CN107287325A - Detect oligonucleotides, method and the kit of BCR FGFR1 fusions - Google Patents
Detect oligonucleotides, method and the kit of BCR FGFR1 fusions Download PDFInfo
- Publication number
- CN107287325A CN107287325A CN201710618750.9A CN201710618750A CN107287325A CN 107287325 A CN107287325 A CN 107287325A CN 201710618750 A CN201710618750 A CN 201710618750A CN 107287325 A CN107287325 A CN 107287325A
- Authority
- CN
- China
- Prior art keywords
- bcr
- fgfr1
- abl
- probe
- fusions
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses oligonucleotides, method and the kit for detecting BCR FGFR1 fusions in 8p11 myeloproliferativesyndromes (EMS) patient, it include expand BCR FGFR1 fusions primer and probe, and reference gene abl primer and probe.The present invention can in quick detection EMS patient body with the presence or absence of BCR FGFR1 fusions and its expression quantity number.The testing result completed using the present invention is accurate, it is sensitive, can auxiliary diagnosis marrow increase to syndrome, determine fused type, it is all significant for timely therapeutic intervention, adjustment therapeutic scheme, evaluation therapeutic effect, prediction prognosis in the pathogenetic early application of disease, targetedly targeted drug has stronger directive function.
Description
Technical field
The present invention provides oligonucleotides, method and the kit of BCR-FGFR1 fusions in detection sample, using probe
Taqman Real-Time Fluorescent Quantitative PCR Techniques, for detecting BCR- in mankind 8p11 myeloproliferativesyndromes (EMS) patient's body
FGFR1 track fusion levels, while carrying out accurate examination to people at highest risk.The kit can effectively save inspection
The survey time, improve accuracy of detection.
Background technology
Chromosome translocation, forms fusion, and then causes the constitutive expression of EGFR-TK in hematologic malignancies,
The disease of especially myeloproliferative syndrome plays very important effect in developing.
(FGFR1) assignment of genes gene mapping of fibroblast growth factor receptor 1 is in the 8p11 of chromosome, its FGFR1 egg encoded
It is one of receptor tyrosine kinase family member in vain.FGFR1 albumen possesses extracellular receptor binding domains, transmembrane region and intracellular tyrosine
Kinase catalytic domain, exists in unactivated state with monomeric form.It can also be entered in chromosome translocation by same activation
And cause the generation of disease.
8p11 myeloproliferativesyndromes (EMS) are a kind of very rare aggressive blood of companion's FGFRl gene rearrangements
Tumour, its main biological property is：It is abnormal that chromosome is related to 8p11, often with eosinophilia, enlargement of lymph nodes and with
Lymphoblastic lymphoma, rapid progression is acute blood disease in a short time.
Report that FGFR1 partner gene there are 14 kinds at present, and BCR-FGFR1 fusions are relatively rare, the fusion base
Because the exon of BCR genes the 4th will be caused to be connected with the 9th exon of FGFR1 genes., Roumiantsev etc. in 2004
177 tyrosine and GRB protein binding of the BCR-FGFR1 albumen likely via BCR are confirmed with mouse model, BCR- is participated in
ABL signal paths conduct, and cause mouse to produce the leukaemia of CML samples.
The pathogenetic early application of disease targetedly targeted drug for the treatment of such disease it is particularly significant, mostly
Number CML newly examines can alleviating by the complete cytogenetics of oral Imatinib appearance for patient, but is due to that this kind of disease is lacked
Weary enough understanding, many patients lose best occasion for the treatment.Therefore the development of fusion BCR-FGFR1 detection is conducive to disease
Early diagnosis and therapy.
The content of the invention
The present invention devises detection internal reference/target gene primer, probe sequence, using fluorescent quantitative PCR technique, utilizes
The method of double standard curves, builds reference gene abl and target gene BCR-FGFR1 quantitation curves, detection respectively
The BCR-FGFR1 expression relative to reference gene.Kit by adjust two genes primed probe ratio, and
PCR reaction conditions, make amplification efficiency and speed reach most preferably.
