CN109652521A - A kind of hybridization probe containing manual tag - Google Patents
A kind of hybridization probe containing manual tag Download PDFInfo
- Publication number
- CN109652521A CN109652521A CN201811624332.1A CN201811624332A CN109652521A CN 109652521 A CN109652521 A CN 109652521A CN 201811624332 A CN201811624332 A CN 201811624332A CN 109652521 A CN109652521 A CN 109652521A
- Authority
- CN
- China
- Prior art keywords
- probe
- manual tag
- value
- hybridization
- upstream
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of hybridization probes containing manual tag.The present invention provides fluorogenic donor or acceptor groups by introducing the new manual tag sequence not hybridized with amplification region on the basis of traditional two hybridization probes (upstream probe and downstream probe), and using the additional special probe hybridized with manual tag region.Because the Tm value of manual tag sequence hybridising region is lower than the Tm value of preceding two hybridization probes and amplification region hybridization portion, therefore the Tm value of whole system is only determined by the Tm value of manual tag part, to make Tm value when melting curve analysis keep constant, do not influenced by mutation such as amplification region SNP, missing, insertions.
Description
Technical field:
The invention belongs to gene engineering technology fields, and in particular to a kind of hybridization probe containing manual tag.
Background technique:
When the fluorescence spectrum and another fluorescent molecule (also known as receptor point of a fluorescent molecule (also known as donor molecule)
Son) excitation spectrum when overlapping, the excitation of donor fluorescent molecule can induce acceptor molecule and issue fluorescence, while donor fluorescent point
The fluorescence-intensity decay of son itself, this phenomenon are known as fluorescence resonance energy transfer (FRET) phenomenon.FRET degree and confession, receptor
The space length of molecule is closely related, and FRET can occur for when generally 7~10nm, with the extension of the distance, FRET is in significantly subtracting
It is weak.
FRET hybridization probe can be used for treating sequencing column and be detected (Matthews, JA Analytical
Biochemistry 169 (1988) 1-25), it is characterized in that using adjacent sites complementary with the same chain of sequence to be measured complementary simultaneously
Two single-stranded hybridization probes pair, two probes mark with different fluorescent components, when specific wavelength excitation, the first ingredient
(donor) by the energy transfer of absorption to second of ingredient (receptor), the fluorescent emission amount by detecting second of ingredient is treated
The amount of sequencing column is detected., must be very close between hybridization probe when being annealed to target sequence, usual first probe mark
The end 3` of note and the splaying 5` of second probe are 1-5 base, about 10-100 angstroms.
In addition to carrying out real-time PCR, FRET hybridization probe can also be used in melting curve analysis, when hybridization probe is integrated to target sequence
When on column, acceptor groups launch fluorescence by FRET principle, and in melting temperature, hybridization probe is detached from from target sequence, by
The fluorescence signal of body group reduces, and observes the maximum value that fluorescence signal reduces by derivation come interpretation melting temperature (Tm) value, leads to
Tm value is crossed to judge whether hybridization sequences are target sequences.
FRET hybridization probe generally uses two to carry donor groups respectively and the probe sequence hybridization of acceptor groups is being expanded
Increase the adjacent parts in region, and the Tm value of melting curve then is determined (usually to depend on by the hybridization sequences of this two probes itself
In Tm value it is lower that first split away off because Tm value is lower compared to Tm value is higher), when SNP, scarce occurs in hybridising region
When the mutation such as mistake, insertion, the variation of Tm value will be caused, result interpretation is influenced.
Summary of the invention:
The object of the present invention is to provide one kind not to be influenced by mutation such as amplification region SNP, missing, insertions, can make to melt
The hybridization probe containing manual tag that Tm value when tracing analysis is kept constant.
