CN109652510A - Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample - Google Patents
Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample Download PDFInfo
- Publication number
- CN109652510A CN109652510A CN201910011711.1A CN201910011711A CN109652510A CN 109652510 A CN109652510 A CN 109652510A CN 201910011711 A CN201910011711 A CN 201910011711A CN 109652510 A CN109652510 A CN 109652510A
- Authority
- CN
- China
- Prior art keywords
- baalc
- probe
- abl
- gene
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is disclosed for detecting the oligonucleotides of BAALC gene, method and kit in sample comprising for the upstream and downstream primer and probe of BAALC, and for the upstream and downstream primer and probe of ABL reference gene.The present invention can quickly detect in sample with the presence or absence of BAALC gene and its expression quantity number.The testing result completed using the present invention is accurate and sensitive, can formulate individualized treatment scheme and disease prognosis judgement for mankind's acute myeloid leukemia (Acute Myeloid Leukemia, AML) auxiliary.
Description
Technical field
The invention belongs to bioscience and field of biotechnology, in particular to the side of BAALC gene in a kind of detection sample
Method, primer, probe and kit detect acute human marrow series leukemia (Acute Myeloid using Fluorescence PCR assay
Leukemia, AML) patient's body BAALC gene expression.
Background technique
Acute myeloid leukemia (Acute Myeloid Leukemia, AML) is the most common type of leukemia, mainly by
In leukemic stem cells clonal expansion, caused by causing marrow normal hematopoiesis function to be suppressed.AML existing cell something lost when diagnosing
Pass the important evidence for learning that exception is predictive disease prognosis.In recent years, the prognosis of AML patient is evaluated using molecular genetics,
In include gene unconventionality expression and mutation.BAALC (Brain And Acute Leukemia, Cytoplasmic) gene position
In 8q22.3, most early in finding its expression in neuroderm tissue.Tanner be equal to 2001 in hemopoietic forebody cell also
It was found that the expression of BAALC.Research report BAALC is in be overexpressed, and its overexpression is normal karyotype acute myeloid in AML patient
The influence factor of leukaemia (AML with normal cytogenetics, CN-AML) patient's prognosis mala.The country also has one
The clinical meaning that a little document report BAALC are overexpressed, however its result is not quite similar.Real-time quantitative PCR is applied in this research
(real-time quantitative PCR, RQ-PCR) method detects the expression of BAALC in Chinese population AML patient,
And its clinical meaning is inquired into.
The BAALC assignment of genes gene mapping encodes a kind of and any known albumen or functional domain without homology in chromosome 8q22.3
Protein.BAALC is mainly expressed in neuroectodermal origin tissue and hemopoietic forebody cell, mature marrow and peripheral blood list
Nucleus is not expressed.AML, acute lymphoblastic are from blood disease (acute lymphocytic leukemia.) and the CML sudden turn of events ALL
There is the high expression of BAALC gene in phase, and CML chronic phase and CLL then can't detect.Part is found from Stephan in 2001 etc.
There are the overexpressions of BAALC gene by AML, ALL patient.And BAALC gene overexpression it is related to the poor prognosis of AML patient with
Carry out expression of the research BAALC Ji Gang in AML and its becomes recent hot spot with the relationship of prognosis.Qualitative RT-PCR,
It is unfavorable for observing gene expression dose.RQ-PCR has many advantages, such as can to quantify, susceptibility is high, has become detection virus at present
With a main means of oncogene expression.
With advances in technology, quantitative PCR technique is widely used to the research of gene expression dose.Wherein real-time quantitative
PCR is most accurate, the best quantitative PCR research method of repeatability generally acknowledged at present.It passes through to each in pcr amplification reaction
The real-time monitoring of circulation products fluorescence signal is to realize quantitative to starting template and qualitatively analysis, advantage are as follows: l, special
Strong, the high sensitivity of property；2, capping is post-processed without PCR；3, quantification range is wide, can reach the l0 order of magnitude；4, using pair
The analysis of number phase, abandons endpoint data, quantitative accurate；5, the online real-time detection of instrument, visual result avoid artificially judging；6,
A Guan Shuanjian or more inspection can be achieved；7, safe operation shortens the time, improves efficiency.It is successfully used for oncogene expression quantity
Research.Common method has SYBR GreenI dye method, double probe hybrid methods and Taqman technology etc..Wherein SYBR
GreenI is due to being non-saturable dye, and specificity is not as good as double probe hybrid methods and Taqman method, it is necessary to bent by observation dissolution
Line come judge its specificity；And two probe method hybrid method cost is costly.Therefore this research uses real-time fluorescent PCR technology
It is applied to BAALC genetic test in conjunction with Taqman sonde method.