" BCR-FGFR1cDNA sequences " in the present invention refers to what BCR-FGFR1 fusions were produced after transcription
The cDNA sequence that mRNA is produced after reverse transcription, or directly synthesized by chemical synthesis means according to this cDNA sequence.
Whether after reverse transcription or the cDNA sequence directly produced by chemical synthesis means are inserted into suitable plasmid, it can make
Used for positive reference substance.
The invention provides the oligonucleotides for detecting BCR-FGFR1 fusions in sample, the oligonucleotides bag
Include sense primer BCR-FGFR1-F, anti-sense primer BCR-FGFR1-R and the probe BCR- of detection BCR-FGFR1 fusions
FGFR1-Probe, its base sequence is：
BCR-FGFR1-F:GAAGCCTTTGAAAGCCGC；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA。
Further, BCR-FGFR1-F：BCR-FGFR1-R：BCR-FGFR1-Probe mol ratio is 2:2:1.
Further, the oligonucleotides also includes sense primer abl-F, the anti-sense primer of detection abl reference genes
Abl-R and probe abl-Probe, its base sequence is：
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT–TAMRA。
Further, abl-F：abl-R：Abl-Probe mol ratio is 2:2:1.
The present invention also provides a kind of method for detecting BCR-FGFR1 fusions in sample, and its step is as follows：
(1) RNA in sample is extracted；
(2) the RNA reverse transcriptions for extracting (1) are cDNA；
(3) cDNA described in (2) is added into reaction tube, utilizes the sense primer for detecting BCR-FGFR1 fusions
BCR-FGFR1 fusions in BCR-FGFR1-F, anti-sense primer BCR-FGFR1-R and probe BCR-FGFR1-Probe detection samples
Gene by fluorescence signal；Utilize the sense primer abl-F, anti-sense primer abl-R and probe abl-Probe for detecting abl reference genes
The abl reference gene fluorescence signals in sample are detected, wherein
BCR-FGFR1-F:GAAGCCTTTGAAAGCCGC；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA；
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT–TAMRA。
(4) according to the BCR-FGFR1 fusions fluorescence signal and abl reference gene fluorescence signals in (3), sample is determined
In BCR-FGFR1 fusion relative expression quantities.
The present invention also provides a kind of kit for detecting BCR-FGFR1 fusions in sample, and the kit includes inspection
Survey system PCR reaction solutions, it is characterised in that the detection architecture PCR reaction solutions include the upper of detection BCR-FGFR1 fusions
Swim primer BCR-FGFR1-F, anti-sense primer BCR-FGFR1-R and probe BCR-FGFR1-Probe and detection abl reference genes
Sense primer abl-F, anti-sense primer abl-R and probe abl-Probe, wherein,
BCR-FGFR1-F:TGCCTATCCCTGTGCCTG；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA；
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
Further, BCR-FGFR1-F：BCR-FGFR1-R：BCR-FGFR1-Probe mol ratio is 2:2:1.
Further, abl-F：abl-R：Abl-Probe mol ratio is 2:2:1.
Further, the kit also includes positive reference substance, negative controls and blank control product, and the positive is right
It is the plasmid solution containing BCR-FGFR1cDNA sequences according to product, the negative controls are not contain BCR-FGFR1cDNA sequences
Plasmid solution, the blank control product are physiological saline or are not added with any material.
Further, the kit also includes sample rna extract solution and erythrocyte cracked liquid, the erythrocyte cracked liquid
Including 16 μm of ol/L ammonium chlorides, 1mmol/L saleratus and 12.5 μm of ol/L EDTA, the sample rna extract solution includes
TRIzol, chloroform, isopropanol, 75% ethanol and RNase-free water.