Hybridization probe containing manual tag of the invention, including upstream probe and downstream probe, which is characterized in that packet
It includes:
A, it is connected with fluorescent receptor group or fluorogenic donor group at 3 ' ends of upstream probe, is connected at 5 ' ends of downstream probe
Manual tag sequence also contains third probe, and the third probe is the probe hybridized with manual tag sequence, third probe
5 ' ends be connected with fluorogenic donor group or fluorescent receptor group, the manual tag sequence not with upstream probe, downstream probe
With amplification template hybridization, the Tm value of manual tag sequence hybridising region hybridizes lower than upstream probe and downstream probe with amplification region
Partial Tm value；
Or b, upstream probe 3 ' end be connected with manual tag sequence, downstream probe 5 ' end be connected with fluorescent receptor group
Or fluorogenic donor group, also contain third probe, the third probe is the probe hybridized with manual tag sequence, and third is visited
5 ' ends of needle are connected with fluorogenic donor group or fluorescent receptor group, and the manual tag sequence is not visited with upstream probe, downstream
Needle and amplification template hybridization, the Tm value of manual tag sequence hybridising region are miscellaneous lower than upstream probe and downstream probe and amplification region
Hand over the Tm value of part；
Or c, at 3 ' ends of upstream probe it is connected with the first artificial sequence label, it is artificial to be connected with second at 5 ' ends of downstream probe
Sequence label further includes having third probe and the 4th probe, and the third probe hybridizes with the first artificial sequence label, described
The 4th probe hybridize with the second manual tag sequence, third probe 3 ' end be connected with fluorescent receptor group or fluorogenic donor base
Group is connected with fluorogenic donor group or fluorescent receptor group at 5 ' ends of the 4th probe, the artificial sequence label of described first and the
Two manual tag sequences do not hybridize with upstream probe, downstream probe and amplification template, and the first artificial sequence label and second is manually
Sequence label does not hybridize mutually, and the Tm value of the first artificial sequence label or the second manual tag sequence hybridising region is visited lower than upstream
The Tm value of needle and downstream probe and amplification region hybridization portion.
The present invention by introduced on the basis of traditional two hybridization probes (upstream probe and downstream probe) it is new not with
The manual tag sequence of amplification region hybridization, and provide fluorescence using the additional special probe hybridized with manual tag region and supply
Body or acceptor groups.Because the Tm value of manual tag sequence hybridising region hybridizes portion with amplification region lower than preceding two hybridization probes
The Tm value divided, therefore the Tm value of whole system is only determined by the Tm value of manual tag part, thus when making melting curve analysis
Tm value is kept constant, and is not influenced by mutation such as amplification region SNP, missing, insertions, further, since one is specially marked with artificial
The probe for signing sequence hybridization can be obtained different in conjunction with multiple manual tags by the change of manual tag Sequence base
Tm value, therefore on a fluorescence channel can be used only one carrying fluorogenic donor group probe and/or a carrying fluorescence
The probe of acceptor groups, to reduce the background fluorescence intensity and save the cost of entire reaction system.
Detailed description of the invention:
Melting curve analysis figure after Fig. 1 is SEQ1, SEQ2, SEQ3, SEQ4 while hybridizing；
Melting curve analysis figure after Fig. 2 is SEQ1, SEQ3, SEQ4 while hybridizing；
Fig. 3 is melting curve analysis figure after SEQ1, SEQ3, SEQ4 hybridization；
Fig. 4 is Hybridization principle figure；
Fig. 5 is melting curve analysis figure after hybridization；
Fig. 6 is melting curve analysis figure after hybridization；
Fig. 7 is Hybridization principle figure；
Fig. 8 is melting curve analysis figure after hybridization；
Fig. 9 is Hybridization principle figure.
Specific embodiment:
The following examples are further illustrations of the invention, rather than limiting the invention.
Embodiment 1:
SEQ1:TACCCGGCCGGAATCCCTGCGTCTAGCGGACGTCCGCCATAACTCAAATTG CGATTCTGT
SEQ2:ACAGAATCGCAATTTGAGTTATGGCGGACGTC-BHQ1
SEQ3:CCGGTCAAGGTTGAGTTATGAAGGACCCGCTAGACGCAGGGATTCCGGCCGGGTA
SEQ4:FAM-AAAAAAGGTCCTTCATCGCTCAGCCTTCACCGG-C3 Spacer
SEQ1 is artificial synthesized amplification region, is hybridized for upstream probe, downstream probe.
SEQ2 is upstream probe, and the terminal modified BHQ1 of 3' is as acceptor groups.
SEQ3 is downstream probe, and the end 5' carries one section of manual tag sequence, is indicated with underscore.
SEQ4 is detection probe (third probe), and the terminal modified FAM of 5' is as donor groups.