Summary of the invention
The present invention devises detection internal reference/target gene primer, probe sequence, using fluorescent quantitative PCR technique, utilizes
The method of double standard curves constructs the quantitation curves of reference gene ABL and target gene BAALC, testing goal base respectively
Expression because of BAALC relative to reference gene ABL.By adjusting the primed probe ratio of target gene and reference gene,
And PCR reaction condition, reach amplification efficiency and rate most preferably, so as to meet the detection of BAALC gene, for commenting
Valence therapeutic effect, prediction prognosis.
Primer and probe for BAALC gene relative expression quantity, which is characterized in that the primer and probe includes:
(1) upstream primer BAALC-F, downstream primer BAALC-R and the probe of BAALC gene are detected
BAALC-Probe,
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA.
(2) upstream primer ABL-F, downstream primer ABL-R and the probe ABL-Probe of reference gene ABL are detected,
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA.
The present invention also provides a kind of methods of BAALC gene in detection sample, the described method comprises the following steps:
(1) RNA in sample is extracted；
It (2) is cDNA by RNA reverse transcription；
(3) cDNA is added into reaction tube, using in the upstream and downstream primer and probe detection sample for BAALC
The fluorescence signal of BAALC gene；Utilize the ABL internal reference in the upstream and downstream primer and probe detection sample for ABL reference gene
The fluorescence signal of gene；
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA；
(4) according to the fluorescence signal of the fluorescence signal of BAALC gene and ABL reference gene, the BAALC base in sample is determined
The relative expression quantity of cause.
The present invention finally provides the kit of detection BAALC gene relative expression quantity, and the kit includes detection body
It is PCR reaction solution, the detection architecture PCR reaction solution includes:
(1) upstream primer BAALC-F, downstream primer BAALC-R and the probe BAALC-Probe of BAALC gene are detected,
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA.
(2) upstream primer ABL-F, downstream primer ABL-R and the probe ABL-Probe of reference gene ABL are detected,
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA.
Further, the kit further includes positive reference substance, negative controls and blank control product, and the positive is right
It is the positive plasmid solution containing BAALC cDNA sequence according to product, the negative controls are without containing BAALC cDNA sequence
Plasmid solution, the blank control product is physiological saline or any substance is not added.
Further, the kit further includes that sample rna extracts reagent, and the sample rna extracts reagent and includes
TRIzol, chloroform, isopropanol, 75% ethyl alcohol and RNase-free water.
Further, it further includes erythrocyte cracked liquid that the sample rna, which extracts reagent, and the erythrocyte cracked liquid includes 16
μm ol/L ammonium chloride, 1mmol/L saleratus and 12.5 μm of ol/L EDTA.
" BAALC cDNA sequence " in the present invention refers to mRNA that BAALC gene generates after transcribing after reverse transcription
The cDNA sequence of generation, or directly synthesized according to this cDNA sequence by chemical synthesis means.It will be whether by inverse
After transcription is still inserted into suitable plasmid by the BAALC cDNA sequence that chemical synthesis means directly generate, the positive can be used as
Reference substance carry out using.
Beneficial effects of the present invention: real-time fluorescent PCR technology is combined and uses Taqman probe, utilizes double standard curves
Method constructs the quantitation curves of reference gene ABL and BAALC target gene respectively, detects the table of BAALC in testee's body
It reaches.Compared to detection means such as previous FISH and △ △ CT methods, this method has accuracy high, is as a result convenient for interpretation etc. excellent
Point.In addition primer needed for reaction system, probe are carried out rational proportion and optimization by this method, reach experiment condition most preferably,
Grope link to eliminate cumbersome condition, greatly improves conventional efficient.This method is specific good after tested, sensitivity
Height, it is easy to operate, it can be provided for the treatment of mankind's acute myeloid leukemia (Acute Myeloid Leukemia, AML) patient
With reference to and foundation, facilitate Personalized medicine scheme formulation and disease prognosis judgement.