Beneficial effects of the present invention：Real-time fluorescence PCR technology is combined and uses Taqman probes by the present invention, utilizes double standards
The method of curve, builds reference gene abl and target gene BCR-FGFR1 quantitation curves respectively, detects testee's body
The interior BCR-FGFR1 expression relative to reference gene.Compared to PCR sequencing PCR, the kit has precision high, can quantify
The advantages of.In addition the primer needed for reaction system, probe are carried out rational proportion and optimization by the kit, reach experiment condition
Most preferably, so that eliminating cumbersome condition gropes link, conventional efficient is greatly improved.The kit is specific good after tested,
Sensitivity is high, easy to operate.BCR-FGFR1 in clinically 8p11 myeloproliferativesyndromes (EMS) patient's body is contributed to merge base
The minimal residue detection of cause, avoids hematology from recurring, adjusts therapeutic scheme, evaluates therapeutic effect, in advance for timely therapeutic intervention
Survey prognosis, prevent clinical recurrence all significant.
Brief description of the drawings
Fig. 1 is the fluorescent PCR testing result of positive sample (sample 1).
Fig. 2 is the fluorescent PCR testing result of negative sample (sample 2).
Embodiment
With reference to specific embodiments and the drawings, the present invention is expanded on further.It should be noted that not specified in embodiment
Normal condition and method, generally according to art experimenter routinely use method：For example, Ao Sibai and James Kingston chief editor
's《Fine works molecular biology experiment guide》Fourth edition, or according to the step and condition proposed by manufacturer.
Embodiment 1
Oligonucleotides for detecting BCR-FGFR1 fusions in sample, the oligonucleotides includes detection BCR-
Sense primer BCR-FGFR1-F, anti-sense primer BCR-FGFR1-R and the probe BCR-FGFR1-Probe of FGFR1 fusions,
Its base sequence is：
BCR-FGFR1-F:TGCCTATCCCTGTGCCTG；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA。
Further, the oligonucleotides also includes sense primer abl-F, the anti-sense primer of detection abl reference genes
Abl-R and probe abl-Probe, its base sequence is：
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
A kind of method of BCR-FGFR1 fusions in detection sample, its step is as follows：
(1) RNA in sample is extracted；
(2) the RNA reverse transcriptions for extracting (1) are cDNA；
(3) cDNA described in (2) is added into reaction tube, utilizes the sense primer for detecting BCR-FGFR1 fusions
BCR-FGFR1 fusion bases in BCR-FGFR1, anti-sense primer BCR-FGFR1-R and probe BCR-FGFR1-Probe detection samples
Because of fluorescence signal；Examined using the sense primer abl-F, anti-sense primer abl-R and probe abl-Probe that detect abl reference genes
Abl reference gene fluorescence signals in test sample sheet, wherein
BCR-FGFR1-F:TGCCTATCCCTGTGCCTG；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA；
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
(4) according to the BCR-FGFR1 fusions fluorescence signal and abl reference gene fluorescence signals in (3), sample is determined
In BCR-FGFR1 fusion relative expression quantities.
The kit of BCR-FGFR1 fusions in a kind of detection sample, including：
Erythrocyte cracked liquid：16 μm of ol/L ammonium chlorides, 1mmol/L saleratus and 12.5 μm of ol/L EDTA；
Sample rna extract solution：TRIzol, chloroform, isopropanol, 75% ethanol, RNase-free water；
Detection architecture PCR reaction solutions：ReverTra Ace qPCR RT Kit (TOYOBO companies)；THNDERBIRD
Probe qPCR Mix (2 ×), sense primer BCR-FGFR1-F, the anti-sense primer BCR- for detecting BCR-FGFR1 fusions
Each 0.8 μM of FGFR1-R, 0.4 μM of probe BCR-FGFR1-Probe, and detection abl reference genes sense primer abl-F,
Each 0.8 μM of anti-sense primer abl-R, abl-probe0.4 μM of probe；Wherein：
BCR-FGFR1-F:TGCCTATCCCTGTGCCTG；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA；
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
Positive reference substance：Plasmid solution containing BCR-FGFR1cDNA sequences.
Negative controls：The plasmid solution of BCR-FGFR1cDNA sequences is not contained.
Blank control product：Physiological saline is not added with any material.
