid carcinoma sample and cancer beside organism's sample, is believed by biology
Cease method and carry out genescreen, pick out candidate FYB1 and CARMIL2 gene, in existing research there is no FYB1 and
CARMIL2 report relevant to thyroid cancer, further, inventor has carried out molecular biology method verifying, it was confirmed that FYB1
Downward is expressed in human thyroid carcinoma or cell with CARMIL2.
Embodiment 1 screens gene marker relevant to thyroid cancer
1, sample collection
Take in October, 2014 to during in January, 2018 Beijing division of endocrinology, Lu He hospital operation in obtain tissue specimen 25
, all samples are confirmed through pathological examination, wherein 8, cancer beside organism's sample, thyroid cancer sample 17, number postposition-
80 DEG C of low temperature refrigerators save.The acquirement of above-mentioned all samples passes through the agreement of the committee, organizational ethics.
2, Total RNAs extraction is carried out to tissue samples
UsingReagent (invitrogen, article No. 15596-018) carries out sample rna extraction, experiment behaviour
Make to carry out by product description, concrete operations are as follows:
It freezes to be put into the mortar being pre-chilled tissue after liquid nitrogen, taking-up after collection sample and be ground, sample to be organized
This is at powdered rear:
1. Trizol is added, room temperature preservation 5 minutes；
2. chlorination imitates 0.2mL, with forced oscillation centrifuge tube, mix well, places -10 minutes 5 minutes at room temperature；
3. drawing upper strata aqueous phase (inhaling 70%) after 12000rpm high speed centrifugation 15 minutes into another new centrifuge tube pipe, pay attention to
The protein substance that be not drawn between two layers of water phase.New pipe is moved into, the pre- cold isopropanol of isometric -20 DEG C is added, it is sufficiently reverse
It mixes, is placed in 10 minutes on ice；
4. 12000rpm high speed from 15 minutes after carefully discard supernatant, in 1mL/mL Trizol ratio be added 75%
DEPC ethyl alcohol washes paint precipitating (4 DEG C of preservations), washes paint sediment, oscillation mixes, 12000rpm high speed centrifugation 5 minutes at 4 DEG C；
5. discarding ethanol liquid, 5 minutes are placed at room temperature sufficiently to dry precipitating, it is heavy that the processed water dissolution of DEPC is added
It forms sediment；
6. measuring RNA purity and concentration with Nanodrop2000 ultraviolet specrophotometer, freeze in -80 DEG C.RNA mass is sentenced
Calibration is quasi-: the OD260/OD280 value of RNA sample is between 1.7-2.2；Total serum IgE electrophorogram has clearly 28S, 18S band；
70 DEG C of water-baths keep the temperature 1 hour after electrophorogram and the map no significant difference before water-bath heat preservation.
3, the quality analysis of RNA sample
RNA extract after agarose gel electrophoresis, from electrophoresis result can with preliminary judgement extract RNA sample it is up-to-standard with
It is no, if to can be used for further transcriptome analysis.And then RNA sample is detected by NanoDrop1000 spectrophotometer
Extract situation, the sample requirement of RNA-seq sequencing: OD260/OD280 1.8-2.2.
4, it is sequenced
Microarray dataset is the 2500 high-flux sequence platform of HiSeq of Illumina company, carries out high-throughput transcript profile depth
Sequencing, we carry out total evaluation, the mass value including base point with quality of the Fast-QC software to sequencing data after sequencing
Cloth, the position distribution of mass value, G/C content, PCR duplication content, the frequency etc. of kmer.In differential gene table
Up to when analysis, according to obtained FPKM value, differential screening is carried out using internationally recognized algorithm EBSeq.Wherein, when screening,
LOG2FC>1 or<-1, FDR<0.05.In order to better understand the function of difference expression gene, inventor is to difference expression gene
Gene Ontology and signal path analysis have been carried out, and difference expression gene progress functional annotation and protein have been made mutually
With network analysis, in view of above data analysis as a result, screened differential expression FYB1 and CARMIL2 in conjunction with document inventor,
The gene expresses downward in human thyroid carcinoma sample.
Embodiment 2Real-Time PCR verifies human thyroid carcinoma and cancer beside organism's FYB1 and CARMIL2 expression
1, material
21, human thyroid carcinoma sample and 8, cancer beside organism's sample are chosen, it is grouped and is numbered.All samples
Confirmed by pathological examination.