Detailed description of the invention
Fig. 1 is amplification curve diagram of the PUC57-T/BAALC positive plasmid under various concentration.
Fig. 2 be PUC57-T/BAALC positive plasmid as standard items the manufactured standard drawing under various concentration.
Fig. 3 is the amplification curve diagram of 100copies/ μ L PUC57-T/BAALC positive plasmid.
Fig. 4 is normal population blood sample BAALC expression quantity/ABL internal reference expression quantity numeric distribution.
Specific embodiment
Combined with specific embodiments below and attached drawing, the present invention is further explained.It should be noted that not specified in embodiment
Normal condition and method, usually routinely use method according to fields experimenter: for example, Ao Sibai and James Kingston chief editor
" fine works molecular biology experiment guide " fourth edition, or according to step proposed by manufacturer and condition.
Embodiment 1
Detect the kit of BAALC gene in sample, comprising:
(1) erythrocyte cracked liquid, including 16 μm of ol/L ammonium chlorides, 1mmol/L saleratus and 12.5 μm of ol/L EDTA.
(2) RNA extracts reagent, including TRIzol, chloroform, isopropanol, 75% ethyl alcohol and RNase-free water.
(3) RNA reverse transcription reagents, ReverTra Ace qPCR RT Kit kit (TOYOBO company).
(4) detection architecture PCR reaction solution, THNDERBIRD Probe qPCR Mix (2 ×) (TOYOBO company).Detection
System PCR reaction solution includes detecting upstream primer BAALC-F, downstream primer BAALC-R and the probe BAALC- of BAALC gene
Probe, upstream primer ABL-F, downstream primer ABL-R and probe ABL-Probe with detection reference gene ABL,
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA.
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA.
(5) positive reference substance, negative controls and blank control product, positive reference substance are to contain BAALCcDNA sequence
Positive plasmid solution, negative controls be the plasmid solution without containing BAALCcDNA sequence, blank control product be physiological saline or
Any substance is not added.
The base sequence of NO:1~6 primer and probe SEQ ID used in the present invention is as shown in table 1.
The sequence of 1. primer and probe of table
Embodiment 2
The operating process of the method for the present invention:
(1) it extracts the tissue RNA in blood: being added in the centrifuge tube of clean 1.5ml red thin in 1ml embodiment 1
Cellular lysate liquid takes anticoagulation 0.5ml to mix, is stored at room temperature 10min；5000rpm is centrifuged 5min, abandons supernatant, collects the thin of bottom
Born of the same parents；The erythrocyte cracked liquid in 0.5ml embodiment 1 is added again, 5000rpm is centrifuged 5min, abandons supernatant, collects the thin of bottom
Born of the same parents；1ml TRIzol is added into cell, piping and druming is completely dissolved until precipitating repeatedly, the static 5min of room temperature；0.2ml chlorine is added
Imitative, concussion is uniform；4 DEG C of centrifugation 10min of 14000rpm, absorption supernatant layer are transferred in another new centrifuge tube and (not draw white
Color middle layer)；Isometric isopropanol is added, mixes well up and down, is stored at room temperature 10min；4 DEG C of 14000rpm centrifugations
10min abandons supernatant, and 75% ethyl alcohol 1ml is added, gently turns upside down and washs tube wall；4 DEG C of centrifugation 5min of 14000rpm abandon second
Alcohol；20ulRNase-free water dissolution precipitating is added in drying at room temperature 10-15min.
(2) prepared by cDNA:, will with reference to the ReverTra Ace qPCR RT Kit kit specification of TOYOBO company
(1) RNA prepared in is reversed to cDNA.