Embodiment 2
The testing process of this method：
(1) the tissue RNA in extracting blood：1ml erythrocyte cracked liquids are added in clean 1.5ml centrifuge tube, are taken
Anticoagulation 0.5ml is mixed.It is stored at room temperature 10min；5000rpm centrifuges 5min, abandons supernatant, collects the cell of bottom；Add again
0.5ml erythrocyte cracked liquids, 5000rpm centrifugation 5min, abandon supernatant, collect the cell of bottom；1ml is added into cell
TRIzol, repeatedly piping and druming is completely dissolved until precipitating, the static 5min of room temperature；0.2ml chloroforms are added, concussion is uniform；14000rpm
4 DEG C of centrifugation 10min, draw supernatant layer and are transferred in another new centrifuge tube；Isometric isopropanol is added, it is fully mixed up and down
It is even, it is stored at room temperature 10min；4 DEG C of centrifugation 10min of 14000rpm, abandon supernatant, add 75% ethanol 1ml, gently turn upside down and wash
Wash tube wall；4 DEG C of centrifugation 5min of 14000rpm, abandon ethanol；Drying at room temperature 10-15min, adds the dissolving of 20 μ lRNase-free water
Precipitation.
(2) with reference to the Rever Tra Ace qPCR RT Kit kit specifications of TOYOBO companies, RNA is reversed to
cDNA。
(3) reagent is configured：By detection people's number configuration each X μ l of detection architecture PCR reaction solutions, per the μ l of person-portion 23 packing：
X=23 μ l reaction solutions × (8 parts of internal references (standard curve)+8 parts of target gene (standard curve)+1 part of sun of+n parts of samples
Property control+1 part of negative control+1 part of blank control)；
(4) it is loaded：The μ l of cDNA 2 in detection architecture PCR reaction solutions in (3) and step (2) are added to 96 orifice plates
In hole or reaction tube；Positive control and negative control directly add 2 μ l positive reference substances and negative controls；Blank control adds 2 μ
L physiological saline is not added with any material.
(5) detect：Detection is carried out on real-time fluorescence PCR instrument, can include ABI7300,7500 (U.S. Appl with instrument
Ied Biosystems companies) etc..Reaction condition：95 DEG C of pre-degeneration 1min；40 circulations of 95 DEG C of 15s, 58 DEG C of 35sec, fluorescence
Signal is gathered when 58 DEG C of 35sec.
(6) result judges：Threshold line is adjusted to more than background signal and negative amplification line, system according to standard curve and
CT values calculate copy number automatically.
1) when internal reference is positive, testing result just thinks effective；
2) positive criterion：, Ct<36, it is positive；35≤Ct≤38, are the doubtful positive, it is necessary to verify again；Ct ＞
38, it is negative.
(7) after being judged as that sample is positive through step (6), the BCR-FGFR1 fusions that are collected according to step (5) and
Abl reference gene fluorescence signals, determine the BCR-FGFR1 fusion relative expression quantities in sample.
Embodiment 3：Sensitivity technique result
By the positive reference substance in embodiment 1, will the plasmid containing BCR-FGFR1cDNA sequences, by 10,
102……..1010Extension rate carry out gradient dilution, the dilution that each gradient dilution is obtained respectively as cDNA templates,
Fluorescent PCR amplification and detection are carried out according to the step (3) in embodiment 2~(7) method, while in the different Kong Zhongchong of 96 orifice plates
Recheck and survey 10 times, dilution 1010With 1011Times when testing result respectively as shown in Table 1 and Table 2：
The dilution of table 1 1010When (concentration be 16.9copies/ μ L) testing result
The dilution of table 2 1011When (concentration be 1.69copies/ μ L) testing result
| The hole of 96 orifice plates | Ct(BCR-FGFR1) |
| A5 | Undet. |
| B5 | Undet. |
| C4 | Undet. |
| C5 | Undet. |
| D4 | Undet. |
| D5 | Undet. |
| E4 | Undet. |
| F4 | Undet. |
| G4 | Undet. |
| H4 | Undet. |
The left column of Tables 1 and 2 is the hole numbering in 96 holes corresponding every time when repeating to detect 10 times, and right row are inspections every time
The Ct values that system is measured during survey.