Hybridized in the following way:
1, SEQ1, SEQ2, SEQ3, SEQ4 hybridize simultaneously, and melting curve analysis is as shown in Figure 1 after hybridization；
2, SEQ1, SEQ3, SEQ4 hybridize simultaneously, and melting curve analysis is as shown in Figure 2 after hybridization；
3, SEQ1, SEQ2, SEQ4 hybridize simultaneously, and melting curve analysis is as shown in Figure 3 after hybridization；
Hybridization principle figure is as shown in Figure 4.
Reaction system:
| Artificial synthesized hybridising region | SEQ1 | 2pmol |
| Carry acceptor groups probe | SEQ2 | 2pmol |
| Carry the hybridization probe of manual tag | SEQ3 | 2pmol |
| Carry the fluorescence probe of donor groups | SEQ4 | 2pmol |
| PCR reaction solution | 2X PCR reaction buffer | 12.5ul |
| ddH2O | Total volume is supplemented to 25ul |
Reaction condition:
| 95 degree | 10 minutes | Thermal starting |
| 45-80 degree | 1 degree/8 seconds melting curve analysis | Melting curve analysis |
It will be seen from figure 1 that as the SEQ2 of modified receptor group and the SEQ3 while and amplification region of carrying manual tag
SEQ1 hybridization, and the SEQ4 for carrying donor groups hybridizes when in manual tag, the melting curve peak that can be designed.
Figure it is seen that when carrying the SEQ2 missing of acceptor groups, due to lacking acceptor groups in reaction system,
FRET phenomenon can not occur, be unable to get melting peakss.
From figure 3, it can be seen that when gear carries the SEQ3 missing of manual tag, since fluorescence probe SEQ4 can not hybridize to people
On work label, FRET phenomenon can not also occur, be unable to get melting peakss.
Embodiment 2: use two hybridization probes and a fluorogenic donor probe, wherein a hybridization probe also serve as fluorescence by
Body probe
1, SEQ5:AACCCAGTGAATTTATGATTAGCA
Respiratory Syncytial Virus(RSV) A type RSVA- forward primer
2, SEQ6:TCCCATAATATACAAGTATGATCTCAA
Respiratory Syncytial Virus(RSV) A type RSVA- reverse primer
3, SEQ7:GGCTCTTAGCAAAGTCAAGTTGAATGATACACTC-BHQ1
Respiratory Syncytial Virus(RSV) A type RSVA specific hybridization probes 2, while fluorescent receptor is also served as with 3 ' end of BHQ1 modification and is visited
Needle
4, SEQ8:CCGGTCAAGGTTGAGTTATGAAGGACCAACAAAGATCAACTTCTGTCATCC AGCAAATAC-
C3Spacer
Respiratory Syncytial Virus(RSV) A type RSVA specific hybridization probes 2
5, SEQ9:GGTACCTCCCATAATATACAAGTATGATCTCAATCCATAAATTTCAACACA ATATTCACAC
AATCTAAAACAACAACTCTATGCATAACTATACTCCATAGTCCAGATGGAGCCTGAAAATTATAGTAATTTAAAATT
AAGGAGAGATATAAGATAGAAGATGGGGCAAATACAAAGATGGCTCTTAGCAAAGTCAAGTTGAATGATACACTCAA
CAAAGATCAACTTCTGTCATCCAGCAAATACACCATCCAACGGAGCACAGGAGATAGTATTGATACTCCTAATTATG
ATGTGCAGAAACACATCAATAAGTTATGTGGCATGTTATTAATCACAGAAGATGCTAATCATAAATTCACTGGGTTG
GATCC
The artificial plasmid of Respiratory Syncytial Virus(RSV) A type RSVA, as template
Reaction system:
Reaction condition:
Experimental result as shown in figure 5, from fig. 5, it can be seen that positive hole (have a line of melting peakss, 106Copy is used as template)
There is the positive peak of Tm=45 degree, negative hole (template that copy number is 0) is consistent with experimental design without positive peak.
Embodiment 3: two hybridization probes, a fluorogenic donor probe and a fluorescent receptor probe are used.