(3) preparation of reagents: each X ul of detection architecture PCR reaction solution is configured by detection person-portion number, every person-portion 23ul is dispensed, such as
Shown in table 2:
X=23ul reaction solution × (8 parts of internal references (standard curve)+8 parts of target gene (standard curve)+1 part of sun of+n parts of samples
Property control+1 part of blank control of+1 part of negative control)；
Table 2BAALC reaction system
Wherein Forward Primer, Reverse Primer and TagMan Probe are respectively selected from BAALC-F, BAALC-
R and BAALC-Probe or ABL-F, ABL-R and ABL-Probe.
(4) it is loaded: the 2 μ l of cDNA prepared in the detection architecture PCR reaction solution and step (2) prepared in (3) is added
Into the hole of 96 orifice plates or reaction tube；Positive control and negative control directly add 2 μ l positive reference substances and negative controls；It is empty
Any substance is not added in white control plus 2 μ l physiological saline.Each sample is also required to 2 repetitions to ensure the stabilization of result.
(5) detect: detection carries out on real-time fluorescence PCR instrument, can include ABI7300, the 7500 (U.S. with instrument
Applied Biosystems company) etc..Reaction condition: 95 DEG C of initial denaturation 1min；95 DEG C of 15s, 58 DEG C of 35sec40 circulations,
Fluorescence signal acquires when 58 DEG C of 35sec.
(6) result judges: threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and
Ct value calculates copy number automatically.
1) when the internal reference positive, testing result just thinks effective；
2) positive judgment criteria: Ct < 36, for the positive；35≤Ct≤38 are the doubtful positive, need to verify again；Ct >
38, for feminine gender.
The detection of 3 positive plasmid of embodiment and sensitivity technique
When preparing positive plasmid, first directly synthesize BAALC cDNA, then be inserted respectively into the plasmid matter selected in advance
In grain (being illustrated by taking PUC57-T plasmid as an example here), PUC57-T/BAALC positive plasmid can be thus prepared.
The PUC57-T/BAALC positive plasmid prepared is subjected to gradient dilution, obtaining copy number is 107、106、105、
104、103、102The positive plasmid of copies/ μ l, and using the positive plasmid of these various concentrations as template, by embodiment 2 into
Row detection, as a result as shown in Figure 1, wherein the corresponding positive plasmid concentration of each amplification curve is respectively from left to right in Fig. 1
107、106、105、104、103、102.As shown in Figure 1, the equal initial line of BAALC and ABL, primer and probe of the invention can be used to detect
PUC57-T/BAALC positive plasmid.Then, using the positive plasmid logarithm of various concentration as abscissa, with dense by every kind
The positive plasmid of degree carries out detected Ct value as ordinate by embodiment 2, draws standard curve, as a result as shown in Figure 2.
The calculation shows that, the slope of the standard curve in Fig. 2 are -3.32, amplification efficiency 99.9%, it can be seen that the discovery present invention is right
The amplification efficiency of positive plasmid can reach requirement.
By 102、101、100The PUC57-T/BAALC positive plasmid of copies/ μ l is detected by embodiment 2, and every kind is not
Positive plasmid with concentration repeats to detect 10 times, as a result as shown in figure 3, from the figure 3, it may be seen that inspection of the present invention to this positive plasmid
Survey lower limit is 100copies.
Embodiment 4 detects clinical blood sample
Peripheral blood sample number 48 for fetching and delivering inspection extract sample rna, reagent preparation by 2 the method for embodiment and detect.
2ul in detection architecture PCR reaction solution is added in every sample.Positive, negative and blank control, reference gene/purpose base are done simultaneously
Each portion of the standard curve of cause.2 repetitions of each sample are to ensure the stabilization of result.By the way that 48 normal persons, (BAALC is expressed
Amount/ABL internal reference expression quantity) ratio statistics, obtain the expression range of normal person.(excluding invalid sample 5) thus obtains result:
BAALC expression quantity in normal population is extremely low or does not express, and concentration proportion is between 0-0.008.Experimental result such as table 3 and Fig. 4
It is shown.
3 48 clinical blood sample B AALC mRNA expressions of table
The present invention can quickly detect in sample with the presence or absence of BAALC gene and its expression quantity number.It is complete using the present invention
At testing result it is accurate and sensitive, can for mankind's acute myeloid leukemia (Acute Myeloid Leukemia, AML) assist
Formulate individualized treatment scheme and disease prognosis judgement.