2, method
2.1 pairs of tissue samples carry out Total RNAs extraction, with the extracting method of embodiment 1.
2.2 reverse transcriptions synthesize cDNA
UsingIII Reverse Transcriptase (invitrogen, article No. 18080-044) into
Row cDNA reverse transcription, experimental implementation are carried out by product description, and concrete operations are as follows:
Using Reverse Transcriptase kit, converse record is carried out to l μ g total serum IgE with RT Buffer and synthesizes cDNA.Using 25 μ L
Reaction system, each sample take 1 μ g total serum IgE as template ribonucleic acid.- 20 DEG C are stored in after the cDNA sample of acquisition is diluted 10 times
Refrigerator is spare.
2.3Real-Time PCR
2.3.1 instrument and analysis method
With 7500 type fluorescence quantitative PCR instrument of ABI, using 2-ΔΔCtMethod carries out data relative quantitative assay.
2.3.2 design of primers
Using primer premier5.0 primer-design software, FYB1 (NM_001243093.1) and CARMIL2 (NM_
001013838.3), interior participation in the election GAPDH is synthesized by invitrogen company after design of primers.Specific primer sequence is as follows:
1 primer sequence of table
Operating process is as follows:
Table 2Real Time reaction system
| Component | Additional amount |
| 2×mix | 10μL |
| Upstream primer (10 μM) | 0.5μL |
| Downstream primer (10 μM) | 0.5μL |
| Template | 2μL |
| Sterile purified water is added | To 25 μ L |
Reaction system: Power is usedGreen PCR Master Mix (invitrogen, article No. 4367659) into
Row amplification, experimental implementation are carried out by product description.
Amplification program are as follows: 95 DEG C of 5min, (95 DEG C of 15sec, 60 DEG C of 45sec, 72 DEG C of 35sec) × 40 circulations.
2.3.3 sample Real Time-PCR is detected
2 μ L will be taken to make template after 10 times of each sample cDNA dilutions, respectively with target gene primer and reference gene primer into
Row amplification.Simultaneously in 60-95 DEG C of progress solubility curve analysis.
3, experimental result
According to the relative quantification formula of qRT-PCR: 2-ΔΔCt× 100%, compare FYB1 and CARMIL2 in thyroid carcinoma group
It knits and the expression in cancer beside organism.As the result is shown: qRT-PCR stable amplification result, wherein FYB1 and CARMIL2 is in first shape
Gland cancer suffers from the 30%-40% (such as Fig. 1) that the expression in tissue is cancer beside organism, and result above demonstrates transcript profile sequencing number
According to FYB1 and CARMIL2 the result of downward is expressed in thyroid cancer patients.
The assembling of 3 kit of embodiment
Based on the primer that embodiment 2 obtains, the kit of the present invention for thyroid cancer detection, the reagent are assembled
Box includes the primer of specific amplified FYB1 and CARMIL2 gene, as shown in SEQID NO.1~SEQID NO.4.
Kit of the invention further includes the primer pair of specific amplified house-keeping gene (GAPDH): SEQ IDNO:5 and SEQ
Shown in ID NO:6；It further include SYBR Green polymerase chain reaction system, as PCR buffer, SYBR Green fluorescence contaminate
Material, dNTPs.The ingredient of the PCR buffer is 25mM KCl, 2.5mM MgCl2, 200mM (NH4)2SO4.By dense to primer
The optimization of degree and annealing temperature, final to determine that reaction system is as follows:
Optimum reaction condition are as follows: 95 DEG C of initial denaturation 5min, (95 DEG C of denaturation 15sec, 60 DEG C of annealing 45sec, 72 DEG C extend
35sec) × 40 circulation, 72 DEG C of extension 15min.
For convenience of use, kit also may include control: the normal cDNA sample of said gene.Subject's biology is taken to imitate
This, extracts RNA using conventional method (or using specific kit) from biological sample, using seminal plasma fructose detection kit, presses
PCR is carried out according to optimal reaction system and condition to react, and uses in kit normal cDNA as Real-Time PCR quantitative detection
In control cDNA, detect subject's biological sample in FYB1 and CARMIL2 gene the relatively normal cDNA of expression quantity table
Change up to amount.