1, SEQ10:GGCTCTTAGCAAAGTCAAGTTGAATGATACACTCTACTTAGACCGGCGAAGTGCCAAGCG
ACTCC
Underscore is RSVA hybridization probe position, and no underscore is fluorescent receptor probe joint position
2, SEQ11:GGAGTCGCTTGGCACTTCGCCGGTCTAAGTA-BHQ1
Fluorescent receptor probe
Reaction system:
Reaction condition:
Experimental result Fig. 6, it is seen that and positive hole (there is a line of melting peakss, 106Copy be used as template) have it is consistent with target temperature
45 degree of the peak Tm, negative hole (copy number be 0 be used as template) do not have melting peakss.Hybridization principle figure is shown in Fig. 7.
Embodiment 4: it doubles as being fluorescent receptor using a hybridization probe, a fluorogenic donor probe and using a primer
Probe
1, SEQ12:AACCCAGTGAATTTATGATT (BHQ1) AGCA
Respiratory Syncytial Virus(RSV) A type RSVA forward primer, the 5th base modification fluorescent receptor group BHQ1 of inverse
2, SEQ13:CACATCAATAAGTTATGTGGCATGTTATTAATCACAGAAGACCGGTCAAGGTTGAGTTAT
GAAGGACC
Hybridization probe 1, underscore part are RSVA specific hybridizing sequence, and no underscore is fluorogenic donor probe combination sequence
Column
3, SEQ14:GGTCCTTCATCGCTCAGCCTTCACCGGAAAAA-FAM
Fluorogenic donor probe, 3 ' terminal modified fluorogenic donor group FAM
Reaction system:
| Forward primer | SEQ12 | 20pmol |
| Reverse primer | SEQ6 | 2pmol |
| Hybridization probe 1 | SEQ13 | 5pmol |
| Fluorogenic donor probe | SEQ14 | 5pmol |
| Template | SEQ9 | 106Copy and 0 copy |
| PCR reaction solution | 2X PCR reaction buffer | 12.5ul |
| ddH2O | Total volume is supplemented to 25ul |
Reaction condition:
Experimental result Fig. 8, it is seen that and positive hole (there is a line of melting peakss, 106Copy is used as template) have and is expected consistent melt
Xie Feng, negative hole (copy number is 0 as template) is without obvious melting peakss.Hybridization principle figure is shown in Fig. 9.
Claims (1)
1. a kind of hybridization probe containing manual tag, including upstream probe and downstream probe characterized by comprising
A, it is connected with fluorescent receptor group or fluorogenic donor group at 3 ' ends of upstream probe, is connected at 5 ' ends of downstream probe artificial
Sequence label also contains third probe, and the third probe is the probe hybridized with manual tag sequence, and the 5 ' of third probe
End is connected with fluorogenic donor group or fluorescent receptor group, the manual tag sequence not with upstream probe, downstream probe and expansion
Increase template hybridization, the Tm value of manual tag sequence hybridising region is lower than upstream probe and downstream probe and amplification region hybridization portion
Tm value；
Or b, at 3 ' ends of upstream probe it is connected with manual tag sequence, fluorescent receptor group or glimmering is connected at 5 ' ends of downstream probe
Light donor groups also contain third probe, and the third probe is the probe hybridized with manual tag sequence, third probe
5 ' ends are connected with fluorogenic donor group or fluorescent receptor group, the manual tag sequence not with upstream probe, downstream probe and
Template hybridization is expanded, the Tm value of manual tag sequence hybridising region hybridizes portion with amplification region lower than upstream probe and downstream probe
The Tm value divided；
Or c, upstream probe 3 ' end be connected with the first artificial sequence label, downstream probe 5 ' end be connected with the second manual tag
Sequence further includes having third probe and the 4th probe, and the third probe hybridizes with the first artificial sequence label, and described
Four probes hybridize with the second manual tag sequence, are connected with fluorescent receptor group or fluorogenic donor group at 3 ' ends of third probe,
Fluorogenic donor group or fluorescent receptor group, the artificial sequence label of described first and the second people are connected at 5 ' ends of the 4th probe
Work sequence label does not hybridize with upstream probe, downstream probe and amplification template, the first artificial sequence label and the second manual tag
Sequence does not hybridize mutually, the Tm value of the first artificial sequence label or the second manual tag sequence hybridising region lower than upstream probe and