Sequence table
<110>Fuzhou Adicon Clinical Laboratory, Inc.
<120>primer, probe and the method and kit of BAALC gene relative expression quantity in sample are detected
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agtccaagca gaagggcaga t 21
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
aggctcagaa ggtcccaaca a 21
<210> 3
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aattctactg agtccctggc aagac 25
<210> 4
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gatacgaagg gagggtgtac ca 22
<210> 5
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ctcggccagg gtgttgaa 18
<210> 6
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gcttctgatg gcaagctcta cgtctcct 28
Claims (6)
1. being used for the primer and probe of BAALC gene relative expression quantity, which is characterized in that the primer and probe includes:
(1) upstream primer BAALC-F, downstream primer BAALC-R and the probe BAALC-Probe of BAALC gene are detected,
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA.
(2) upstream primer ABL-F, downstream primer ABL-R and the probe ABL-Probe of reference gene ABL are detected,
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA.
2. a kind of method of BAALC gene in detection sample, which is characterized in that the described method comprises the following steps:
(1) RNA in sample is extracted；
It (2) is cDNA by RNA reverse transcription；
(3) cDNA is added into reaction tube, utilizes the BAALC base in the upstream and downstream primer and probe detection sample for BAALC
The fluorescence signal of cause；Utilize the ABL reference gene in the upstream and downstream primer and probe detection sample for ABL reference gene
Fluorescence signal；
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA；
(4) according to the fluorescence signal of the fluorescence signal of BAALC gene and ABL reference gene, the BAALC gene in sample is determined
Relative expression quantity.
3. detecting the kit of BAALC gene relative expression quantity, the kit includes detection architecture PCR reaction solution, feature
It is, the detection architecture PCR reaction solution includes:
(1) upstream primer BAALC-F, downstream primer BAALC-R and the probe BAALC-Probe of BAALC gene are detected,
BAALC-F:AGTCCAAGCAGAAGGGCAGAT；
BAALC-R:AGGCTCAGAAGGTCCCAACAA；
BAALC-Probe:FAM-AATTCTACTGAGTCCCTGGCAAGAC-TAMRA.
(2) upstream primer ABL-F, downstream primer ABL-R and the probe ABL-Probe of reference gene ABL are detected,
ABL-F:GATACGAAGGGAGGGTGTACCA；
ABL-R:CTCGGCCAGGGTGTTGAA；
ABL-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA.
4. kit as claimed in claim 3, the kit further includes positive reference substance, negative controls and blank control
Product, which is characterized in that the positive reference substance is the positive plasmid solution containing BAALC cDNA sequence, the negative controls
For the plasmid solution without containing BAALC cDNA sequence, the blank control product is physiological saline or any substance is not added.
5. kit as claimed in claim 3, which is characterized in that the kit further includes that sample rna extracts reagent, described
It includes TRIzol, chloroform, isopropanol, 75% ethyl alcohol and RNase-free water that sample rna, which extracts reagent,.
6. kit as claimed in claim 5, which is characterized in that it further includes erythrocyte splitting that the sample rna, which extracts reagent,
Liquid, the erythrocyte cracked liquid include 16 μm of ol/L ammonium chlorides, 1mmol/L saleratus and 12.5 μm of ol/L EDTA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910011711.1A CN109652510A (en) | 2019-01-07 | 2019-01-07 | Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910011711.1A CN109652510A (en) | 2019-01-07 | 2019-01-07 | Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109652510A true CN109652510A (en) | 2019-04-19 |
Family
ID=66118957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910011711.1A Pending CN109652510A (en) | 2019-01-07 | 2019-01-07 | Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109652510A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699454A (en) * | 2019-10-25 | 2020-01-17 | 北京艾迪康医学检验实验室有限公司 | Oligonucleotide, method and kit for detecting relative expression quantity of MLL5 gene in sample |
| CN110951877A (en) * | 2019-12-20 | 2020-04-03 | 济南艾迪康医学检验中心有限公司 | Primer and probe for detecting relative expression quantity of MN1 gene |
| CN111733239A (en) * | 2020-06-12 | 2020-10-02 | 杭州艾迪康医学检验中心有限公司 | Method, primer, probe and kit for detecting relative expression quantity of EVI1 gene |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103014154A (en) * | 2012-09-29 | 2013-04-03 | 李艳 | Kit capable of detecting expression quantity of BAALC (brain and acute leukemia cytoplasmic) gene mRNA (Messenger Ribose Nucleic Acid) |
-
2019
- 2019-01-07 CN CN201910011711.1A patent/CN109652510A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103014154A (en) * | 2012-09-29 | 2013-04-03 | 李艳 | Kit capable of detecting expression quantity of BAALC (brain and acute leukemia cytoplasmic) gene mRNA (Messenger Ribose Nucleic Acid) |
Non-Patent Citations (1)
| Title |
|---|
| 钟明华等: "实时定量逆转录PCR 检测急性髓系 白血病患者骨髓细胞BAALC 基因表达", 《中日友好医院学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699454A (en) * | 2019-10-25 | 2020-01-17 | 北京艾迪康医学检验实验室有限公司 | Oligonucleotide, method and kit for detecting relative expression quantity of MLL5 gene in sample |
| CN110951877A (en) * | 2019-12-20 | 2020-04-03 | 济南艾迪康医学检验中心有限公司 | Primer and probe for detecting relative expression quantity of MN1 gene |
| CN111733239A (en) * | 2020-06-12 | 2020-10-02 | 杭州艾迪康医学检验中心有限公司 | Method, primer, probe and kit for detecting relative expression quantity of EVI1 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105986028A (en) | Method for detecting HER 2 positivity of breast cancer through ddPCR technology | |
| CN108504742A (en) | A kind of kit and method detecting HER-2 gene copy number variations based on digital pcr technology | |
| CN106319042A (en) | PCR micro droplet kit for examining human EGFR gene mutation | |
| CN109652510A (en) | Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample | |
| CN110093413A (en) | Detect the primer sets and kit of beta Thalassemia | |
| CN106399462A (en) | BCR-ABL fusion gene amplification kit and BCR-ABL fusion gene detection kit | |
| CN106434982B (en) | The relevant molecular marked compound of cerebral arterial thrombosis and its application | |
| CN108315431A (en) | Digital pcr technology detects primer, probe and its detection method of c-MET gene magnifications | |
| CN109055555A (en) | A kind of lung cancer transfer diagnosis marker and its kit and application in early days | |
| CN104694623A (en) | Plasma miRNA marker for diagnosis of lung cancer and application | |
| CN106701962A (en) | Primer group, probe and kit for detecting Kawasaki disease | |
| CN107574246A (en) | Detect TBLR1 RAR α and PRKAR1A RAR alpha fusion gene relative expression quantity primed probe methods | |
| CN107267659A (en) | Detect the purposes of the product of TRIM genes and/or protein level | |
| CN110511995A (en) | One group of tuberculosis marker and its application | |
| CN110396542A (en) | A kind of LncRNA marker and its application in diabetes | |
| CN109385474A (en) | Breast cancer molecular parting and DISTANT METASTASES IN risk genes group and diagnostic products and application | |
| CN105734155B (en) | Chondroblastic osteosarcoma Disease-causing gene and its application | |
| CN107815494A (en) | Detect method, kit and the oligonucleotides of PCM1 JAK2 relative expression quantities | |
| CN110317870B (en) | miRNA marker for diagnosing prostate cancer, kit, system, application and detection method | |
| CN109402228A (en) | The method of RT-qPCR detection tree shrew SLC2A9/Glut9 gene transcription level | |
| CN107447008A (en) | For the enhancer RNA combinations of acatalepsia reason recurrent miscarriage, primer sets and application and kit | |
| CN103667457B (en) | The primer of detection leukemia BCR/ABL b3a2, b2a2 fusion gene relative expression quantity and method | |
| CN107029238B (en) | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis | |
| CN107287325A (en) | Detect oligonucleotides, method and the kit of BCR FGFR1 fusions | |
| CN107151699A (en) | Detect the kit and method of NUP214 ABL1 gene relative expression quantities |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190419 |