The value of kit of the invention is by most simplifying the expression with special primer pair detection gene, no
It is only stable, easy to detect and accurate, the sensibility and specificity of Diagnosis of Thyroid Carcinoma is greatly improved, therefore this kit is thrown
Enter practice, can help to instruct early diagnosis and more effective individualized treatment.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>accurate (Beijing) Laboratory of medical test Co., Ltd of Si Tai get
<120>a kind of thyroid cancer early detection molecular marker and its application
<130> P18133
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 1
tcttcggggt cattgtgtgc 20
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 2
ggctggcatt tccttggttg 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 3
tcctgagccg tcctaacgta 20
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 4
gggaggctgt tggctacac 19
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 5
ggagcgagat ccctccaaaa t 21
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 6
ggctgttgtc atacttctca tgg 23
<210> 7
<211> 216
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 7
tcttcggggt cattgtgtgc caggcatatc aactcttttc aataaaaatg gatggaaagg 60
cagatgtaaa gtccctcatg gcgaaatata acacgggggg caacccgaca gaggatgtct 120
cagtcaatag ccgacccttc agagtcacag ggccaaactc atcttcagga atacaagcaa 180
gaaagaactt attcaacaac caaggaaatg ccagcc 216
<210> 8
<211> 166
<212> DNA
<213>artificial sequence (Artificial sequence)
<400> 8
tcctgagccg tcctaacgta ctgtcgttcc tgaatctcgc aggcaccgac actgccctgg 60
acactgtgag ggggtgctcc gtggggggat ggatgaccgg cagggcggac tggagggcgg 120
gacggggagg gctcggtccc cccgcgggtg tagccaacag cctccc 166
Claims (10)
1. a kind of thyroid cancer early detection molecular marker, which is characterized in that the molecular marker be FYB1 and
CARMIL2；The molecular marker is related to the generation of thyroid gland carninomatosis.
2. molecular marker as described in claim 1, which is characterized in that FYB1 the and CARMIL2 gene is in thyroid cancer
It expresses and lowers in tissue.
3. molecular marker of any of claims 1 or 2 is preparing the application in diagnosis of thyroid cancer product.
4. application as claimed in claim 3, which is characterized in that the product includes: by real-timePCR, Western
Blot method, immune detection, in situ hybridization detect the expression of FYB1 and CARMIL2 gene and its expression product to diagnose first
The product of shape gland cancer.
5. application as claimed in claim 4, which is characterized in that the product includes preparation, chip, kit.
6. a kind of thyroid cancer detection kit, which is characterized in that the kit includes detection FYB1 and CARMIL2 gene table
Up to horizontal reagent, and how to use the explanation of the kit.
7. kit as claimed in claim 6, which is characterized in that the kit includes for detecting FYB1 and CARMIL2
The primer pair or probe of gene.
8. kit as claimed in claim 7, which is characterized in that the primer of the specific amplified FYB1 and CARMIL2 gene
Nucleotide sequence it is as follows:
FYB1:
SEQID NO.1TCTTCGGGGTCATTGTGTGC；
SEQID NO.2GGCTGGCATTTCCTTGGTTG；
CARMIL2:
SEQID NO.3TCCTGAGCCGTCCTAACGTA；
SEQID NO.4GGGAGGCTGTTGGCTACAC。
9. kit as claimed in claim 7, which is characterized in that detect that the FYB1 conserved sequence is SEQ ID NO:7
It is shown, detect that the CARMIL2 conserved sequence is shown in SEQ ID NO:8.
Application of the 10.FYB1 and/or CARMIL2 promotor in the pharmaceutical composition of preparation treatment thyroid cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811572052.0A CN109652540A (en) | 2018-12-21 | 2018-12-21 | A kind of thyroid cancer early detection molecular marker and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811572052.0A CN109652540A (en) | 2018-12-21 | 2018-12-21 | A kind of thyroid cancer early detection molecular marker and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109652540A true CN109652540A (en) | 2019-04-19 |
Family
ID=66116187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811572052.0A Pending CN109652540A (en) | 2018-12-21 | 2018-12-21 | A kind of thyroid cancer early detection molecular marker and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109652540A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101622349A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | miR-20 regulated genes and pathways as targets for therapeutic intervention |
| US20140349864A1 (en) * | 2008-11-17 | 2014-11-27 | Veracyte, Inc. | Methods and compositions of molecular profiling for disease diagnostics |
| US20160060705A1 (en) * | 2010-09-15 | 2016-03-03 | Almac Diagnostics Limited | Molecular diagnostic test for cancer |
| CN105695616A (en) * | 2016-04-22 | 2016-06-22 | 王冬国 | Analysis marker for diagnosing thyroid cancer and application thereof |
-
2018
- 2018-12-21 CN CN201811572052.0A patent/CN109652540A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101622349A (en) * | 2006-12-08 | 2010-01-06 | 奥斯瑞根公司 | miR-20 regulated genes and pathways as targets for therapeutic intervention |
| US20140349864A1 (en) * | 2008-11-17 | 2014-11-27 | Veracyte, Inc. | Methods and compositions of molecular profiling for disease diagnostics |
| US20160060705A1 (en) * | 2010-09-15 | 2016-03-03 | Almac Diagnostics Limited | Molecular diagnostic test for cancer |
| CN105695616A (en) * | 2016-04-22 | 2016-06-22 | 王冬国 | Analysis marker for diagnosing thyroid cancer and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| JUNKE LIU ET AL.: ""FYB (FYN binding protein) serves as a binding partner for lymphoid protein and FYN kinase substrate SKAP55 and a SKAP55-related protein in T cells"", 《PROC.NATL.ACAD.SCI.USA》 * |
| MARIA HERNANDEZ-VALLADARES ET AL.: ""Structural characterization of a capping protein interaction motif defines a family of actin filament regulators"", 《NATURE STRUCTURAL & MOLECULAR BIOLOGY》 * |
| 于远东: ""miRNA：甲状腺癌诊治和预后评估的新型分子标志物"", 《癌症进展》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946739B (en) | EGFR genetic mutation detection kit and its application | |
| CN106978497A (en) | Detection primer, probe and the detection kit of EML4 ALK fusion gene mutations | |
| CN110527710B (en) | Primer, probe and kit for detecting NTRK gene fusion mutation | |
| CN108949990A (en) | A kind of kit and method detecting EGFR genetic mutation | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN105671187B (en) | Group of genes for molecular typing of head and neck squamous cell carcinoma and application thereof | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN105256036A (en) | Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN107190052A (en) | The purposes of LOC101928926 genes | |
| CN107190005B (en) | Applications of the lncRNA as biomarker in adenocarcinoma of lung diagnosis and treatment | |
| CN108949976A (en) | Purposes of the C12orf70 and/or C17orf107 gene in cancer of pancreas testing product | |
| CN108949989A (en) | One group of biomarker is preparing the purposes in IVL detection, diagnosis or Prognosis scoveillance product | |
| CN106755309A (en) | Application of the molecular marked compound in cancer of pancreas prognosis evaluation product is prepared | |
| CN109652540A (en) | A kind of thyroid cancer early detection molecular marker and its application | |
| CN109652535A (en) | Identify human thyroid tubercle good pernicious kit and its application method and application | |
| CN112226507B (en) | Papillary thyroid carcinoma serum marker and application | |
| CN108660193A (en) | Mankind's LMNA-NTRK1 Gene Fusion abrupt climatic changes primer, probe and detection kit | |
| CN114350812A (en) | NSCLC-free RNA-3 related to oxicetitinib drug resistance and application thereof | |
| CN106636444A (en) | Application of FAM78A gene | |
| CN106702002A (en) | Biomarker for lung adenocarcinoma diagnosis and treatment | |
| CN106434968B (en) | Application of the CCDC168 as marker in detection cancer of pancreas reagent | |
| CN109161596B (en) | The application of miR-129 and its target gene in detection adenocarcinoma of lung | |
| CN106868197B (en) | Application of the gene marker in Huppert's disease | |
| CN111440868A (en) | Laryngeal squamous carcinoma molecular marker hsa _ circ _0018169 and detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Ji Zhili Inventor after: Zhao Dong Inventor after: Xiong Hui Inventor after: Yao Guangyin Inventor after: Li Li Inventor after: Yang Longyan Inventor after: Sun Rongxin Inventor before: Ji Zhili Inventor before: Zhao Dong Inventor before: Xiong Hui Inventor before: Yao Guangyin Inventor before: Li Li Inventor before: Yang Longyan Inventor before: Sun Rongxin |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190419 |