As shown in Table 1, when extension rate is 1010When, detection 10 times is repeated, typical S types amplification curve is produced every time.
As shown in Table 2, when extension rate is 1011When, repetition, which is detected 10 times, does not all detect (Undet.).Hence, it can be determined that this
The Monitoring lower-cut (detection sensitivity in other words) of invention detection is 16.9copies/ μ L, i.e., 16.9 × 103copies/ml。
The positive sample of embodiment 4 and negative sample checking
Because BCR-FGFR1 fusions are more rare, therefore the positives sample of this experiment is used containing BCR-
The plasmid solution (being designated as sample 1) of FGFR1cDNA sequences, negative sample then uses the visiting sample (being designated as sample 2) of Healthy People,
Detected by the method in embodiment 2.
Every part of sample adds 2 μ l in detection architecture PCR reaction solutions.Detection time is only 100 minutes.
The testing result figure of sample 1 is as shown in figure 1, reference gene abl amplified signal shows PCR system stabilization, detection
As a result effectively, the BCR-FGFR1 types CT of sample 1<There is amplified signal before 36, so sample 1 is BCR-FGFR1 positive.
The testing result figure of sample 2 is as shown in Fig. 2 reference gene abl amplified signal shows that tested sample genome is carried
Success is taken, testing result is effective, the BCR-FGFR1 types CT of sample 2>Without amplified signal after 38, so sample 2 is BCR-
FGFR1 is negative.
The clinical sample of embodiment 5 is detected
20 parts of clinical sample to be checked is taken, by the tissue RNA in the methods described of embodiment 2 extraction sample, reagent preparation simultaneously
Detection.
Every part of sample adds 2 μ l in detection architecture PCR reaction solutions.Detected with fluorescent PCR instrument, the time is 100 minutes.20
The equal initial lines of the abl of all samples in clinical sample, and BCR-FGFR1 can not be detected, and illustrate none example in 20 samples
BCR-FGFR1 is positive.Experimental result is as shown in table 3 below：
3 20 clinical sample BCR-FGFR1 testing results of table
SEQUENCE LISTING
<110>ADICON Clinical Laboratories, Inc.
<120>Detect oligonucleotides, method and the kit of BCR-FGFR1 fusions
<130>
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence
<400> 1
gaagcctttg aaagccgc 18
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
gagtcccact ggaggagagc 20
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence
<400> 3
tgatggccga accagaagaa ccc 23
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<400> 4
gatacgaagg gagggtgtac ca 22
<210> 5
<211> 18
<212> DNA
<213>Artificial sequence
<400> 5
ctcggccagg gtgttgaa 18
<210> 6
<211> 28
<212> DNA
<213>Artificial sequence
<400> 6
gcttctgatg gcaagctcta cgtctcct 28
Claims (10)
1. the oligonucleotides for detecting BCR-FGFR1 fusions, it is characterised in that the oligonucleotides includes detection BCR-
Sense primer BCR-FGFR1-F, anti-sense primer BCR-FGFR1-R and the probe BCR-FGFR1-Probe of FGFR1 fusions,
Its base sequence is：
BCR-FGFR1-F:GAAGCCTTTGAAAGCCGC；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA。
2. oligonucleotides as claimed in claim 1, it is characterised in that BCR-FGFR1-F：BCR-FGFR1-R：BCR-FGFR1-
Probe mol ratio is 2:2:1.
3. oligonucleotides as claimed in claim 1, it is characterised in that the oligonucleotides also includes detection abl reference genes
Sense primer abl-F, anti-sense primer abl-R and probe abl-Probe, its base sequence is：
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT–TAMRA。
4. primer and probe as claimed in claim 3, it is characterised in that abl-F：abl-R：Abl-Probe mol ratio is
2:2:1。
5. a kind of method of detection BCR-FGFR1 fusions, it is characterised in that：
(1) RNA in sample is extracted；
(2) the RNA reverse transcriptions for extracting (1) are cDNA；
(3) cDNA described in (2) is added into reaction tube, utilizes the sense primer BCR- for detecting BCR-FGFR1 fusions
BCR-FGFR1 fusions in FGFR1-F, anti-sense primer BCR-FGFR1-R and probe BCR-FGFR1-Probe detection samples
Fluorescence signal；Detected using the sense primer abl-F, anti-sense primer abl-R and probe abl-Probe that detect abl reference genes
Abl reference gene fluorescence signals in sample, wherein
BCR-FGFR1-F:GAAGCCTTTGAAAGCCGC；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA；
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT–TAMRA。
(4) according to the BCR-FGFR1 fusions fluorescence signal and abl reference gene fluorescence signals in (3), determine in sample
BCR-FGFR1 fusion relative expression quantities.
6. a kind of kit of detection BCR-FGFR1 fusions, the kit includes detection architecture PCR reaction solutions, it is special
Levy and be, the detection architecture PCR reaction solutions include detection BCR-FGFR1 fusions sense primer BCR-FGFR1-F, under
Swim primer BCR-FGFR1-R and probe BCR-FGFR1-Probe and detect the sense primer abl-F of abl reference genes, downstream
Primer abl-R and probe abl-Probe, wherein,
BCR-FGFR1-F:TGCCTATCCCTGTGCCTG；
BCR-FGFR1-R:GAGTCCCACTGGAGGAGAGC；
BCR-FGFR1-Probe:FAM-TGATGGCCGAACCAGAAGAACCC-TAMRA；
abl-F:GATACGAAGGGAGGGTGTACCA；
abl-R:CTCGGCCAGGGTGTTGAA；
abl-Probe:FAM-GCTTCTGATGGCAAGCTCTACGTCTCCT-TAMRA。
7. kit as claimed in claim 6, it is characterised in that BCR-FGFR1-F：BCR-FGFR1-R：BCR-FGFR1-
Probe mol ratio is 2:2:1.
8. kit as claimed in claim 6, it is characterised in that abl-F：abl-R：Abl-Probe mol ratio is 2:2:
1。
9. kit as claimed in claim 6, the kit also includes positive reference substance, negative controls and blank control
Product, it is characterised in that the positive reference substance is the plasmid solution containing BCR-FGFR1cDNA sequences, the negative controls
Not contain the plasmid solution of BCR-FGFR1cDNA sequences, the blank control product are physiological saline or are not added with any material.
10. the kit as described in one of claim 6~9, the kit also includes sample rna extract solution and red blood cell splits
Solve liquid, it is characterised in that the erythrocyte cracked liquid includes 16 μm of ol/L ammonium chlorides, 1mmol/L saleratus and 12.5 μm of ol/
L EDTA, the sample rna extract solution includes TRIzol, chloroform, isopropanol, 75% ethanol and RNase-free water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710618750.9A CN107287325A (en) | 2017-07-26 | 2017-07-26 | Detect oligonucleotides, method and the kit of BCR FGFR1 fusions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710618750.9A CN107287325A (en) | 2017-07-26 | 2017-07-26 | Detect oligonucleotides, method and the kit of BCR FGFR1 fusions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107287325A true CN107287325A (en) | 2017-10-24 |
Family
ID=60103112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710618750.9A Pending CN107287325A (en) | 2017-07-26 | 2017-07-26 | Detect oligonucleotides, method and the kit of BCR FGFR1 fusions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107287325A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112608997A (en) * | 2020-12-17 | 2021-04-06 | 武汉艾迪康医学检验所有限公司 | Method, primer, probe and composition for screening eosinophilia-related fusion gene by using multiplex fluorescence PCR (polymerase chain reaction) technology |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667457A (en) * | 2012-04-25 | 2014-03-26 | 武汉艾迪康医学检验所有限公司 | Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level |
| CN103757102A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method and oligonucleotide for detecting type-B TEL-ABL fusion gene |
| CN103757101A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide |
-
2017
- 2017-07-26 CN CN201710618750.9A patent/CN107287325A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667457A (en) * | 2012-04-25 | 2014-03-26 | 武汉艾迪康医学检验所有限公司 | Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level |
| CN103757102A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method and oligonucleotide for detecting type-B TEL-ABL fusion gene |
| CN103757101A (en) * | 2013-12-23 | 2014-04-30 | 成都艾迪康医学检测实验室有限公司 | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide |
Non-Patent Citations (2)
| Title |
|---|
| THOAS FIORETOS ET AL.: "Fusion of the BCR and the fibroblast growth factor receptor-1(FGFR1) genes as a result of t(8;22)(p11;q11) in a myeloproliferative disorder: The first fusion gene involving BCR but not ABL", 《GENES, CHROMOSOMES & CANCER》 * |
| 李自刚 李鸣晓主编: "《生物检测技术》", 31 August 2016, 中国轻工业出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112608997A (en) * | 2020-12-17 | 2021-04-06 | 武汉艾迪康医学检验所有限公司 | Method, primer, probe and composition for screening eosinophilia-related fusion gene by using multiplex fluorescence PCR (polymerase chain reaction) technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450901B (en) | The nucleic acid markers of quick diagnosis mucocutaneous lymphnode syndrome and test kit thereof | |
| CN107663533A (en) | A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application | |
| CN105986028A (en) | Method for detecting HER 2 positivity of breast cancer through ddPCR technology | |
| EP2910948A1 (en) | Novel cancer marker and utilization thereof | |
| CN108559776A (en) | A kind of biomarker and its application for sudden weak smart auxiliary diagnosis | |
| CN105980555A (en) | Novel fusion gene as factor responsible for stomach cancer | |
| CN107385038A (en) | Detect oligonucleotides, method and the kit of ZNF198 FGFR1 fusions in sample | |
| CN108642156A (en) | A kind of the digital pcr detection kit and its detection method of T790M gene mutations | |
| CN108977529A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
| CN109652510A (en) | Detect primer, probe and the method and kit of BAALC gene relative expression quantity in sample | |
| CN102649977B (en) | Kit for detecting relative expression index of leukemia BCR/ABL (m-bcr) fusion gene | |
| CN107815494B (en) | Method, kit and oligonucleotide for detecting relative expression amount of PCM1-JAK2 | |
| CN106906288A (en) | Detect the primer and method of leukaemia CDX2 gene expression doses | |
| CN107287325A (en) | Detect oligonucleotides, method and the kit of BCR FGFR1 fusions | |
| CN104611430A (en) | Detection method and primers for TMPRSS2-ERG gene in human urine | |
| CN103757101A (en) | Method for detecting relative expression quantity of fusion gene ATIC-ALK and oligonucleotide | |
| CN109735612A (en) | The biomolecule marker and its kit of Kawasaki disease coronary aneurysm complication | |
| CN104984363B (en) | Applications of the ZMYM1 in Parkinson's diagnosis and treatment reagent is prepared | |
| CN103667457B (en) | The primer of detection leukemia BCR/ABL b3a2, b2a2 fusion gene relative expression quantity and method | |
| CN102758006B (en) | Kit for detecting relative expression of leukemia BCR/ABL (b3a2, b2a2) fusion gene | |
| CN107151699A (en) | Detect the kit and method of NUP214 ABL1 gene relative expression quantities | |
| CN111471683A (en) | Application of miR-93-5p as marker for diagnosing and treating gastric cancer | |
| CN110988346A (en) | Marker for auxiliary diagnosis of lung cancer and detection method | |
| CN105506131A (en) | Primer pair for detecting people AEG-1 gene expression quantity and relative expression quantity | |
| CN108949981A (en) | Utilize the kit of real-time fluorescence quantitative PCR detection VEGFR2 gene relative expression quantity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171024 |