The Tm value of downstream probe and amplification region hybridization portion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811624332.1A CN109652521A (en) | 2018-12-28 | 2018-12-28 | A kind of hybridization probe containing manual tag |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811624332.1A CN109652521A (en) | 2018-12-28 | 2018-12-28 | A kind of hybridization probe containing manual tag |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109652521A true CN109652521A (en) | 2019-04-19 |
Family
ID=66117884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811624332.1A Pending CN109652521A (en) | 2018-12-28 | 2018-12-28 | A kind of hybridization probe containing manual tag |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109652521A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2243759A1 (en) * | 1996-02-05 | 1997-08-14 | The Perkin-Elmer Corporation | Fluorescence detection assay for homogeneous pcr hybridization systems |
| WO2004061132A1 (en) * | 2002-12-20 | 2004-07-22 | Stratagene | Compositions and methods for polynucleotide detection |
| CN101871007A (en) * | 2010-05-07 | 2010-10-27 | 无锡锐奇基因生物科技有限公司 | Method for detecting by using labeled probe and analyzing fusion curve |
| CN108913759A (en) * | 2018-07-24 | 2018-11-30 | 江西南兴医疗科技有限公司 | A kind of fluorescence PCR primer, probe and detection method for target sequence detection |
-
2018
- 2018-12-28 CN CN201811624332.1A patent/CN109652521A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2243759A1 (en) * | 1996-02-05 | 1997-08-14 | The Perkin-Elmer Corporation | Fluorescence detection assay for homogeneous pcr hybridization systems |
| WO2004061132A1 (en) * | 2002-12-20 | 2004-07-22 | Stratagene | Compositions and methods for polynucleotide detection |
| CN101871007A (en) * | 2010-05-07 | 2010-10-27 | 无锡锐奇基因生物科技有限公司 | Method for detecting by using labeled probe and analyzing fusion curve |
| CN108913759A (en) * | 2018-07-24 | 2018-11-30 | 江西南兴医疗科技有限公司 | A kind of fluorescence PCR primer, probe and detection method for target sequence detection |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102449167B (en) | Method for detecting variations in nucleic acid sequences | |
| US11345958B2 (en) | Methods for performing multiplexed real-time PCR | |
| JP5385973B2 (en) | Simultaneous detection of multiple nucleic acid sequences in a reaction | |
| AU2006204087B2 (en) | Primer for nucleic acid detection | |
| US6593091B2 (en) | Oligonucleotide probes for detecting nucleic acids through changes in flourescence resonance energy transfer | |
| EP2971106B1 (en) | Methods for true isothermal strand displacement amplification | |
| CN111621551B (en) | Multiplex ligation probe microarray detection | |
| AU2010244453A1 (en) | Detection of multiple nucleic acid sequences in a reaction cartridge | |
| WO2010030716A1 (en) | Detection of nucleic acids by oligonucleotide probes cleaved in presence of endonuclease v | |
| US20120252692A1 (en) | Methods and compositions for detection of nucleic acids based on stabilized oligonucleotide probe complexes | |
| CN112592964A (en) | Method for performing multiplex detection of nucleic acids | |
| JP2023501219A (en) | Nucleic acid detection methods using LAMP and probe detection | |
| US11198903B2 (en) | Methods for performing multiplexed real-time PCR | |
| CN109988865A (en) | A method of detection Respirovirus | |
| CN111394432A (en) | Multiple quantitative PCR detection system based on universal probe chip | |
| JP5207355B2 (en) | Method for detecting nucleic acid having target nucleotide sequence, probe set, and method for identifying nucleic acid | |
| CN108642165A (en) | A kind of probe and its application method for real-time fluorescence PCR | |
| CN109652521A (en) | A kind of hybridization probe containing manual tag | |
| CN110016500A (en) | Surface-probe quantifying PCR method | |
| CN110257492A (en) | One group of FRET hybridization amplimer and detection probe group | |
| US6841346B1 (en) | Methods for detecting bacteriophage MS2 | |
| WO2023118399A1 (en) | Improved detection of lamp amplification products | |
| WO2021080629A1 (en) | Methods for true isothermal strand displacement amplification | |
| CN109593830A (en) | A kind of fluorescence probe reducing analysis background signal |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |