CN109652430B - Influenza virus mutants and uses thereof - Google Patents

Abstract

The present invention relates to influenza virus mutants and uses thereof. The invention discloses a nucleic acid sequence which comprises SEQ ID NO. 1.

Description

Influenza virus mutants and uses thereof

The present application is a divisional application of an invention patent application with the application date of 2012, 6, 21, the application number of 201280040857.5 and the invention name of "influenza virus mutant and application thereof".

Cross Reference to Related Applications

The present application claims the benefit of U.S. provisional application No. 61/501,034 filed on 24 th month 6 2011, the contents of which are incorporated herein by reference in their entirety.

Sequence listing

The present application contains a sequence listing in ASCII format that has been submitted through EFS-Web and the entire contents of this sequence listing are incorporated herein by reference. The ASCII copy name created on month 21 of 2013 is 090248-0125_sl.txt and is 28,140 bytes in size.

Background

Influenza is the leading cause of death in adults in the united states. Every year, about 36,000 people die from influenza, with over 200,000 hospitalized. Influenza is a highly contagious disease that is transmitted by coughing, sneezing and by direct physical contact with virus-carrying objects such as door handles and telephones. Symptoms of influenza include fever, extreme fatigue, headache, coldness, and body pain; about 50% of the infected subjects are asymptomatic, but still contagious. Immunization is 70-90% effective in preventing influenza in healthy humans under 65 years of age, provided that the antigenicity of the circulating strain matches that of the vaccine.

Vaccination is the primary method of preventing influenza, and both live attenuated and inactivated (killed) viral vaccines are currently available. Live viral vaccines, which are typically administered intranasally, activate all stages of the immune system and can stimulate an immune response against a variety of viral antigens. Thus, the use of live viruses overcomes the problem of viral antigen destruction that may occur during the preparation of inactivated viral vaccines. In addition, immunity generated by live virus vaccines is generally more durable, more efficient and more cross-reactive than immunity induced by inactivated vaccines, and live virus vaccines are less costly to produce than inactivated virus vaccines. However, mutations in attenuated viruses are often less defined and recovery is a problem.

Disclosure of Invention

In one aspect, the present disclosure provides a nucleic acid sequence comprising SEQ ID NO. 1.

In one aspect, the present disclosure provides a nucleic acid sequence comprising SEQ ID NO. 2.

In one aspect, the present disclosure provides a nucleic acid sequence comprising SEQ ID NO. 3.

In one aspect, the present disclosure provides a composition comprising SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 3 operably linked to (i) a promoter and (ii) a transcription termination sequence.

In one aspect, the present disclosure provides a recombinant influenza virus comprising a mutation in the M gene. In certain embodiments, the recombinant influenza virus comprises SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. In certain embodiments, a mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID NO. 4. In certain embodiments, the mutation in the M gene does not revert to wild-type or a non-wild-type sequence encoding a functional M2 protein in an in vitro host cell system for at least 10 generations. In certain embodiments, the virus is an influenza a virus. In certain embodiments, the virus is non-pathogenic in a mammal infected with the virus. In certain embodiments, the in vitro cell system comprises chinese hamster ovary cells. In certain embodiments, the in vitro cell system comprises Vero cells.

In one aspect, the present disclosure provides a cell comprising the recombinant influenza virus of any one of claims 5-10. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in vivo.

In one aspect, the present disclosure provides a composition comprising: recombinant influenza virus containing mutations in the M gene. In certain embodiments, the composition comprises SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. In certain embodiments, a mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID NO. 4. In certain embodiments, the virus is an influenza a virus. In certain embodiments, the composition is non-pathogenic to the mammal to which the composition is administered. In certain embodiments, the composition elicits a detectable immune response in a mammal within about 3 weeks after administration of the composition to the mammal.

In one aspect, the present disclosure provides a vaccine comprising: recombinant influenza virus containing mutations in the M gene. In certain embodiments, the vaccine comprises SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. In certain embodiments, a mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID NO. 4. In certain embodiments, the virus is an influenza a virus. In certain embodiments, the vaccine is non-pathogenic to the mammal to which the vaccine is administered. In certain embodiments, the vaccine elicits a detectable immune response in a mammal within about 3 weeks after administration of the vaccine to the mammal. In certain embodiments, the vaccine comprises at least 2 different influenza strains in addition to the recombinant virus. In certain embodiments, the vaccine comprises at least one influenza b virus or influenza b virus antigen. In certain embodiments, the vaccine comprises at least one influenza c virus or influenza c virus antigen. In certain embodiments, the vaccine comprises one or more viruses or viral antigens comprising human influenza a and pandemic influenza virus from a non-human species. In certain embodiments, the vaccine comprises a human influenza a virus selected from the group consisting of H1N1, H2N2, and H3N 2.

In one aspect, the present disclosure provides a method for propagating a recombinant influenza virus, the method comprising: contacting the host cell with recombinant influenza virus SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3; incubating the host cells for a sufficient time and isolating the progeny virus particles under conditions suitable for viral replication.

In one aspect, the present disclosure provides a method for preparing a vaccine, the method comprising: placing a host cell into a bioreactor; contacting the host cell with recombinant virus SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3; incubating the host cell for a sufficient time under conditions suitable for propagation of the virus; isolating the progeny virus particles; and formulating the progeny virus particles for administration as a vaccine.

In one aspect, the present disclosure provides a method for immunizing a subject, the method comprising: administering a composition comprising a recombinant influenza virus comprising a mutation in the M gene, wherein the mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus to express a truncated M2 protein having the amino acid sequence of SEQ ID No. 4.

In one aspect, the present disclosure provides a method for reducing the likelihood or severity of an influenza a virus infection in a subject, the method comprising: administering a composition comprising a recombinant influenza virus comprising a mutation in the M gene, wherein the mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus to express a truncated M2 protein having the amino acid sequence of SEQ ID No. 4. In certain embodiments, the recombinant influenza virus comprises SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. In certain embodiments, the method comprises: providing at least 1 booster dose of the composition, wherein the at least 1 booster dose is provided 3 weeks after the first administration. In certain embodiments, the method comprises: the composition is administered intranasally, intramuscularly or intradermally. In certain embodiments, the method comprises: the administration is performed intradermally. In certain embodiments, the method comprises: application was performed using a microneedle delivery device.

In one aspect, the present disclosure provides a method for intradermal administration of an immunogenic composition, the method comprising: (a) Providing a microneedle delivery device comprising (i) a piercing mechanism; (ii) An immunogenic composition layer comprising a plurality of microneedles capable of piercing the skin and allowing intradermal administration of the immunogenic composition; and (b) compressing the lancing mechanism; wherein the immunogenic composition comprises a recombinant influenza virus comprising a mutation in the M gene, and wherein the mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID No. 4. In certain embodiments, the recombinant influenza virus comprises SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3. In certain embodiments, the microneedle array is initially located inside the device housing and, upon actuation of the lever, allows the microneedles to extend through the bottom of the device and into the skin, thereby allowing infusion of vaccine fluid into the skin.

In one aspect, the present disclosure provides a recombinant influenza virus comprising a mutation in the M gene, wherein the virus does not replicate in an unmodified host cell selected from the group consisting of: a Chinese Hamster Ovary (CHO) cells, vero cells, or Madin-Darby canine kidney cells. In certain embodiments, a mutation in the M gene results in a failure of the virus to express the M2 protein, or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID NO. 4.

In one aspect, the present disclosure provides a recombinant cell comprising a nucleic acid encoding an influenza virus M2 ion channel gene, wherein the nucleic acid is expressed in the cell.

In one aspect, the present disclosure provides a recombinant cell comprising a 2, 6-sialic acid receptor gene.

In one aspect, the present disclosure provides a recombinant cell comprising a cell genome or expression vector that expresses (i) an M2 ion channel gene of a virus and (ii) a 2, 6-sialic acid receptor gene. In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the eukaryotic cell is a chinese hamster ovary cell or Vero cell. In certain embodiments, the recombinant cell further comprises a human influenza virus, wherein the virus does not express a functional M2 protein.

In one aspect, the present disclosure provides a method for producing a recombinant influenza virus particle, the method comprising: (A) Infecting a cell of one of claims 47-52 with a human influenza virus, wherein the cell either (i) constitutively expresses a functional M2 ion channel protein or (ii) is induced to express a functional M2 ion channel protein after infection by the virus, and wherein the virus successfully replicates only in the presence of the functional M2 ion channel protein expressed by the cell; and (B) isolating the progeny virus particles. In certain embodiments, the method further comprises: the isolated viral particles are formulated into a vaccine. In certain embodiments, the virus comprises a human influenza virus, and wherein the virus does not express a functional M2 protein.

Drawings

FIG. 1 is a graph depicting the role of M2 ion channels in the life cycle of influenza virus, wherein (1) influenza virus attaches to sialic acid receptors on the cell surface; (2) the virus is internalized into the cell; (3) expression of M2 ion channels on viral surfaces; (4) The M2 ion channel opens to allow proton entry, resulting in release of viral RNA into the nucleus, replication, and viral protein synthesis; and (5) the viral component is packaged into a viral particle and released.

FIG. 2 is a schematic representation of the wild-type and mutant M2 genes. The M2 gene of the A/Puerto Rico/8/1934 (PR 8) M segment was deleted as follows: 2 stop codons were inserted downstream of the open reading frame of the M1 protein followed by deletion of 51 nucleotides in the transmembrane domain to inhibit expression of the full length M2 protein.

FIG. 3 shows the nucleotide sequences of unprocessed M1 and M2 (SEQ ID NO: 28).

The graph of fig. 4 shows the growth kinetics of M2KO (Δtm) (upper panel) and wild-type PR8 (lower panel) viruses in normal MDCK cells and MDCK cells stably expressing M2 protein (M2 CK). At 10 ^-5 Is a complex of infection, and the cells are infected with a virus. Viral titers in cell supernatants were determined. Wild-type PR8 grew to high titers in both cell types, whereas M2KO (ΔTM) grew better in M2CK cells only, and did not grow at all in MDCK cells.

Western blot of FIG. 5 shows that M2KO (ΔTM) virus produces viral antigen in normal cells, but does not produce M2. Cell lysates were probed with PR8 infected mouse serum (panel A) or anti-M2 monoclonal antibody (panel B). Lane 1, molecular weight markers; lane 2, MDCK cells infected with PR 8; lane 3, MDCK cells infected with M2KO (Δtm); lane 4, uninfected MDCK cells.

The graph of fig. 6 shows the change in body weight of mice after inoculation with the M2KO variant.

Figure 7A is a graph showing antibody responses in mice vaccinated with M2KO variants.

Figure 7B is a graph showing anti-PR 8IgG antibody titers in serum of mice boosted 6 weeks after infection.

Figure 8 is a graph showing the change in body weight of mice after influenza challenge following inoculation of the M2KO variant.

Figure 9 is a graph showing survival of mice following influenza challenge following inoculation of the M2KO variant.

The graph of fig. 10 shows the change IN body weight of mice after Intranasal (IN), intradermal (ID) or Intramuscular (IM) inoculation with PR 8.

FIG. 11A is a graph showing that PR8 was inoculated with 1.8X10 s 2 weeks later ¹ pfu (Lo) or 1.8x10 ⁴ Antibody titer in serum collected from mice at pfu (Hi) virus concentration. FIG. 11B is a graph showing that PR8 was inoculated 7 weeks after having a concentration of 1.8x10 ¹ pfu (Lo) or 1.8x10 ⁴ Antibody titer in serum collected from mice at vaccine concentration for pfu (Hi).

Figure 12 is a graph showing survival of mice following influenza challenge after PR8 inoculation.

The graph of fig. 13 shows the change in body weight of mice after influenza challenge after PR8 inoculation.

FIG. 14 is a graph showing antibody titers in serum collected from mice vaccinated intradermally 1.8x10 7 weeks after vaccination ⁴ pfu PR8。

FIG. 15 is a graph showing intradermal inoculation of 1.8x10 ⁴ Variation of body weight of pfu PR8 mice.

Figure 16 is a graph showing the percent survival of mice infected with a heterosubtype virus after challenge.

Figure 17 is a graph showing ELISA titers from mice from different vaccinated groups.

Figure 18 is a graph showing the percent survival of mice after infection with an isoform virus.

Figure 19 is a graph showing the percent survival of mice following challenge with a heterosubtype virus.

The graph of fig. 20 shows the change in body weight of vaccinated ferrets (ferret). Inoculation of ferrets 10 ⁷ TCID ₅₀ M2KO (delta. TM) virus (group A) or 10 ⁷ TCID ₅₀ Influenza a virus (group B) of brisban/10/2007 (H3N 2). Body weight was monitored 3 days after inoculation.

The graph of fig. 21 shows the change in body temperature of the vaccinated ferret. Inoculation of ferrets 10 ⁷ TCID ₅₀ M2KO (delta. TM) virus (group A) or 10 ⁷ TCID ₅₀ Influenza a virus (group B) of brisban/10/2007 (H3N 2). Body temperature was monitored 3 days after inoculation.

The graph of fig. 22 shows the change in body weight of ferrets after vaccination. Inoculation of ferrets 10 ⁷ TCID ₅₀ M2KO (delta. TM) virus [ G1 and G3 ]]、10 ⁷ TCID ₅₀ FM#6 virus [ G2 and G4 ]]Or OPTI-MEM ^TM [G5]. The body weight change was monitored for 14 days after challenge vaccination (group a) and after receiving booster vaccine (group B).

The graph of fig. 23 shows the change in body weight of ferrets after challenge. With 10 ⁷ TCID ₅₀ Influenza A virus of (B) A/Brisban/10/2007 (H3N 2) attacks ferrets. Body weight was monitored for 14 days post inoculation.

The graph of fig. 24 shows the change in body temperature of ferrets after vaccination. Inoculation of ferrets 10 ⁷ TCID ₅₀ M2KO (delta. TM) virus [ G1 and G3 ]]、10 ⁷ TCID ₅₀ FM#6 virus [ G2 and G4 ]]Or OPTI-MEM ^TM [G5]. Changes in body temperature were monitored for 14 days after challenge vaccination (group a) and after receiving booster vaccine (group B).

The graph of fig. 25 shows the change in body temperature of ferrets after challenge. With 10 ⁷ TCID ₅₀ Influenza A virus of (B) A/Brisban/10/2007 (H3N 2) attacks ferrets. Body temperature was monitored for 14 days post inoculation.

The graph of fig. 26 shows the change in weight of ferrets after virus inoculation. Inoculation of donor ferrets 10 on day 0 ⁷ TCID ₅₀ M2KO (delta. TM) virus (group A) or 10 ⁷ TCID ₅₀ (B) A/Brisban/10/2007 (H3N 2) virus (group B). 24 hours after inoculation (day 1), the donor was placed in a cage with Direct Contact (DC) adjacent to the cage containing Aerosol Contact (AC). Changes in body weight were monitored for 14 days after donor inoculation.

The graph of fig. 27 shows the change in body temperature of ferrets after virus inoculation. Inoculation of donor ferrets 10 on day 0 ⁷ TCID ₅₀ M2KO (delta. TM) virus (group A) or 10 ⁷ TCID ₅₀ (B) A/Brisban/10/2007 (H3N 2) virus (group B). 24 hours after inoculation (day 1), the donor was placed in a cage with Direct Contact (DC) adjacent to the cage containing Aerosol Contact (AC). Changes in body temperature were monitored for 14 days after donor inoculation.

The graph of fig. 28 shows that the M2KO (Δtm) vaccine would elicit both humoral and mucosal responses. Group a shows serum IgG and IgA titers after administration of PR8, M2KO (Δtm), inactivated PR8 (IN, IM) or PBS. Group B shows lung wash IgG and IgA titers following administration of PR8, M2KO (Δtm), inactivated PR8 (IN, IM) or PBS.

The graph of fig. 29 shows that the M2KO (Δtm) vaccine protects mice from lethal subtype and heterosubtype virus challenge. Group a shows the change in body weight of mice following homologous PR8 (H1N 1) challenge. Group B shows survival of mice following heterologous aici (H3N 2) challenge.

The graph of fig. 30 shows that the M2KO (Δtm) vaccine controls the replication of the challenge virus in the respiratory tract. Group a shows the virus titer after PR8 (H1N 1) challenge. Group B shows the virus titer after aici (H3N 2) challenge.

Figure 31 is a graph showing the kinetics of antibody responses in serum against M2KO (delta TM) vaccine.

FIG. 32 is a graph showing mucosal antibody responses in serum and respiratory tract against M2KO (ΔTM) vaccine.

FIG. 33 is a graph showing the kinetics of anti-HA IgG in mice in response to M2KO (ΔTM) vaccine.

FIGS. 34A-34C show that M2KO (ΔTM) vaccine induces and

an immune response similar to IVR-147. Group A shows administration->

Serum viral titers in animals H3, M2KO (. DELTA.TM.) H3, IVR-147 and PBS. Group B shows administration->

Lung wash virus titers in animals H3, M2KO (. DELTA.TM.) H3, IVR-147 and PBS. Group C shows administration->

Rhinovirus titers in animals of H3, M2KO (. DELTA.TM.) H3, IVR-147 and PBS.

The graphs of FIGS. 35A-35B demonstrate that the M2KO (ΔTM) vaccine protects against Aichi challenge. Group A shows administration of

Animals with H3, M2KO (. DELTA.TM.) H3, IVR-147 and PBS lost weight after Aichi challenge. Group B shows administration->

Percent survival of H3, M2KO (ΔTM) H3, IVR-147 and PBS animals following Aichi challenge.

The graph of fig. 36 shows that the H5N 1M 2KO (Δtm) vaccine causes IgG antibody titers against HA.

FIG. 37 is a graph showing administration of M2KO (. DELTA.TM.) CA07, WT CA07 and

body weight after CA07 vaccine.

The graph of FIG. 38 shows that the M2KO (ΔTM) virus does not replicate in the respiratory tract of mice.

The graph of fig. 39 shows that the M2KO (Δtm) vaccine exhibits rapid antibody kinetics.

FIG. 40 is a graph showing that M2KO (ΔTM) vaccine will protect against H3N2 virus, A/Aichi/2/1968 heterologous challenge.

The graph of fig. 41 shows that the M2KO (Δtm) vaccine elicits a cellular response that is recovered after challenge.

FIG. 42 is a graph showing that M2KO (. DELTA.TM.) virus produces mRNA levels similar to those of M2 wild-type virus.

FIG. 43 shows restriction digestion of pCMV-PR8-M2 expression plasmids by agarose gel. Lanes 1 and 5;1Kb DNA ladder (Promega, madison, wis., USA), lanes 2-4; pCMLV-PR8-M2 digested with Eco R1: 0.375. Mu.g (lane 2), 0.75. Mu.g (lane 3) and 1.5. Mu.g (lane 4).

FIGS. 44A to 44D are diagrams showing sequence alignment of pCMV-PR8-M2 and the open reading frame of the influenza M2 gene. FIGS. 44A to 44D show SEQ ID NO.29 to SEQ ID NO.33, respectively, in the order of appearance.

FIG. 45 is a graph showing M2KO (ΔTM) and in the respiratory tract of ferrets

Viral replication.

FIG. 46 is a graph showing M2KO (. DELTA.TM.) and M2KO in nasal wash after intranasal challenge with A/Brisban/10/2007 (H3N 2) virus

Viral titer.

FIG. 47 is a graph showing M2KO (ΔTM) alone and

IgG titers in ferrets after challenge group vaccination.

FIG. 48 is a graph showing the use of M2KO (ΔTM) and

IgG titers in ferrets after challenge-boost group vaccination.

FIG. 49 is a graph showing the use of M2KO (ΔTM) or

Summary of ELISA IgG titers in ferret serum after vaccination to challenge.

Figure 50 is a graph showing viral titers in nasal washes from ferrets in transmission studies. M2KO (ΔTM) virus did not spread (no virus detected), whereas control Brisbane (Brisb)/10 virus did spread.

FIG. 51 is a graph showing IgG titers IN subjects vaccinated with A/California, A/Perth and B/Brisbane viruses Intranasal (IN), intramuscular (IM) and intradermal (ID FGN).

The graph of fig. 52 shows IgG titers in subjects administered either Intramuscularly (IM) or intradermally (ID FGN) with either a challenge dose or a challenge and booster dose of an a/peltier (H3N 2) vaccine.

The graph of figure 53 shows viral titers in guinea pigs vaccinated with FluLaval: a/california/7/2009 NYMC X-181, a/victoria/210/2009 NYMC X-187 (a/peltier/16/2009-like virus) and B/brisban/60/2008 by Intramuscular (IM) and Intradermal (ID) delivery at days 0, 30 and 60 post-vaccination.

FIG. 54 is a graph showing the percent survival of H5N1M2KO (ΔTM) vaccinated subjects 5 months after immunization with Vietnam/1203/2004 virus.

FIG. 55 is a graph showing the percent survival of H5N1M2KO (. DELTA.TM.) vaccinated subjects at 4 weeks post-immunization with Vietnam/1203/2004 virus.

Detailed Description

I. Definition of the definition

The following terms are used herein, and definitions of the terms are provided for guidance.

As used herein, the singular forms "a", "an" and "the" refer to the singular and the plural, unless otherwise indicated.

The use of the term "about" and the generic scope, whether or not defined by the term "about", is intended to mean that the numbers included are not limited to the exact numbers set forth herein, and are intended to represent ranges substantially within the exemplified scope without departing from the scope of the invention. As used herein, "about" will be understood by one of ordinary skill in the art and will vary to some extent depending on the context in which it is used. If the application of the term is not clear to one of ordinary skill in the art in the context of the application to which it applies, "about" refers to up to plus or minus 10% of the particular term.

As used herein, "subject" and "patient" are used interchangeably and refer to an animal, e.g., a member of any vertebrate species. The methods and compositions of the presently disclosed subject matter are particularly useful for warm-blooded vertebrates, including mammals and birds. An exemplary subject may include: mammals such as humans, as well as mammals and birds that are important for the purpose of being to be reseeded, economically important (animals raised in farms for human consumption) and/or socially important for humans (animals raised as pets or in zoos). In certain embodiments, the subject is a human. In certain embodiments, the subject is not a human.

The term "effective amount" or "therapeutically effective amount" or "pharmaceutically effective amount" as used herein means an amount sufficient to achieve the desired therapeutic and/or prophylactic effect, e.g., an amount that results in the prevention of a disease, disorder, and/or symptom thereof. In the context of therapeutic or prophylactic applications, the amount of composition administered to a subject will depend on the type and severity of the disease and the characteristics of the individual, such as general health, age, sex, weight and tolerance to the composition's drug. And will also depend on the extent, severity and type of disease or disorder. The skilled artisan will be able to determine the appropriate dosage based on these and other factors. In certain embodiments, multiple doses are administered. Additionally or alternatively, in certain embodiments, a plurality of therapeutic compositions or compounds (e.g., immunogenic compositions such as vaccines) are administered.

The terms "isolated" and/or "purified" as used herein mean the in vitro preparation, isolation and/or purification of a nucleic acid (e.g., vector or plasmid), polypeptide, virus or cell such that it is free of or substantially purified from undesired in vivo materials with which it is typically present. For example, in certain embodiments, the isolated viral preparation is obtained by in vitro culture and propagation and is substantially free of other infectious pathogens. As used herein, "substantially free" means that the standard detection method using the compound or reagent is below the detection level of a particular compound (such as an undesired nucleic acid, protein, cell, virus, infectious pathogen, etc.).

The term "recombinant virus" as used herein means a virus of the type: it has been subjected to in vitro manipulations (e.g., using recombinant nucleic acid techniques) to introduce changes into the viral genome and/or to introduce changes into viral proteins. For example, in certain embodiments, recombinant viruses may include wild-type, endogenous, nucleic acid sequences and mutants and/or exogenous nucleic acid sequences. Additionally or alternatively, in certain embodiments, the recombinant virus may include modified protein components, such as mutant or variant matrices, hemagglutinin, neuraminidase, nucleoprotein, nonstructural proteins, and/or polymerase proteins.

The term "recombinant cell" or "modified cell" as used herein refers to such cells: it has been subjected to in vitro manipulations (e.g., using recombinant nucleic acid techniques) to introduce nucleic acids into cells and/or to modify nucleic acids of cells. Examples of recombinant cells include: prokaryotic or eukaryotic cells carrying exogenous plasmids, expression vectors, and the like, and/or cells comprising modifications to their cellular nucleic acids (e.g., substitutions, mutations, insertions, deletions, etc. in the cell genome). An exemplary recombinant cell is one that has been subjected to in vitro manipulation to express an exogenous protein, such as a viral M2 protein.

The terms "mutant," "mutation," and "variant" are used interchangeably herein and refer to a nucleic acid or polypeptide sequence that differs from the wild-type sequence. In certain embodiments, the mutant or variant sequence is naturally occurring. In other embodiments, the mutant or variant sequence is recombinantly and/or chemically introduced. In certain embodiments, the nucleic acid mutation comprises: modifications (e.g., additions, deletions, substitutions) to the RNA and/or DNA sequences. In certain embodiments, dilution includes chemical modification (e.g., methylation), and may also include substitution or addition of natural and/or unnatural nucleotides. The nucleic acid mutation may be a silent mutation (e.g., one or more nucleic acid changes that encode the same amino acid as the wild-type sequence), or may result in a change in the encoded amino acid, produce a stop codon, or may introduce a splice defect or splice change. Mutations in the nucleic acid encoding the sequence may also result in conservative or non-conservative amino acid changes.

The term "vRNA" as used herein means an RNA that: it comprises a viral genome, including a segmented or non-segmented viral genome, as well as a plus-and minus-strand viral genome. vRNA may be entirely endogenous and "wild-type" and/or may include recombinant and/or mutant sequences.

The term "host cell" as used herein refers to a cell in which a pathogen, such as a virus, can replicate. In certain embodiments, the host cell is an in vitro cultured cell (e.g., CHO cell, vero cell, MDCK cell, etc.). Additionally or alternatively, in certain embodiments, the host cell is in vivo (e.g., a cell of an infected vertebrate such as a bird or mammal). In certain embodiments, the host cell may be modified, for example, to enhance viral production, such as by enhancing viral infection of the host cell, and/or by enhancing the growth rate of the virus. By way of example, but not limitation, exemplary host cell modifications include: recombinant expression of 2-6-linked sialic acid receptors on the cell surface of host cells, and/or recombinant expression of proteins in host cells that have been deleted or disabled by pathogens or viruses.

The term "infection" as used herein means a disease or pathogen, such as a virus, is carried. Infection may be intentional, such as by administration of a virus or pathogen (e.g., by vaccination), or unintentional, such as by natural transfer of the pathogen from one organism to another, or from a contaminated surface to an organism.

As used herein, the term "attenuated" used in conjunction with a virus means such a virus: it has reduced virulence or pathogenicity compared to the non-attenuated counterpart, but is still viable or living. In general, attenuation results in less harmful or virulence of an infectious pathogen (such as a virus) to an infected subject than an unabated virus. This is different from killed or fully inactivated viruses.

As used herein, the terms "type" and "strain" are used interchangeably in connection with viruses and are used to refer broadly to viruses having different characteristics. For example, influenza a virus is a different type of virus than influenza b virus. Similarly, influenza a H1N1 is a different type of virus than influenza a H2N1, H2N2, and H3N 2. Additionally or alternatively, in certain embodiments, different types of viruses (such as influenza a H2N1, H2N2, and H3N 2) may be referred to as "subtypes".

As used herein, "M2KO" or "M2KO (ΔTM)" means SEQ ID NO:1, a virus containing SEQ ID NO:1, or a vaccine comprising a virus containing SEQ ID NO:1, depending on the context in which it is used. For example, in describing the mutation of the M2 gene as demonstrated herein, "M2KO" or "M2KO (ΔTM)" means SEQ ID NO:1. In describing the viral components of the vaccine, "M2KO" or "M2KO (Δtm)" means such recombinant influenza viruses: it has the internal 6 genes of PR8 (nucleoprotein (NP), polymerase genes (PA, PB1, PB 2), non-structural (NS), matrix (M)), but it does not express functional M2 proteins. In describing a vaccine, "M2KO" or "M2KO (Δtm)" means a vaccine comprising M2KO (Δtm) recombinant virus.

As used herein, "M2KO (ΔTM) virus" includes such recombinant influenza viruses: it has the internal 6 genes of PR8 (nucleoprotein (NP), polymerase genes (PA, PB1, PB 2), non-structural (NS), matrix (M)), but it does not express functional M2 proteins, either alone or in combination with other viral components and/or genes encoding other viral components. In certain embodiments, the M2KO (Δtm) virus comprises genes of other influenza viruses. In certain embodiments, the virus comprises the HA and NA genes of influenza a/brisban/10/2007-like a/yerba mate/716/2007 (H3N 2). In certain embodiments, the M2KO (ΔTM) virus comprises the HA and NA genes of the A/Vietnam/1203/2004 (H5N 1) virus. In certain embodiments, the M2KO (Δtm) virus comprises HA and NA genes of a/california/07/2009 (CA 07) (H1N 1 pdm) virus.

Influenza A virus

A. Summary of the invention

Influenza is the leading cause of death in adults in the united states. The pathogenic bacteria of influenza are viruses of the orthomyxoviridae family, including influenza a, b and c, with influenza a being the most common and toxic in humans.

Influenza a viruses are enveloped negative-strand RNA viruses. The genome of influenza a virus is contained on 8 separate (unpaired) RNA strands, the complement of which encodes 11 proteins (HA, NA, NP, M1, M2, NS1, NEP, PA, PB1, PB1-F2, PB 2). The total genome size is about 14,000 bases. The piecewise nature of the genome allows for the exchange of entire genes between different viral strains during cell-harboring. The 8 RNA segments are as follows. 1) HA encodes hemagglutinin (about 500 hemagglutinin molecules are required to make up 1 virion); 2) NA encodes neuraminidase (about 100 neuraminidase molecules are required to make up 1 virion); 3) NP encodes a nucleoprotein; 4) M encodes 2 proteins (M1 and M2) using different reading frames from the same RNA segment (about 3000M 1 molecules are required to make up 1 virion); 5) NS encodes 2 proteins (NS 1 and NEP) using different reading frames from the same RNA segment; 6) PA encodes RNA polymerase; 7) PB1 encodes RNA polymerase and PB1-F2 protein (inducing apoptosis) using different reading frames from the same RNA segment; 8) PB2 encodes RNA polymerase.

There are several influenza a subtypes, which are named according to the number H (for hemagglutinin type) and the number N (for neuraminidase type). Currently, there are 16 different known H antigens (H1 to H16) and 9 different known N antigens (N1 to N9). Each viral subtype has been mutated to multiple strains with different pathogenic properties; some are pathogenic to one species, but others are not, and some are pathogenic to multiple species. Exemplary influenza a virus subtypes that have been demonstrated in humans include, but are not limited to: H1N1, which causes "spanish influenza" and 2009 swine influenza outbreaks; H2N2, which causes "asian influenza" in the late 50 s of the twentieth century; H3N2, which causes hong kong influenza in the late 60 s of the twentieth century; H5N1, by its transmission in mid 2000, poses a global influenza pandemic threat; H7N7; H1N2, which currently circulates in humans and pigs; and H9N2, H7N3, H5N2, H10N7.

Some influenza a variants were identified and named as follows: from their most similar known isolates, and thus assuming a shared lineage (e.g., fowls influenza virus-like); according to their typical host (e.g., human influenza virus); depending on their subtype (e.g., H3N 2); and according to their pathogenicity (e.g., LP, low pathogenicity). Thus, influenza caused by viruses similar to isolate A/Fujian/411/2002 (H3N 2) can be referred to as Fujian influenza, human influenza, and H3N2 influenza.

In addition, influenza variants are sometimes named according to the species (host) in which the strain is prevalent or adapted. The main variants named using this convention are: avian influenza, human influenza, swine influenza, equine influenza and canine influenza. Variants have also been named according to their pathogenicity in poultry, particularly chickens, e.g., low Pathogenic Avian Influenza (LPAI) and High Pathogenic Avian Influenza (HPAI).

B. Lifecycle and structure

The life cycle of influenza viruses generally includes: binds to cell surface receptors, enters the cell and uncoats the viral nucleic acid, and the viral genes replicate in the cell. After synthesis of new copies of viral proteins and genes, these components assemble into progeny viral particles, which then leave the cell. Different viral proteins function in each of these steps.

Influenza a particles are composed of a lipid envelope encapsulating a viral core. The inner side of the envelope is lined with matrix protein (M1), while the outer surface is characterized by class 2 glycoprotein spikes: hemagglutinin (HA) and Neuraminidase (NA). M2 (a transmembrane ion channel protein) is also part of the lipid envelope. See, for example, fig. 1.

The HA protein, a trimeric type I membrane protein, is responsible for binding to sialyloligosaccharides (oligosaccharides containing terminal sialic acid linked to galactose) on the surface glycoproteins or glycolipids of host cells. The protein is also responsible for fusion between the virus and host cell membrane after internalization of the virion by endocytosis.

Neuraminidase (NA), a tetrameric type II membrane protein, is a sialidase that cleaves terminal sialic acid residues from glycoconjugates of host cells with HA and NA, and is thus recognized as a receptor disrupting enzyme. This sialidase activity is necessary for efficient release of progeny virions from the host cell surface and prevention of progeny aggregation (due to the binding activity of HA of the virus to other glycoproteins). Thus, the receptor binding activity of HA and the receptor disrupting activity of NA may act as countermeasures, allowing for efficient replication of influenza.

The genomic segments are packaged into the core of the viral particle. RNP (RNA+nucleoprotein, NP) is in helical form, 3 viral polymerase polypeptides are associated with each segment.

The influenza virus life cycle begins with the binding of HA to sialic acid containing receptors on the surface of host cells, followed by receptor-mediated endocytosis. FIG. 1. The low pH of late endosomes triggers conformational transition of HA, thereby exposing the N-terminus of the HA2 subunit (the so-called fusion peptide). The fusion peptide initiates fusion of the virus and endosomal membrane, and the matrix protein (M1) and RNP complex are released into the cytoplasm. RNP consists of a Nucleoprotein (NP) encapsidating vRNA and a viral polymerase complex formed by PA, PB1 and PB2 proteins. RNP is transported into the nucleus where transcription and replication takes place. The RNA polymerase complex catalyzes 3 different reactions: (1) synthesis of mRNA having a 5 'cap and 3' polyadenylation structure, (2) synthesis of full-length complementary RNA (cRNA), and (3) synthesis of genomic vRNA using cDNA as a template. Subsequently, the newly synthesized vRNA, NP and polymerase proteins are assembled into RNPs, exported from the nucleus, transported to the plasma membrane where budding of the progeny viral particles occurs. Neuraminidase (NA) proteins function at the late stages of infection as follows: sialic acid is removed from the sialyloligosaccharide, thereby releasing the newly assembled viral particles from the cell surface and preventing the viral particles from self-aggregation. Although viral assembly involves protein-protein interactions and protein-vRNA interactions, the nature of these interactions is largely unknown.

Action of M2 protein

As described above, 3 proteins cross viral membranes: hemagglutinin (HA), neuraminidase (NA) and M2. The extracellular domains (ectodomains) of HA and NA are highly variable, while the ectodomain of M2 is essentially unchanged in influenza a virus. Without wishing to be bound by theory, in influenza a virus, the M2 protein (which has ion channel activity) is thought to play a role between host cell penetration and uncoating of viral RNA at an early stage of the viral life cycle. Once the virion undergoes endocytosis, it is believed that the virion-associated M2 ion channel (a homotetrameric helix bundle) allows protons to flow from the endosome into the interior of the virion to disrupt the acid labile M1 protein-ribonucleoprotein complex (RNP) interactions, thereby facilitating release of the RNP into the cytoplasm. In addition, in certain influenza strains (e.g., a/fowl plague/Rostock/34) where HA is cleaved intracellularly, the M2 ion channel is thought to raise the pH across the golgi network, thereby avoiding conformational changes in the HA in this compartment caused by low pH conditions. It was also demonstrated that the M2 transmembrane domain itself can act as an ion channel. The M2 protein ion channel activity is thought to be essential in the life cycle of influenza virus, as amantadine hydrochloride blocking the M2 ion channel activity has been shown to inhibit viral replication. However, the necessary conditions for this activity in influenza a virus replication have not been directly demonstrated. The structure of the M2 protein is shown in figure 2. The nucleic acid sequence of the M2 protein and the M1 sequence are shown in fig. 3.

Although influenza b and c viruses are similar in structure and function to influenza a viruses, there are some differences. For example, influenza b virus does not have an ion channel active M2 protein. In contrast, NB protein (product of NA gene) may have ion channel activity and thus have similar functions to the influenza a M2 protein. Similarly, influenza c viruses also do not have ion channel active M2 proteins. However, the CM1 protein of influenza c virus may have this activity.

III.M2 Virus mutants

In one aspect, influenza a viruses carrying mutant M2vRNA sequences are disclosed. Typically, such mutants do not possess M2 ion channel activity, exhibit reduced in vivo growth performance, are unable to produce infectious offspring, and are non-pathogenic or exhibit reduced pathogenesis in infected subjects. Mutant viruses are immunogenic and, when used as vaccines, provide protection against infection by the corresponding wild-type and/or other pathogenic viruses. In addition, regardless of the host cell used, the M2 mutants disclosed herein are stable and do not mutate to express a functional M2 polypeptide. Additionally or alternatively, in certain embodiments, the M1 proteins of these mutants are produced without detectably altering their function. In certain embodiments, viruses carrying the mutant M2 nucleic acid sequences are not replicable in host cells, whereas the corresponding wild-type viruses may be propagated in the host cells. By way of example, but not by way of limitation, in certain embodiments the wild-type virus may grow, multiply and replicate in cultured MDCK cells, CHO cells and/or Vero cells, while the corresponding virus carrying the mutant M2 sequence may not grow, multiply or replicate in the same type of cells.

As noted above, in certain embodiments, the M2 mutant virus is stable and does not mutate or revert to wild-type or non-wild-type sequences encoding functional M2 proteins in the host cell. For example, in certain embodiments, the M2 mutant virus may be stable in the host cell for 2, 3, 5, 10, 12, 15, 20, 25, or more than 25 generations. In certain embodiments, the host cell is an unmodified host cell. In other embodiments, the host cell is a modified host cell, such as an MDCK cell expressing an M2 protein.

In certain embodiments, the M2 mutant comprises one or more nucleic acid substitutions and/or deletions. In certain embodiments, the mutation is localized in a nucleic acid encoding one or more of the following: an extracellular domain of an M2 protein, a transmembrane domain of an M2 protein, and/or a cytoplasmic tail of an M2 protein. Additionally or alternatively, in certain embodiments, one or more nucleic acid mutations will result in splice variants, one or more stop codons, and/or one or more amino acid deletions of the M2 peptide. In certain embodiments, viruses carrying mutant M2 nucleic acids produce nonfunctional M2 polypeptides. In certain embodiments, the virus carrying the mutant M2 nucleic acid does not produce an M2 polypeptide. In certain embodiments, the virus carrying the mutant M2 nucleic acid produces a truncated M2 polypeptide. In certain embodiments, the truncated M2 polypeptide has the amino acid sequence MSLLTEVETPIRNEWGCRCNGSSD (SEQ ID NO: 4).

3 exemplary, non-limiting, M2 virus mutants (M2-1, M2-2, and M2-3) are provided in tables 1-3 below. In the table, lowercase letters correspond to M2 sequences; capital letters correspond to M1 sequences; the mutant sequence (e.g., stop codon, splice defect) is underlined in bold. The underlined (lower case) letters in the M2-2 mutants indicate the regions deleted in the M2-1 and M2-3 mutants.

The sequence of the M2 polypeptide produced from this mutant is as follows:

MSLLTEVETPIRNEWGCRCNGSSD.(SEQ ID NO:4)。

no M2 polypeptide sequence was produced from this mutant.

No M2 polypeptide sequence was produced from this mutant.

Additionally or alternatively, in certain embodiments, the M2 mutation is introduced into the cytoplasmic tail. Fig. 2. The cytoplasmic tail of the M2 protein is the medium for infectious virus production. In certain embodiments, truncation of the M2 cytoplasmic tail results in reduced infectious viral titer, reduced amount of packaged viral RNA, reduced budding events, and reduced budding efficiency. It has been demonstrated that 5' sequences are more important than 3' sequences for genome packaging, and longer 5' sequences are preferred for genome packaging. In addition, studies have demonstrated that nucleotide length is important, but the actual sequence is less important (random sequences are sufficient to produce virus). The development of stable M2 cytoplasmic tail mutants has been challenging and the literature includes numerous examples of mutant recovery.

For example, pekosz et al JVI,2005;79 (6) 3595-3605 substitution of 2 codons with stop codons at amino acid position 70, but the virus is soon restored. Another exemplary M2 cytoplasmic tail mutation is known as M2del11. In the M2del11 mutant, 11 amino acid residues are deleted from the carboxy terminus of the cytoplasmic tail. This truncation was due to the introduction of 2stop codons and did not result in a full length M2 polypeptide. Although this mutant was stable when passaged in M2-expressing MDCK cells (M2 CK), it recovered to full length M2 during passaging in normal MDCK cells (J virol.2008 (5): 2486-92). Without wishing to be bound by theory, recovery may occur at the selection pressure of MDCK cells.

Another M2 cytoplasmic tail mutant, M2Stop90ala78-81, did not decrease viral titer, but ala70-77 decreased (JVI 2006;80 (16) p 8178-8189). Alanine scanning experiments further indicated that amino acids at positions 74-79 of the M2 tail play a role in virion morphogenesis and affect infectivity of the virus (J Virol.2006 80 (11): 5233-40).

Thus, provided herein are novel cytoplasmic mutants having different characteristics than those described above. For example, in certain embodiments, the cytoplasmic mutant is stable in MDCK cells (does not revert to expression of the full length M2 polypeptide). In certain embodiments, the cytoplasmic mutant is stable in the host cell for 2, 3, 5, 10, 15, 20, 25, or more than 25 generations.

Wild-type M2 polypeptides are shown in table 4 below. For each sequence, bold text indicates the transmembrane domain. The extracellular domain is in front (left), followed by the transmembrane domain (center) and cytoplasmic tail sequence (right).

M2-4 (M2 del FG#1) was prepared, but could not be passaged in normal MDCK cells, but could be passaged in modified host cells (e.g., cells expressing wild-type M2 polypeptide). M2-5 (M2 del FG#2) and M2-6 (FG#3) were prepared and passaged in normal MDCK cells. The nucleotide sequence of the M gene of these viruses is stable in MDCK cells at least up to passage 10. These mutants can be propagated and also passaged in other cells (e.g., cells that support influenza replication). It was also found that these mutants were not attenuated and pathogenic.

As described in the examples below, the M2 mutant viruses described herein do not replicate or propagate in the respiratory tract to other organs in the ferret model and do not propagate in the ferret model. Vaccines comprising M2 mutants elicit robust immune responses in mammals and protect mammals from influenza virus challenge. M2KO virus elicits humoral and mucosal immune responses in mice and protects mice from lethal isotype and heterosubtype challenge. Vaccines comprising M2 mutant viruses as described herein provide effective protection against influenza challenge and have the advantage of attenuation in mammalian hosts. These findings confirm that the M2 mutant viruses described herein are useful in anti-influenza vaccines.

Cell-based virus production system

A. Production of "first generation" mutant viruses

Mutant viruses, such as those carrying mutant M2 nucleic acids, can be prepared by plasmid-based reverse genetics as described by Neumann et al Generation of influenza A viruses entirely from clone cDNAs, proc.Natl.Acad.Sci.USA 96:9345-9350 (1999), which is incorporated herein by reference in its entirety. Briefly, eukaryotic host cells are transfected with one or more plasmids encoding 8 viral RNAs. Each viral RNA sequence is flanked by an RNA polymerase I promoter and an RNA polymerase I terminator. Notably, the viral RNA encoding the M2 protein includes a mutant M2 nucleic acid sequence. The host cells are further transfected with one or more expression plasmids encoding viral proteins (e.g., polymerases, nucleoproteins, and structural proteins, including wild-type M2 proteins). Transfection of host cells with viral RNA plasmids results in the synthesis of all 8 influenza RNAs, one of which carries the mutant M2 sequence. The co-transfected viral polymerase and nucleoprotein assemble the viral RNA into a functional vRNP that replicates and transcribes, ultimately forming an infectious influenza virus with mutant M2 nucleic acid sequences, which still has a functional M2 polypeptide incorporated into the viral lipid envelope.

Alternative methods of producing "first generation" mutant viruses include Ribonucleoprotein (RNP) transfection systems that allow substitution of influenza virus genes with recombinant RNA molecules prepared in vitro, such as described by enamine and Palese, high-efficiency formation of influenza virus transfectants, j.virol.65 (5): 2711-2713 (which is incorporated herein by reference).

Viral RNA is synthesized in vitro and RNA transcripts are coated with viral Nucleoprotein (NP) and polymerase proteins that act as biologically active RNPs in transfected cells, as demonstrated by Luytjes et al, amplification, expression, and packaging of a foreign gene by influenza virus, cell59:1107-1113, which is incorporated herein by reference.

The RNP transfection method can be divided into 4 steps: 1) Preparation of RNA: transcribing plasmid DNA encoding the influenza virus segment into negative sense RNA in an in vitro transcription reaction; 2) Encapsidation of RNA: the transcribed RNA is then mixed with gradient purified NP and polymerase proteins isolated from disrupted influenza virus to form a biologically active RNP complex; 3) Transfection and rescue of encapsidated RNA: transfecting an artificial ribonucleocapsid into cells previously infected with a helper influenza virus containing different genes derived from the RNA to be rescued; the helper virus will amplify the transfected RNA; 4) Selection of transfected genes: because helper virus and transfectants containing the rescued genes are in the culture supernatant, a proper selection system using antibodies is necessary to isolate the virus carrying the transfected genes.

The selection system allows the preparation of novel transfectant influenza viruses with specific biological and molecular characteristics. Antibody selection against the target surface protein can then be used for positive or negative selection.

For example, a transfectant or mutant virus containing an M2 gene that does not express an M2protein may be cultured in a suitable mammalian cell line that has been modified to stably express the wild type functional M2 protein. In order to prevent or inhibit replication of helper viruses expressing the wild-type M2 gene, and thus the M2e protein, at the membrane surface, antibodies against M2e may be used. Such antibodies are commercially available and will inhibit replication of helper virus and allow transfectants/mutant viruses containing mutant M2 to grow and concentrate in the supernatant. Inhibition of influenza virus replication by M2e antibodies has been previously described in: influenza A virus M2protein: monoclonal antibody restriction of virus growth and detection of M2in virons, J Virol 62:2762-2772 (1988) and Trenor et al, passively transferred monoclonal antibody to the M2protein inhibits influenza A virus replication in mice, J.virol.64:1375-1377 (1990).

Additionally or alternatively, the same antibodies may be used to 'capture' helper virus and allow for enrichment of the transfectants. For example, the bottom of a tissue culture dish may be coated with antibodies, or may be used in a column matrix to allow for enrichment of transfectants in supernatant or eluate.

Transfectant viruses can be cultured in M2-expressing cells in multi-well plates by limiting dilution, followed by identification and cloning, e.g., by preparing replica plates. For example, half an aliquot of a given well of a multiwell plate containing cultured virus can be used to infect MDCK cells, and the other half can be used to infect MDCK cells expressing M2 protein. Both transfectant and helper viruses grew in MDCK cells expressing M2 protein. However, helper virus alone will grow in standard MDCK cells, allowing identification of wells containing transfectants in multiwell plates. The transfectant virus may be further plaque purified in cells expressing the M2 protein.

B. Propagation of viral mutants

In certain embodiments, the viral mutants described herein are maintained and passaged in a host cell. By way of example, but not by way of limitation, exemplary host cells suitable for use in culturing influenza virus mutants, such as influenza A virus mutants, include any number of eukaryotic cells including, but not limited to, madin-Darby canine kidney cells (MDCK cells), simian cells such as African green monkey cells (e.g., vero cells), CV-1 cells and rhesus monkey kidney cells (e.g., LLcomk.2 cells), bovine cells (e.g., MDBK cells), porcine cells, ferret cells (e.g., mink lung cells) BK-1 cells, rodent cells (e.g., chinese hamster ovary cells), human cells such as embryonic human retinal cells (e.g.,

) 293T human embryoFetal kidney cells and avian cells (including embryonic fibroblasts).

Additionally or alternatively, in certain embodiments, eukaryotic host cells are modified to increase viral production, for example, by increasing viral infection of the host cells and/or by increasing the viral growth rate. For example, in certain embodiments, host cells are modified to express 2, 6-linked sialic acid on the cell surface or to increase its expression, allowing for more efficient and effective infection of these cells by mutant or wild-type influenza a viruses. See, for example, U.S. patent publication No. 2010-0021499 and U.S. patent No. 7,176,021, which are incorporated herein by reference in their entireties. Thus, in certain exemplary embodiments, chinese hamster ovary cells (CHO cells) and/or Vero cells modified to express at least 1 copy of the 2, 6-sialyltransferase gene (ST 6GAL 1) are used. By way of example, but not by way of limitation, the homo sapiens ST6 beta-galatosamide alpha-2, 6-sialyltransferase gene sequence represented by accession number BC040009.1 is one example of a ST6Gal gene that can be incorporated into and expressed by CHO cells. One or more copies of a polynucleotide encoding a functional ST6Gal I gene product may be engineered into a cell. That is, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more than 12 copies of cells that have been stably transformed to express the ST6Gal I gene may be used. A single expression cassette may include one or more copies of the ST6Gal I gene to be expressed operably linked to regulatory elements such as promoters, enhancers and terminators and polyadenylation signal sequences to facilitate expression of the ST6Gal I gene or its copies. Alternatively, a single expression cassette may be engineered to express 1 copy of the ST6Gal I gene and multiple expression cassettes integrated into the host cell genome. Thus, in certain embodiments, at least one ST6Gal I gene is integrated into the genome of a host cell such that the cell expresses the ST6Gal I gene and its enzyme protein product. Depending on the copy number, a single host cell can express many functional ST6Gal I gene proteins.

Suitable vectors for cloning, transfection and production of stable modified cell lines are well known in the art. One non-limiting example includes the pcDNA3.1 vector (Invitrogen).

Additionally or alternatively, in certain embodiments, eukaryotic host cells are modified to produce a mutant viral gene in wild-type form, thereby providing the virus with the gene in reverse. For example, a virus strain carrying a mutant M2 protein may exhibit an increased growth rate (e.g., greater virus production) when passaged in a host cell that produces the wild-type M2 protein. In certain embodiments, a viral strain carrying a mutant M2 protein may not grow or replicate in cells that do not express the wild-type M2 gene. In addition, such host cells may slow or prevent the virus from recovering to a functional M2 sequence because, for example, there is no selection pressure for recovery in such hosts.

Methods for producing expression vectors and modified host cells are well known in the art. For example, an M2 expression vector may be prepared by placing the following M2 nucleic acid sequence (M2 ORF sequence; this is the "wild-type" M2 start codon to stop codon (Table 5)) in a eukaryotic expression vector.

The method may then be performed by methods known in the art, for example, using commercially available reagents and kits, such as

LT1 (Mirus Bio, madison, wis.) transfected host cells (e.g., MDCK cells). By way of example, but not by way of limitation, cells may be selected and tested for M2 expression as follows: screening is performed by co-transfection with a detectable marker or selectable marker (e.g., hygromycin resistance), and/or by indirect immunostaining, e.g., using an M2 antibody. M2 expression can be determined by indirect immunostaining, flow cytometry, or ELISA.

By way of example, but not by way of limitation293T human embryonic kidney cells and Madin-Darby canine kidney (MDCK) cells were maintained in Dulbecco's modified eagle's medium supplemented with 10% fetal bovine serum and in Minimal Essential Medium (MEM) containing 5% neonatal calf serum, respectively. At 37℃at 5% CO ₂ All cells are maintained. Hygromycin-resistant MDCK cells stably expressing the M2 protein from A/Puerto Rico/8/34 (H1N 1) were established by co-transfection with plasmid pRHyg containing the hygromycin resistance gene and plasmid pCAGGS/M2 expressing the full length M2 protein in a 1:1 ratio. Stable MDCK cell clones (M2 CK) expressing M2 were selected in medium containing 0.15mg/mL hygromycin (Roche, mannheim, germany) by screening with an anti-M2 (14C 2) monoclonal antibody by indirect immunostaining (Iwatsuki et al, JVI,2006, volume 80, phase 1, pages 5233-5240). M2CK cells were cultured in MEM supplemented with 10% fetal bovine serum and 0.15mg/mL hygromycin. In M2CK cells, the expression levels and localization of M2 were similar to those in virus-infected cells (data not shown). Vero cells expressing M2 can be prepared in a similar manner.

In certain embodiments, the cells and viral mutants are cultured and propagated by methods well known in the art. By way of example, but not by way of limitation, in certain embodiments, the host cells are cultured in the presence of MEM supplemented with 10% fetal bovine serum. Cells expressing M2 were infected at a MOI of 0.001 by washing with PBS followed by adsorption of the virus at 37 ℃. In certain embodiments, a viral growth medium containing trypsin/TPCK is added and the cells are incubated for 2-3 days until cytopathic effects are observed.

Together with these lines, disposable bioreactor systems have been developed for mammalian cells (with or without viruses), with benefits including faster equipment installation and reduced risk of cross-contamination. For example, the cells described herein may be cultured in disposable bags, such as bags from Stedim, bioize, SAFC Biosciences, hybridBagTM from Cellexus Biosytems, or disposable bioreactors from HyClone or Celltainer from Lonza. The bioreactor may be in the form of 1L, 10L, 50L, 250L, 1000L size. In certain embodiments, the maintenance cells are suspended in an optimized serum-free medium that is free of animal products. The system may be: fed-batch systems, wherein the culture can be amplified in a single bag of, for example, 1L to 10L; or a perfusion system that allows for a constant supply of nutrients while avoiding accumulation of potentially toxic byproducts in the culture medium.

For long term storage, the mutant virus may be stored as a frozen stock.

V. vaccine and method of administration

A. Immunogenic compositions/vaccines

From the cell-based virus production systems disclosed herein, a variety of different types of vaccines can be prepared. The present disclosure includes, but is not limited to: preparation and production of live attenuated virus vaccines, inactivated virus vaccines, whole virus vaccines, split virus vaccines, virosomal virus vaccines, viral surface antigen vaccines, and combinations thereof. Thus, there are a number of vaccines capable of generating protective immune responses specific for different influenza viruses, wherein suitable formulations of any of these vaccine types are capable of generating immune responses, e.g. systemic immune responses. Live attenuated viral vaccines have the advantage of also being able to stimulate local mucosal immunity in the respiratory tract.

In certain embodiments, the vaccine antigens used in the compositions described herein are "direct" antigens, i.e., they are not administered as DNA, but rather the antigen itself. Such vaccines may include whole viruses or only a portion of viruses, such as, but not limited to, viral polysaccharides, whether alone or conjugated to carrier elements such as carrier proteins, live attenuated whole microorganisms, inactivated microorganisms, recombinant peptides and proteins, glycoproteins, glycolipids, lipopeptides, synthetic peptides or lysed microorganisms, in the case of vaccines, referred to as "split" vaccines.

In certain embodiments, whole virus particle vaccines are provided. The whole virion vaccine can be concentrated by ultrafiltration and then purified by zonal centrifugation or by chromatography. Typically, the viral particles are inactivated, for example, using formalin or beta-propiolactone, either before or after purification.

In certain embodiments, subunit vaccines comprising purified glycoproteins are provided. Such a vaccine may be prepared as follows: using a virus suspension fragmented by detergent treatment, the surface antigen is purified by, for example, ultracentrifugation. Thus, subunit vaccines contain mainly HA protein, but also NA. The detergents used may be: cationic detergents, such as cetyltrimethylammonium bromide; anionic detergents such as ammonium deoxycholate; or a nonionic detergent, such as the detergent sold under the trade name TRITON X100. The hemagglutinin may also be isolated after treatment of the viral particles with a protease such as bromelain, and then purified by standard methods.

In certain embodiments, there is provided a split vaccine comprising a viral particle that has been treated with a lipid-solubilizing agent. Split vaccines can be prepared as follows: the aqueous suspension of purified virus, whether inactivated or not, obtained as above is treated with a lipid solvent (e.g. diethyl ether or chloroform) and a detergent under stirring. Solubilization of viral envelope lipids results in fragmentation of the viral particles. Recovering an aqueous phase containing a split vaccine consisting essentially of hemagglutinin and neuraminidase (the original lipid environment of which is removed) and the core or its degradation products. Then, if the inactivation has not been previously performed, the remaining infectious particles are inactivated.

In certain embodiments, an inactivated influenza virus vaccine is provided. In certain embodiments, the inactivated vaccine is prepared by inactivating the virus by known methods such as, but not limited to, formalin or beta-propiolactone treatment. Types of inactivated vaccines useful in the present invention may include Whole Virus (WV) vaccines or subviral particle (SV) (split) vaccines. WV vaccines contain intact inactivated virus, while SV vaccines contain purified virus that is destroyed with detergent (which solubilizes lipid-containing viral envelope) followed by chemical inactivation of residual virus.

Additionally or alternatively, in certain embodiments, live attenuated influenza virus vaccines are provided. Such vaccines can be used to prevent or treat influenza virus infection according to known method steps.

In certain embodiments, attenuation is achieved in a single step by transferring an attenuation gene from an attenuated donor virus to an isolate or reassortant virus according to known methods (see, e.g., murphy, effect. Dis. Clin. Practice. 2,174 (1993)). In certain embodiments, the mutant virus is produced by attenuating the virus by mutation of one or more viral nucleic acid sequences. For example, in certain embodiments, the mutant viral nucleic acid sequence encodes a defective protein product. In certain embodiments, the protein product has reduced or no function. In other embodiments, the protein product is not produced from the mutant viral nucleic acid.

Thus, the virus can be attenuated or inactivated, formulated and administered as an immunogenic composition (e.g., as a vaccine) according to known methods to induce an immune response in an animal (e.g., avian and/or mammalian). Methods for determining whether such attenuated or inactivated vaccines maintain antigenicity similar to clinical isolates or high-growth strains derived therefrom are well known in the art. Such known methods include: eliminating viruses expressing an epitope of the donor virus using antisera or antibodies; chemical selection (e.g., amantadine or rimantadine); HA and NA activity and inhibition; and DNA screening (such as probe hybridization or PCR) to confirm the absence of a donor gene (e.g., HA or NA gene) or other mutant sequence (e.g., M2) encoding the antigenic determinant in the attenuated virus. See, e.g., robertson et al, giornale di Igiene e Medicina Preventiva,29,4 (1988); kilbourne, bull.m2world Health org.,41,643 (1969); and Robertson et al, biologicals,20,213 (1992).

In certain embodiments, the vaccine comprises an attenuated influenza virus that does not express a functional M2 protein. In certain embodiments, the mutant virus replicates well in cells expressing the M2 protein, but expresses the viral protein in the corresponding wild-type cells without producing infectious progeny virions.

Pharmaceutical compositions of the invention suitable for intradermal, vaccination or parenteral or oral administration comprise attenuated or inactivated influenza virus and may optionally further comprise sterile aqueous or non-aqueous solutions, suspensions and emulsions. The composition may further comprise adjuvants or excipients known in the art. See, e.g., berkow et al, the Merck Manual, 15 th edition, merck and co., rahway, n.j. (1987); goodman et al, editions Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8 th edition, pergamon Press, inc., elmsford, n.y. (1990); avery's Drug Treatment Principles and Practice of Clinical Pharmacology and Therapeutics, 3 rd edition, ADIS Press, ltd., williams and Wilkins, baltimore, md. (1987); and Katzung, editions, basic and Clinical Pharmacology, 5 th edition, appleton and Lange, norwalk, conn. (1992).

In certain embodiments, formulations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions and/or emulsions, which may contain adjuvants or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (e.g. olive oil) and injectable organic esters (e.g. ethyl oleate). The carrier or occlusive dressing may be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration may generally include liquid dosage forms comprising a liposome solution. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups and elixirs containing inert diluents commonly used in the art, such as purified water. Such compositions may contain, in addition to inert diluents, adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents.

When the composition of the present invention is for administration to an individual, it may further comprise salts, buffers, adjuvants or other substances as desired for enhancing the efficacy of the composition. For vaccines, adjuvants, i.e. substances that enhance specific immune responses, may be used. Typically, the adjuvant and the composition are mixed together prior to presentation to the immune system, or presented separately, but at the same site of the organism to be immunized.

In certain embodiments, the immunogenic compositions (e.g., vaccines) disclosed herein comprise a plurality of different types of viruses or viral antigens, at least one of which comprises a mutant M2 gene (e.g., a virus comprising a M2KO (Δtm) (SEQ ID NO: 1) mutation) and/or a corresponding mutation in an M2 functional equivalent of the virus (e.g., NB protein of influenza b, or CM1 protein of influenza c). In other embodiments, the immunogenic composition comprises a single type of virus or viral antigen comprising a mutant M2 gene (e.g., a virus comprising a M2KO (Δtm) (SEQ ID NO: 1) mutation) and/or a corresponding mutation in an M2 functional equivalent of the virus (e.g., NB protein of influenza b, or CM1 protein of influenza c). For example, in certain embodiments, the major components in an immunogenic composition (such as a vaccine composition) include: one or more influenza a, b, or c viruses, or any combination thereof, or any combination of antigens derived from such viruses, wherein at least one virus comprises a mutant M2 gene (e.g., a virus comprising a M2KO (Δtm) (SEQ ID NO: 1) mutation) and/or a corresponding mutation in an M2 functional equivalent of the virus (e.g., NB protein of influenza b, or CM1 protein of influenza c). For example, in certain embodiments, at least 2 of the 3 types, at least 2 of the different subtypes, at least 2 of the same type, at least 2 of the same subtype, or different isolates or reassortants are provided in an immunogenic composition (e.g., vaccine). By way of example, but not by way of limitation, human influenza a viruses include the H1N1, H2N2, and H3N2 subtypes. In certain embodiments, the immunogenic composition (e.g., vaccine) comprises: a virus comprising a mutant M2 gene (e.g., a virus comprising a M2KO (Δtm) (SEQ ID NO: 1) mutation) and/or a corresponding mutation in the M2 functional equivalent of the virus (e.g., NB protein of influenza b, or CM1 protein of influenza c), and about 0.1-200 μg (e.g., 10-15 μg) of hemagglutinin from each virus strain that entered the composition. Heterogeneity may be provided in a vaccine by mixing at least 2 influenza strains (such as 2-50 strains or any range or value therebetween) of repeated influenza viruses. In certain embodiments, influenza a or b strains with modern antigenic composition are used. In addition, variations in individual influenza strains can be provided with immunogenic compositions (e.g., vaccines) using techniques known in the art.

In certain embodiments, the vaccine comprises such a virus: which comprises M2KO (. DELTA.TM) (SEQ ID NO: 1) mutations and other viral components and/or genes expressing other viral components. In certain embodiments, the vaccine (e.g., a virus comprising a M2KO (ΔTM) (SEQ ID NO: 1) mutation) comprises genes from other strains, including, but not limited to, for example, HA and NA genes from other strains. In certain embodiments, the vaccine comprises HA and NA genes from human influenza a virus subtypes H5N1, H1N1, H2N2, or H3N 2. In certain embodiments, the vaccine comprises HA and NA genes from, for example, PR8x brisban/10/2007, a/vietnam/1203/2004, or a/california/07/2009 (CA 07) virus.

The pharmaceutical composition according to the present invention may further or additionally comprise at least one chemotherapeutic compound, such as an immunosuppressant, an anti-inflammatory or an immunostimulating agent for gene therapy, or an antiviral agent, including, but not limited to, gamma globulin, amantadine, guanidine, hydroxybenzimidazole, interferon-alpha, interferon-beta, interferon-gamma, tumor necrosis factor-alpha, thiosemicarbazones, metaxazone, rifampin, ribavirin, pyrimidine analogs, purine analogs, phosphonic acid, phosphonoacetic acid, acyclovir, dideoxynucleosides, protease inhibitors or ganciclovir.

The composition may also contain variable, but small amounts of endotoxin-free formaldehyde and preservatives, which have been found to be safe and not contributing to undesirable effects in the organism to which the composition is applied.

B. Application of

The immunogenic compositions disclosed herein (e.g., vaccines) can be administered by any of the routes conventionally used or recommended by the vaccine (parenteral route, mucosal route), and can be in different forms: injectable or sprayable liquids, formulations that have been freeze-dried or dried by atomization or air-drying, and the like. The vaccine may be administered by means of a syringe or by means of a needleless syringe for intramuscular, subcutaneous or intradermal injection. The vaccine may also be administered by means of a nebulizer capable of delivering a dry powder or liquid spray to the mucosa, whether they be nasal, pulmonary, vaginal or rectal.

The vaccines disclosed herein can confer resistance to one or more influenza strains by passive or active immunization. In active immunization, an inactivated or attenuated live vaccine composition is administered prophylactically to a host (e.g., a mammal) against which an immune response may protect the host from infection and/or disease. For passive immunization, the elicited antisera may be recovered and administered to a recipient suspected of having an infection caused by at least one influenza strain.

Accordingly, the present invention includes methods for preventing or alleviating a disease or disorder (e.g., an infection caused by at least one strain of influenza virus). As used herein, a vaccine is considered to prevent or ameliorate a disease if administration of the vaccine causes all or part of the symptoms or conditions of the disease to be alleviated (i.e., inhibited), or the individual is immunized against all or part of the disease.

The at least one inactivated or attenuated influenza virus or composition thereof of the invention may be administered by any means that achieves the intended purpose using a pharmaceutical composition as described previously. For example, administration of such compositions may be by various parenteral routes, such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, oral, or transdermal routes. Parenteral administration may be performed using bolus injection or infusion with a time gradient. In certain embodiments, the immunogenic compositions disclosed herein are administered intramuscularly or subcutaneously.

In certain embodiments, the regimen for preventing, inhibiting, or treating an influenza virus-related pathology comprises: an effective amount of a vaccine composition as described herein is administered as a single treatment, or repeated administration as a booster or boost dose over a period of between 1 week and about 24 months (inclusive) or any range or value therebetween. In certain embodiments, the influenza vaccine disclosed herein is administered annually.

According to the invention, an "effective amount" of a vaccine composition is an amount sufficient to achieve the desired biological effect. It will be appreciated that in certain embodiments, the effective dose will depend on the age, sex, health and weight of the recipient, the type of concurrent treatment (if any), the frequency of treatment and the nature of the desired effect. The ranges of effective dosages provided below are not intended to be limiting and represent exemplary dosage ranges. Thus, in certain embodiments, the dosage will be tailored for the individual subject, as understood and determinable by those skilled in the art. The dose of attenuated viral vaccine for adult mammals (e.g., humans) may be about 10 ³ -10 ⁷ Plaque Forming Units (PFU) or any range or value therebetween. The dose range of the inactivated vaccine may be about 0.1-200 (e.g., 50 μg) of hemagglutinin protein. However, using existing vaccines as a starting point, the dose should be a safe and effective amount as determined by conventional methods.

C. Intradermal delivery

Live influenza vaccines have traditionally been delivered intranasally to mimic the natural route of infection and to promote a similar immune response to natural viral infection. As an alternative, disclosed herein are intradermal delivery methods that include the use of novel microneedle devices to take advantage of the immunological benefits of intradermal delivery. In certain embodiments, an attenuated virus (e.g., an M2 virus mutant) is used in a vaccine composition for intradermal administration. In certain embodiments, M2 virus mutants are provided in the vaccine that do not produce infectious progeny virus. Thus, any potential for wild-type circulating influenza virus reconstitution is substantially eliminated.

In embodiments disclosed herein, intradermal delivery (intradermal) applies the vaccine to the skin. In certain embodiments, intradermal delivery is performed using a microneedle delivery device. As disclosed herein, intradermal delivery has numerous advantages. For example, the immunogenicity of a vaccine is enhanced by triggering the immunological potential of the skin immune system. The vaccine is directly accessible to potent antigen presenting skin dendritic cells, i.e., epidermal langerhans cells and dermal dendritic cells. Skin cells produce pro-inflammatory signals that enhance the immune response to antigens introduced through the skin. In addition, the skin immune system produces antigen-specific antibodies and cellular immune responses. In view of the above, intradermal delivery allows for a reduced vaccine dose when delivered intradermally, i.e., a lower dose of antigen may be effective.

Also, because the vaccine is delivered to the skin through the microneedle array of the device, the risk of unintended needle sticks is reduced, and intradermal vaccine delivery via the microneedle array is relatively painless compared to intramuscular injection using conventional needles and syringes.

Microneedle devices are known in the art, including, for example, those described in published U.S. patent applications 2012/0109066, 2011/0172645, 2011/0172639, 2011/0172638, 2011/0172637, and 2011/0172609. The microneedle device may be made, for example, as follows: fabricated from stainless steel sheet (e.g., trinity Brand Industries, georgia; SS 304;50 μm thick) by wet etching. In certain embodiments, a single microneedle has a length of about 500 μm to 1000 μm (e.g., about 750 μm) and a width of about 100 μm to 500 μm (e.g., about 200 μm). The vaccine may then be applied as a coating to the microneedles. By way of example, but not by way of limitation, the coating solution may include 1% (w/v) carboxymethylcellulose sodium salt (low viscosity, U.S. pharmacopoeia grade; carbon-Mer, san Diego CA), 0.5% (w/v) Lutrol F-68NF (BASF, mt.Olive, NJ), and antigen (e.g., 5ng/ml soluble HA protein; live attenuated viruses such as M2 mutant viruses described herein, etc.). To achieve higher vaccine concentrations, the coating solution may be evaporated at room temperature (23 ℃) for 5-10 minutes. The coating may be performed by a dip coating method. The amount of vaccine per row of microneedles can be determined as follows: the microneedles were immersed in 200 μl of Phosphate Buffered Saline (PBS) for 5 minutes and the antigen was determined by methods known in the art.

In certain embodiments, microneedle devices are used that are made primarily of polypropylene and stainless steel rough cut (first-cut) blocks that are mated together with a simple snap fit and heat seal. In certain embodiments, the device is entirely self-contained and includes a vaccine, a pump mechanism, an activation mechanism, and a microneedle unit. These components are concealed within the plastic cover. With the device, vaccine infusion is initiated by pressing an actuation button. Pressing the button simultaneously inserts the microneedle into the skin and activates the pumping mechanism, which exerts pressure on the primary drug container. When the spring mechanism exerts sufficient pressure on the vaccine reservoir, the vaccine begins to flow through the microneedle array and into the skin. In certain embodiments, delivery of the vaccine dose is completed within about 2 minutes after actuation of the device. After infusion was completed, the device was gently removed from the skin.

In certain embodiments, a method of intradermal administration of an immunogenic composition (e.g., a vaccine) using a microneedle device is provided. In certain embodiments, the microneedle device comprises a piercing mechanism and an immunogenic composition layer comprising a plurality of microneedles capable of piercing the skin and allowing intradermal administration of the immunogenic composition. In certain embodiments, the method comprises compressing the lancing mechanism. In certain embodiments, the immunogenic composition (e.g., vaccine) comprises a virus comprising a nucleic acid sequence encoding an expressed mutant M2 protein or a mutant M2 protein that is not expressed; wherein the expressed mutant M2 protein comprises or consists of the amino acid sequence of SEQ ID NO. 4. In certain embodiments, the microneedle array is initially located inside the device housing and, upon actuation of the lever, allows the microneedles to extend through the bottom of the device and into the skin, thereby allowing infusion of vaccine fluid into the skin.

The delivery devices described herein may be used to deliver any substance that may be desired. In one embodiment, the substance to be delivered is a drug and the delivery device is a drug delivery device configured to deliver the drug to the subject. The term "drug" as used herein is intended to include any substance (e.g., vaccine, drug, nutrient, nutraceutical, etc.) that is delivered to a subject for any therapeutic, prophylactic, or medical purpose. In one such embodiment, the drug delivery device is a vaccine delivery device configured to deliver a dose of vaccine to a subject. In one embodiment, the delivery device is configured to deliver an influenza vaccine. Embodiments discussed herein relate generally to devices configured to transdermally deliver a substance. In certain embodiments, the device may be configured to deliver a substance directly to an organ other than the skin.

Examples

Although the following examples are demonstrated with influenza a, it is to be understood that the mutations and methods described herein are equally applicable to other viruses that express M2, M2-like proteins or proteins having the same or similar function as influenza a M2 protein.

Example 1: preparation of M2 Virus mutants

The M2 mutant was constructed as follows.

a) M2-1: m2 extracellular Domain+2 stop codon+TM deletion (PR 8M segment+2 stops (786-791) none 792-842 (TM))

Part of the wild-type M gene was amplified from PR8 by PCR using oligo set 1 and oligo set 2 as shown below.

TABLE 6
	Oligomer aggregate 1
acacacCGTCTCTAGgatcgtctttttttcaaatgcatttacc(SEQ ID NO:10)
	CACACACGTCTCCTATTAGTAGAAACAAGGTAGTTTTT(SEQ ID NO:11)
Oligo set 2
	acacacCGTCTCatcCTATTAatcacttgaaccgttgc(SEQ ID NO:12)
CACACACGTCTCCGGGAGCAAAAGCAGGTAG(SEQ ID NO:13)

The PCR product was then digested with BsmBI. The expression vector (pHH 21) was also digested with BsmBI and the digested PCR product was ligated into the vector using T4DNA ligase. Coli cells are transformed with the vector and, after appropriate incubation, the vector is isolated and purified by methods known in the art. The mutant M2 portion of the vector was characterized by nucleic acid sequencing.

b) M2-2: m2 extracellular domain+2 stop+splice defects (PR 8M segment+2 stop (786-791) +splice defect nucleotide 51)

Using the primer set shown below, a portion of the wild-type M gene was amplified from PR8 by PCR.

TABLE 7
	PCR primer
5’acacacCGTCTCcCTACGTACTCTCTATCATCCCG(SEQ ID NO:14)
	5’CACACACGTCTCCTATTAGTAGAAACAAGGTAGTTTTT(SEQ ID NO:15)

The PCR product was then digested with BsmBI. The expression vector (pHH 21) was also digested with BsmBI. Double-stranded DNA fragments were then prepared by annealing the 2 nucleotides shown below.

TABLE 8
	Annealed nucleotides
5’GGGAGCAAAAGCAGGTAGATATTGAAAGatgagtcttctaaccgaggtcgaaac(SEQ ID NO:16)
	5’GTAGgtttcgacctcggttagaagactcatCTTTCAATATCTACCTGCTTTTGC(SEQ ID NO:17)

The digested vector, PCR product and double stranded fragment were then ligated using T4DNA ligase. Coli cells are transformed with the vector and, after appropriate incubation, the vector is isolated and purified by methods known in the art. The mutant M2 portion of the vector was characterized by nucleic acid sequencing.

c) M2-3M 2 extracellular Domain+2 stops+splice defects+TM deletions (PR 8M segment+2 stops (786-791) does not have 792-842 (TM) +splice defective nucleotide 51)

The partial M2-1 mutant (M2 extracellular domain+2 stop codons+TM deleted (PR 8M segment+2 stops (786-791) no 792-842 (TM)) was amplified from PR8 by PCR using the following primers:

TABLE 9
	PCR primer
5’acacacCGTCTCcCTACGTACTCTCTATCATCCCG(SEQ ID NO:18)
	5’CACACACGTCTCCTATTAGTAGAAACAAGGTAGTTTTT(SEQ ID NO:19)

The PCR product was then digested with BsmBI. The expression vector (pHH 21) was also digested with BsmBI. Double-stranded DNA fragments were then prepared by annealing the 2 nucleotides shown below.

Table 10
	Annealed nucleotides
5’GGGAGCAAAAGCAGGTAGATATTGAAAGatgagtcttctaaccgaggtcgaaac(SEQ ID NO:20)
	5’GTAGgtttcgacctcggttagaagactcatCTTTCAATATCTACCTGCTTTTGC(SEQ ID NO:21)

The digested vector, PCR product and double stranded fragment were then ligated using T4DNA ligase. Coli cells are transformed with the vector and, after appropriate incubation, the vector is isolated and purified by methods known in the art. The mutant M2 portion of the vector was characterized by nucleic acid sequencing.

The sequences of each of the 3M 2 mutant constructs are provided in tables 1-3.

Example 2: preparation and culture of M2 mutant viruses

This example demonstrates the cultivation of PR8 virus containing M2KO (. DELTA.TM) (SEQ ID NO: 1) mutation. Mutant viruses were prepared with some modifications as reported in Neumann et al Generation of influenza A viruses entirely from clone cDNAs, proc.Natl.Acad.Sci.USA 96:9345-9350 (1999). Briefly, 293T cells were transfected with 17 plasmids: 8 PolI constructs for 8 RNA segments, one of which carries a mutant M2 sequence; and 9 protein expression constructs for the following 5 structural proteins: NP (pCAGGS-WSN-NP 0/14); m2 (pEP 24 c); PB1 (pcDNA 774); PB2 (pcDNA 762); and PA (pcDNA 787) from A/Puerto Rico/8/34 (H1N 1) virus.

Plasmids were combined with transfection reagent (2. Mu.L Trans)

LT-1 (Mirus, madison, wis.)/μg DNA) was mixed, incubated at room temperature for 15-30 minutes, and 1X10 was added ⁶ In 293T cells. After 48 hours, the virus in the supernatant was serially diluted and inoculated into M2CK cells. 2-4 days after inoculation, the virus in the supernatant in the final dilution well, where the cells show a pronounced cytopathic effect (CPE), was inoculated into M2CK cells for production of stock virus. The M gene of the prepared virus was sequenced to confirm the expected mutated gene and presence and to ensure that no unwanted mutations were present.

The mutant M2 virus was cultured and passaged as follows. M2CK host cells were cultured in the presence of MEM supplemented with 10% fetal bovine serum. Cells were infected at a MOI of 0.001 by washing with PBS followed by adsorption of the virus at 37 ℃. Viral growth medium containing trypsin/TPCK was added and the cells were incubated for 2-3 days until cytopathic effects were observed.

Example 3: restricted M2KO replication in normal cells

In normal MDCK cells and MDCK cells stably expressing M2 protein (M2 CK), the growth kinetics of PR8 virus having M2KO (. DELTA.TM) (SEQ ID NO: 1) mutation and wild-type PR8 were analyzed. At 10 ^-5 Is a complex of infection, and the cells are infected with a virus. Viral titers of cell supernatants were determined in MDCK or M2CK cells. Wild-type PR8 grew to high titers in both cell types, whereas M2KO grew well only in M2CK cells and not at all in MDCK cells (fig. 4).

Example 4: m2KO virus produces viral antigen in normal cells, but does not produce M2

This example demonstrates that PR8 virus with M2KO (. DELTA.TM) (SEQ ID NO: 1) mutation produces viral antigen in normal cells, but does not produce M2 protein. Viral protein expression was assessed by infecting wild-type MDCK cells with wild-type PR8 or M2KO at a multiplicity of infection (MOI) of 0.5 in medium without trypsin (to ensure that the virus completed only 1 life cycle). Viral proteins in cell lysates were separated on 4-12% SDS-PAGE gels and detected by Western blotting using PR8 infected mouse serum (panel A) or anti-M2 monoclonal antibody (14C2,Santa Cruz Biotechnology) (panel B). Group a in fig. 5 shows that similar protein expression levels of PR8 and M2KO were detected against antisera to PR 8. When lysates were probed with anti-M2 monoclonal antibodies (group B), M2 expression was detected only in PR8 infected cells, not in M2 KO. These results indicate that the M2KO virus expresses all viral proteins except the M2 protein at a similar level as the PR8 virus (fig. 5).

Example 5: the M2 mutant is attenuated in vivo

An experiment was performed to confirm that the M2 mutant virus was attenuated in vivo. Female mice (23/group) of 6 week old BALB/c were inoculated intranasally with one of the following mutants: m2KO (yk) as described in j.virol (2009) 83:5947-5950; m2-1 (TM del M2KO aka M2KO (. DELTA.TM)) and M2-2 (Splice def M2 KO) (collectively referred to as "M2KO variants"). At 1.2x10 ⁴ The mutant was administered at pfu/mouse dose. PBS was administered to mice in the control group. Mice were observed for any changes in body weight and symptoms of infection for 14 days after inoculation. In addition, 3 days after inoculation, virus titers were obtained from the lungs and turbinates (NTs) of 3 mice per group.

As shown in fig. 6, mice vaccinated with the M2KO variant and PBS did not show any clinical symptoms of infection nor lost any body weight for a 14 day period. The change in body weight between groups was comparable over a 14 day period. In addition, no virus was detected in titers collected from the lungs and NTs. The lack of clinical symptoms, lack of weight loss, and lack of virus together indicate that M2 mutant viruses are attenuated and non-pathogenic in mice.

Example 6: m2 mutant induces antibodies against influenza virus and protects mice from lethal virus attack

Experiments were also performed to determine the antibody titers from the mice described in example 5 above and their survival after challenge with a lethal viral dose. Serum samples were collected 3 weeks after inoculation and anti-viral IgG antibody titers from the serum samples were determined by enzyme-linked immunosorbent assay (ELISA). Humoral responses are shown in figure 7, which shows that all 3M 2 mutants raised anti-influenza virus antibodies above the PBS control group.

In addition, half of the mice in each group were boosted 28 days post-inoculation with the same amount of M2 mutant virus. Serum was then collected 6 weeks after the first inoculation and IgG titers against the virus were determined. As shown in fig. 7B, mice boosted with M2 mutant virus had higher levels of anti-influenza virus antibodies than non-boosted mice.

49 days after the first inoculation (3 weeks after boosting), mice were challenged with a lethal dose of PR8 virus (40 mice were challenged with a 50% lethal dose (MLD) ₅₀ )). As shown in fig. 8 and 9, all mice vaccinated with the M2KO variant were challenged without weight loss. However, control mice administered PBS alone lost weight and were not alive 8 days after the challenge day. On day 3 after challenge, lung and NT were obtained and virus titers were determined by plaque assay in MDCK cells. As shown in table 11, pneumovirus titers in the M2KO variants were at least 1 log lower than in the original control PBS, and almost no virus was detected in the turbinates of the M2KO variant group, but more than 100,000PFU/g was detected in the original control PBS group, indicating that the M2 mutant vaccine would confer protection and limitation of replication of the challenge virus.

Table 11: viral titers in mouse tissues after challenge (log 10 PFU/g)

	Lung (lung)	Nose armor
			M2KO(yk)	6.1，5.9，ND	1.7，ND，ND
M2KO(ΔTM)	5.8±0.25	2.5，ND，ND
			M2KO(splice def)	ND，ND，ND	ND，ND，ND
PBS	7.9±0.27	5.3±0.55

In another experiment, the M2KO (ΔTM) group was challenged with either subtype or heterosubtype influenza virus 6 weeks after immunization. Mice were challenged with the aici (H3N 2) virus and scored for survival for 14 days. The results of the heterosubtype challenge are shown in figure 16.

Example 7: intradermal vaccine delivery

Experiments were performed to demonstrate that intradermal vaccine delivery/immunization protects subjects from influenza. 1.8x10 per mouse ¹ 、1.8x10 ² 、1.8x10 ³ Or 1.8x10 ⁴ Concentration of pfu (50. Mu.l) PR8 virus (3.5X10) was inoculated Intranasally (IN), intramuscularly (IM) or Intradermally (ID) to 6-7 week old BALB/c female mice (5/group) (Harland Laboratories) ⁷ pfu). PBS was also administered to control mice by 3 different routes of administration. Body weight and survival were monitored for 14 days post inoculation. For the mouse experiments, an allergy syringe with an intradermal bevel needle was used.

Most vaccines are administered by intramuscular or subcutaneous injection using conventional needles and syringes. However, recent studies have demonstrated that intradermal vaccine delivery achieves better immunogenicity than intramuscular or subcutaneous administration. Intradermal vaccination delivers antigen directly to the enriched skin immune system and has been shown to be effective against a variety of vaccines, including rabies, hepatitis b and influenza. Intradermal delivery may also provide dose reduction, thereby achieving the same immune response with less vaccine than is required for intramuscular injection. Current state of the art for intradermal delivery (using conventional needles and syringes) is the mango technique, which requires a lot of training, is difficult to perform, and often results in misdirected (subcutaneous) or incomplete administration. The lack of suitable delivery devices has hampered intradermal vaccination research and product development, although superior immune responses have been documented using this route of administration.

As shown IN Table 12, IN-vaccinated mice will be at 1.8X10 ³ And 1.8x10 ⁴ Influenza infection occurred at higher doses of pfu/mouse, at 1.8x10 alone ¹ Has complete survival. However, IM-and ID-vaccinated mice survived at all doses. Table 13 shows half the lethal dose (MLD) of IN-vaccinated mice ₅₀ ). FIG. 10 shows that 1.8X10 ⁴ pfu virus IM-and ID-vaccinated mice showed no weight change and showed 1.8X10 ⁴ pfu virus IN-vaccinated mice lack survival.

Serum was collected at 2 weeks (fig. 11A) and 7 weeks (fig. 11B) after inoculation and evaluated for anti-PR 8IgG antibodies (as determined by ELISA). "Hi" means 1.8x10 ⁴ pfu inoculation, "Lo" stands for 1.8x10 ¹ pfu. IN-, IM-and ID-vaccinated mice responded IN both time periods IN a classSimilarly, the method is used for preparing the liquid crystal display. IN-vaccinated mice exhibited the highest number of antibodies per time period. Only 1.8x10 was identified ¹ pfu IN-vaccinated mice (i.e., "Lo") because by this time, mice vaccinated with higher doses of IN-have died. IM-and ID-vaccinated mice exhibited lower levels of antibody than IN-vaccinated mice, although vaccinated mice exhibited greater amounts of antibody at higher doses than control mice administered PBS alone. In addition, the intradermal route of administration produced more antibody over time than the intramuscular route, as demonstrated by the higher titer levels shown in fig. 11B.

IN another experiment, groups of IN-, IM-and ID-vaccinated mice were challenged 8 weeks after vaccination (except 1.8x10 ³ Out of the 4 mice of the group, 5 mice/group). Specifically attack 1.8x10 ¹ IN-vaccinated mice, 1.8x10 ³ IM-vaccinated mice, 1.8x10 ⁴ IM-vaccinated mice, 1.8x10 ³ ID-vaccinated mice and 1.8x10 ⁴ ID-vaccinated mice. Mice that lost their body weight by more than 25% were euthanized.

As shown in FIG. 12, 100% of the total weight of the composition is 1.8x10 ³ IM-vaccinated mice did not survive 8 days post challenge. The survival rate of all ID-vaccinated mice was between 40% and 60%. However, at 1.8x10 ⁴ The survival rate of IM-vaccinated mice was 100%. FIG. 13 shows that ID-vaccinated and IM-vaccinated (1.8X10) ⁴ ) The mice groups had an initial average weight loss, but ended with a low weight loss relative to the challenge date.

ID-vaccinated mice (1.8x10) ⁴ ) The evaluation of (1 and 5 in fig. 14 and 15) showed that 2 mice elicited a better immune response than the other mice, and in addition did not develop signs of influenza infection (e.g., weight loss, uneven fur, calm, etc.). However, in the IM-vaccinated group (1.8x10 ⁴ ) All mice in (a) exhibited some symptoms and lost at least 10% of body weight.

Example 8: stability of M2KO variants

To test the stability of the M2 gene of the M2KO variant in wild-type cells, the M2KO variant was passaged in wild-type MDCK cells lacking expression of the M2 protein as well as M2CK cells, which are MDCK cells expressing the M2 protein. All M2KO variants were passable in M2CK cells without any mutation at least until passage 10. Although M2-1 (TM del M2 KO), M2-2 (Splice def M2 KO) and M2-3 (TM del+splice def M2 KO) could not be passaged in wild-type MDCK cells (no cytopathic effect (CPE) was observed in wild-type MDCK cells), M2KO (yk) showed CPE even after passage 4 in MDCK cells. M-segment RNA was extracted from the 4 th generation of M2KO (yk) in wild-type MDCK and cDNA was sequenced. As shown in Table 14, 2 inserted stop codons for M2KO (yk) were edited, and the 4 th generation of M2KO (yk) in wild type MDCK had full length M2 protein gene.

Example 9: m2KO vaccination

In order to confirm that the M2KO vaccine can stimulate an immune response similar to that of natural influenza infection, vaccine experiments were performed. The low inoculum of PR8 virus represents a natural influenza infection and the inactivated PR8 virus (Charles River) delivered by the standard intramuscular and intranasal routes represents a standard inactivated influenza vaccine.

PR8 virus (10) with live virus (10 pfu PR8), containing M2KO (ΔTM) delivered intranasally and intramuscularly ⁴ pfu) or 1 μg of inactivated PR8 virus to 6-7 week old BALB/c mice. Intranasal administration 10 ⁴ The M2KO (. DELTA.TM.) infected particle mice did not lose weight and did not show signs of infection. In addition, the lungs of mice treated with M2KO (Δtm) did not contain detectable infectious particles 3 days after inoculation. On day 21, serum was obtained from immunized mice and antibody titers against hemagglutinin were determined by standard ELISA assays. FIG. 17 shows that anti-HA IgG titers were highest in the live virus and M2KO (ΔTM) groups compared to the inactivated vaccine group. Mucosal IgA antibodies against influenza were detected only in the serum of live PR8 or M2KO vaccinated mice.

6 weeks after immunization, all groups were challenged with either isotype (PR 8, H1N 1) or heterosubtype (Aichi, H3N 2) influenza virus. Both M2KO and inactivated vaccination protected mice from infection with subtype virus (fig. 18). However, only M2KO vaccinated mice were protected from heterosubtype virus challenge (fig. 19). Mice immunized with the inactivated vaccine develop infection similar to that of naive mice.

Example 10: m2KO (delta. TM) virus does not replicate in the respiratory tract or other organs

Summary-this example demonstrates that the M2KO (Δtm) virus does not replicate in the respiratory tract or spread to other organs in ferret models. At 1x10 ⁷ Dosage level of TCID50, M2KO (Δtm) virus was administered intranasally to 3 male ferrets. As a control, 1x10 ⁷ TCID ₅₀ Is administered intranasally to a second group of 3 male ferrets an influenza a/bris shift/10/2007 (H3N 2). After virus inoculation, ferrets were observed for mortality to day 3 post inoculation, with daily measurements of body weight, body temperature and clinical signs. All animals were necropsied 3 days after inoculation. Organs were collected for histopathology and viral titers.

The control group receiving a/brisban/10/2007 (H3N 2) showed a short drop in weight and an increase in body temperature at 2 days post-inoculation, which was not observed in the M2KO (Δtm) group. The activity level in the A/Brisbane/10/2007 group also decreased, sneezing was observed on days 2-3 post infection. No changes in activity levels or clinical signs associated with virus exposure were observed in the M2KO (Δtm) group. Histopathological analysis revealed changes in turbinates in animals exposed to influenza a/brisban/10/2007 (H3N 2), which were not observed in ferrets exposed to M2KO (Δtm) virus. Exposure to a/brisban/10/2007 can result in atrophy of the respiratory epithelium, neutrophil infiltration, and turbinate edema. Viral inoculation did not affect other organs. Under experimental conditions, the M2KO (Δtm) virus did not induce clinical signs of infection or cause histological changes in the organs analyzed.

Materials and methods

A. Vaccine material and control virus: the M2KO (ΔTM) virus is a recombinant virus as follows: it HAs the internal 6 genes of PR8 (nucleoprotein (NP), polymerase genes (PA, PB1, PB 2), non-structural (NS), matrix (M)), but it does not express functional M2 proteins, as well as HA and NA genes of influenza a/brisban/10/2007-like a/ilex/716/2007 (H3N 2). A/Brisban/10/2007 (H3N 2) wild-type virus served as a control virus and was supplied by IITRI. The virus was cryopreserved at-65 ℃ prior to use.

B. Test and positive control dosage formulations: by mixing 8. Mu.L of 1x1010TCID ₅₀ 1X10 per 316. Mu.L was prepared by diluting/mL into 2.528mL of PBS ⁷ TCID ₅₀ M2KO (. DELTA.TM.) virus administration solution per mL. 1X10 per 316. Mu.L was used undiluted ⁷ TCID ₅₀ A/Brisbane/10/2007 (H3N 2) titres per mL.

C. Animal and animal care: 8 male ferrets were purchased from Triple F farm and 6 ferrets were used for the study. At the start of the study, the animals were approximately 4 months of age. The animals were tested healthy by the supplier and were free of antibodies to infectious diseases. After arrival, the animals were individually housed in suspension wire cages with a slatted bottom, suspended above a waste tray of interleaving paper. Prior to receiving the animals, the animal houses and cages have been cleaned and sterilized according to accepted animal care practices and related standard operating procedures. Certified Teklad Global Ferret Diet #2072 (Teklad diabetes, madison Wis.) and Chicago city tap water were supplied ad libitum and updated at least 1 time per day. Fluorescent lighting in the animal house was maintained at a 12-hour light/dark cycle. During the course of the study, the animal room temperature and relative humidity were within the respective protocol limits and were in the range of 22.0-25.0 ℃ and 33-56%, respectively.

D. Animal isolation and randomization: ferrets were kept isolated for 5 days, then randomized and observed daily. Ferrets were released from quarantine for randomization and testing based on daily observations indicating overall good health of the animals. After isolation, ferrets were weighed and assigned to treatment groups based on body weight resulting in similar group averages using computerized randomization operations [

Version e.11 (PDS Pathology Data Systems, inc., basel, switzerland)]. Within a group, all body weights are within 20% of their average value. Animals selected for the study received a permanent identification number via the ear tag, and the transponder and respective cage card also identified the study animal via respective number and group. The assigned authentication number is unique in the study.

E. Experiment design: all animal manipulations were performed in an animal biosafety level-2 device according to an animal care and use committee approved protocol at IIT Research Institute. 6 male ferrets (Triple F farm, sayr PA) (4 months of age at study initiation) were used for the study. Ferrets were monitored for 3 days prior to infection to measure body weight and establish a baseline body temperature. Temperature readings were recorded daily by subcutaneous implantation of a transponder (BioMedic data system, seaford, DE) in each ferret. Blood was collected through the jugular vein prior to study initiation and serum was tested for influenza antibodies. Study animals without influenza antibodies were randomized and divided into 2 groups (3 ferrets/group) as shown in table 15. A group of 3 ferrets was anesthetized and vaccinated intranasally with a single dose of 316 μl 1×10 ⁷ TCID ₅₀ M2KO (delta. TM) virus of (E). The control group (3 ferrets) was inoculated with 316. Mu.L of 1X10 ⁷ TCID ₅₀ Is 1/brisban/10/2007 (H3N 2). Ferrets were observed daily to monitor body weight, body temperature and clinical symptoms. On day 3 post inoculation, ferrets (3 ferrets/group) were euthanized and necropsied. The following tissue samples were collected: turbinates, trachea, lung, kidney, pancreas, olfactory bulb, brain, liver, spleen, small intestine and large intestine. One portion of the collected samples was fixed with buffered neutral formalin for histological evaluation, and the other portion of the samples was preserved at-65 ℃ for virus titration.

TABLE 15 immunization and sample collection plans

F. Virus inoculation: ferret was vaccinated with M2KO (delta. TM) virus or wild type A/Brisbane/10/2007 (H3N 2) influenza a virus. A bottle of frozen stock was thawed and diluted to the appropriate concentration in phosphate buffered saline solution. Ferrets were anesthetized with ketamine/ranolazine and virus doses were administered intranasally in volumes of 316 μl (for M2KO (Δtm) virus) and 316 μl (for a/brisban/10/2007 (H3N 2) virus). To confirm the inoculation titer of A/Brisban/10/2007 (H3N 2) virus, TCID was performed on a portion of the prepared virus challenge solution in IITRI ₅₀ And (5) measuring. Viral titer assays were performed according to Illinois Institute of Technology Research Institute (IITRI) standard protocol.

G. Moribundity/mortality observations: after challenge, all animals were observed 2 times daily for evidence of mortality or moribund rate. Animals were observed 3 days after challenge. Animals were euthanized by intravenous administration of an overdose of 150mg/kg sodium pentobarbital.

H. Body weight and body weight changes: animal body weight was recorded at the time of reception (10% of samples at random), at the time of randomization (day-3 to 0) and daily after virus inoculation.

I. Clinical observation: the temperature change (in degrees celsius) of each ferret was determined daily. Clinical signs, loss of appetite, respiratory signs (such as dyspnea, sneeze, cough, and rhinorrhea) and activity levels were assessed daily. The activity level was assessed using a score based on that described by Reuman, et al, "Assessment of signs of influenza illness in the ferret model," J.Virol, methods 24:27-34 (1989), as follows: 0, alert and fun; 1, alert, but interesting only when stimulated; 2, alert, but not interesting when stimulated; and 3, neither alert nor fun when stimulated. The Relative Inactivity Index (RII) was calculated as the average score per observation (day) of each group of ferrets during the study.

J. Euthanasia: study animals were euthanized by intravenous administration of 150mg/kg sodium pentobarbital. Death was confirmed by the absence of observable heart beats and respiration. Necropsy was performed on all study animals.

K. Necropsy: nasal turbinates, trachea, lung, kidney, pancreas, olfactory bulb, brain, liver, spleen, small intestine and large intestine were harvested. One portion of each tissue was fixed in formalin and the other portion was given IITRI bars for freezing and storage. The tissues harvested for titers were: the right nasal concha, the upper 1/3 of the trachea, the right cranial lobes, the right kidney, the right branch of the pancreas (near the duodenum), the right olfactory bulb, the right brain, the right hepatic lobes, the right half of the spleen (the end of the spleen seen when the abdominal cavity is opened), the small intestine and the large intestine.

L. histopathological analysis: tissues were embedded in paraffin blocks, sectioned at approximately 5-micron thickness, and stained with hematoxylin and eosin (H & E).

Serum collection: serum was collected from all ferrets prior to vaccination (day-3). Ferrets were anesthetized with a mixture of ketamine (25 mg/kg) and ranolazine (2 mg/kg). Blood samples (approximately 0.5-1.0 mL) were collected from each ferret via the vena cava and processed into serum. Blood was collected into a Serum Gel Z/1.1 tube (Sarstedt inc. Newton, NC) and stored at room temperature for no more than 1 hour, after which Serum was collected. The Serum Gel Z/1.1 tube was centrifuged at 10,000Xg for 3 minutes and Serum was collected. Individual pre-inoculation serum samples were collected and 2 aliquots were prepared from each sample. One aliquot was tested prior to study initiation to confirm that ferrets did not contain antibodies to influenza a virus, and one serum aliquot was stored at-65 ℃.

N. Hemagglutination Inhibition (HI) assay: serum samples were treated with Receptor Destroying Enzyme (RDE) (Denka Seiken, tokyo, japan) to eliminate non-specific inhibitors of hemagglutination. The RDE was reconstructed according to the manufacturer's instructions. Serum was diluted 1:3 in RDE and incubated in a 37.+ -. 2 ℃ water bath for 18-20 hours. After adding an equal volume of 2.5% (v/v) sodium citrate, the samples were incubated in a 56.+ -. 2 ℃ water bath for 30.+ -. 5 minutes. After RDE treatment, 0.85% nacl was added to each sample to a final serum dilution of 1:10. The diluted samples were then diluted in Phosphate Buffered Saline (PBS) in duplicate to 4 2-fold dilutions (1:10 to 1:80) and then incubated with 4 hemagglutination units of influenza a/brisbane/10/2007 (H3N 2) virus. After incubation, 0.5% chicken red blood cells were added to each sample and incubated. The presence or absence of hemagglutination is then scored.

O. viral titer: by TCID in Madin-Darby canine kidney (MDCK) cells ₅₀ The concentration of infectious virus in the virus inoculum samples before and after challenge was determined. Briefly, samples stored at-65 ℃ were thawed and centrifuged to remove cell debris. The resulting supernatant was diluted 10-fold in triplicate in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, carlsbad, calif., USA) containing penicillin/streptomycin, 0.1% gentamicin, 3% NaCO in 96-well microtiter plates ₃ 0.3% BSA fraction V (Sigma St. Louis, MO), 1% MEM vitamin solution (Sigma) and 1% L-glutamine (Meditech, marassas, va., USA). After preparation of 10-fold serial dilutions, 100L was transferred into individual wells of a 96-well plate containing a monolayer of MDCK cells. At 37 ℃ +/-2 ℃ and 5+/-2% CO ₂ Plates were incubated at 70% humidity. After 48 hours, the wells were observed for cytopathogenic effects (CPE). Supernatants (50 μl) from each well were transferred to 96-well plates and Hemagglutination (HA) activity was determined and recorded. The HA activity of the supernatant was assessed by HA assay using 0.5% packed turkey red blood cells (crbcs). TCID was calculated using the method of Reed LJ and Muench H, "A simple method for estimating% points," am. J. Hygine 27:493-497 (1938) ₅₀ Titer.

P, data analysis: the body weight and body weight gain (loss) and body temperature changes for each individual animal were determined and expressed as the mean and mean standard deviation for each test group.

Results

After inoculation with M2KO (ΔTM) virus or A/Brisban/10/2007 (H3N 2) influenza A virus, ferrets were monitored for survival and clinical signs of infection. The results are presented in tables 16A and 16B. All ferrets were spent on infection with M2KO (ΔTM) virus and A/Brisbane/10/2007 (H3N 2). Ferrets vaccinated with A/Brisbane/10/2007 exhibited respiratory signs (sneezes) on days 2 and 3. Ferrets vaccinated with A/Brisban/10/2007 had a relative inactivity index of 0.67; whereas ferrets vaccinated with M2KO (Δtm) showed no decrease in activity level, with a relative inactivity index of 0.0.

Body weight after virus inoculationAnd the change in temperature are shown in fig. 20 and 21. Following inoculation with A/Brisban/10/2007 (H3N 2), a 2-3% weight loss was observed in all animals on day 2 post-inoculation. Slight to zero weight loss was observed in ferrets vaccinated with M2KO (Δtm) virus. One M2KO (. DELTA.TM) -vaccinated ferret exhibited a 1% weight loss on day 2 post-vaccinations. High body temperatures of 40.3-40.7℃were observed in ferrets vaccinated with A/Brisbane 10/2007 on day 2 post-vaccination. Body temperature returned to normal range on day 3. The body temperature of M2KO (. DELTA.TM.) vaccinated ferrets remained within normal range during the study period. To determine whether the M2KO (Δtm) virus replicates in the respiratory tract or other organs and induces pathology, ferret tissues were histologically examined on day 3 post-inoculation and compared to those obtained from ferrets vaccinated with a/brisbane/10/2007. In ferrets vaccinated with A/Brisban/10/2007, pathology was observed only in the turbinates. Atrophy of the respiratory epithelium, neutrophil infiltration and edema were observed in the turbinates. In ferrets vaccinated with M2KO (Δtm) virus, no histopathological changes associated with viral infection were observed. The concentration of the virus administration solution before and after challenge was 10, respectively ^7.5 TCID ₅₀ /mL and 10 ^7.75 TCID ₅₀ /mL, indicating good stability of the challenge material in application.

Table 16A: effects of virus vaccination on survival of ferrets and clinical signs of infection.

^a Hemagglutination Inhibition (HI) antibody titers against homologous viruses in ferret serum prior to virus inoculation.

^b Clinical signs were observed 3 days after virus inoculation. In addition to sleepiness, findings of clinical signs are given as the number/total of ferrets with signs. Respiratory signs include sneezing.

^c Determined 2 times per day based on a scoring system, observed for 3 days, and calculated as each time over a 3-day periodThe average score of each group of ferrets was observed (day). The relative inactivity index before inoculation was 0.

Table 16B: m2KO (. DELTA.TM) did not replicate in ferret respiratory harvested on day 3

Conclusion(s)

This example shows that on day 3 post-inoculation, the M2KO (ΔTM) virus does not induce clinical signs of disease or histopathological changes associated with wild-type virus infection. This suggests that the M2KO (ΔTM) virus of the present technology can be used in intranasal influenza vaccines.

Example 11: immune response and protection of M2KO (delta. TM) virus against other vaccines

Summary-this example demonstrates the immune response elicited by the M2KO (delta TM) vaccine and the protective effect of this vaccine in the ferret model. At 1x10 ⁷ TCID ₅₀ Is administered intranasally to 12 male ferrets. As a control, 1x10 ⁷ TCID ₅₀ Is administered intranasally to a second group of 12 male ferrets with fm#6 virus. Administration of OPTI-MEM to ferrets of the third group ^TM As placebo control. For each treatment group, either a challenge-only or challenge-boost vaccination regimen was used. Ferrets receiving the challenge-boost vaccination regimen were given a challenge vaccine (day 0) and a boost vaccination after 28 days (day 28). On the same day (day 28) that the boost vaccine was administered to the challenge-boost ferret, a single vaccination was administered to ferrets that received only the challenge vaccine. After each vaccination, ferrets were observed for mortality to 14 days post-vaccination, with daily measurements of body weight, body temperature and clinical signs. Nasal washes were collected from ferrets on days 1, 3, 5, 7 and 9 post challenge vaccination to observe viral shedding. Nasal washes and serum were collected weekly from all ferrets after vaccination to evaluate antibody levels over time.

On day 56, 1X10 was used ⁷ TCID ₅₀ Is +.A/Brisban-10/2007 (H3N 2) all animals were challenged intranasally. After challenge, ferrets were monitored for mortality to 14 days post inoculation, with daily measurements of body weight, body temperature and clinical signs. Nasal washes were collected from ferrets in each group for viral titers on days 1, 3, 5, 7, 9 and 14 post-challenge. In addition, serum was collected from surviving ferrets for analysis after challenge (day 70). 3 days after challenge, autopsies were performed on 3 ferrets per group. Organs were collected for histopathology and viral titers.

No vaccine-related adverse events were observed in group 5. Following challenge, the placebo control group exhibited an increase in body temperature and a decrease in weight 2 days after challenge. Weight loss was also observed in the M2KO (Δtm) and FM #6 vaccinated groups; however, the reduction is less than in OPTI-MEM ^TM The relief observed in the group. The level of activity was not reduced in any group; however, sneezing was observed in all groups after the challenge. Histopathological analysis revealed that the same as OPTI-MEM ^TM Lung infiltration in control group the severity of mixed cell infiltration in vaccinated ferret lungs was increased compared to lung infiltration in control group. In the turbinates, with OPTI-MEM ^TM Animals receiving either the challenge or challenge + boost regimen of M2KO (Δtm) or FM #6 had a lower severity of respiratory epithelial atrophy compared to the control group. Vaccination with M2KO (Δtm) virus appears to provide similar protection against viral challenge as fm#6 virus.

Materials and methods

A. Vaccine material: the M2KO (ΔTM) virus is a recombinant virus as follows: it HAs the internal 6 genes of PR8 (nucleoprotein (NP), polymerase genes (PA, PB1, PB 2), non-structural (NS), matrix (M)), but it does not express functional M2 proteins, as well as HA and NA genes of influenza a/brisban/10/2007-like a/ilex/716/2007 (H3N 2). FM#6 virus is obtained from

Clone #6 of influenza a/uyerba/716/2007 (H3N 2) of formulation 2009-2010. 1x10 at 316. Mu.L dose ⁷ TCID ₅₀ (50% tissue culture infection dose), M2KO (ΔTM) virus and FM#6 virus were administered intranasally to animals.

B. Test and positive control dosage formulations: by mixing 120. Mu.L of 1X10 ⁹ TCID ₅₀ 1X10 per 316. Mu.L was prepared by diluting/mL into 3.680mL of PBS ⁷ TCID ₅₀ M2KO (. DELTA.TM.) virus administration solution per mL. By mixing 120. Mu.L of 1X10 ⁹ TCID ₅₀ 1X10 per 316. Mu.L was prepared by diluting/mL into 3.680mL of PBS ⁷ TCID ₅₀ FM#6 virus at/mL titer.

C. Animal and animal care: 36 male ferrets were purchased from Triple F farm and 30 ferrets were used for the study. At the start of the study, the animals were approximately 4 months of age. The animals were tested healthy by the supplier and were free of antibodies to infectious diseases. After arrival, the animals were individually housed in suspension wire cages with a slatted bottom, suspended above a waste tray of interleaving paper. Prior to receiving the animals, the animal houses and cages have been cleaned and sterilized according to accepted animal care practices and related standard operating procedures. Certified Teklad Global Ferret Diet #2072 (Teklad diabetes, madison Wis.) and Chicago city tap water were supplied ad libitum and updated at least 3 times per week. Fluorescent lighting in the animal house was maintained at a 12-hour light/dark cycle. During the course of the study, the animal room temperature and relative humidity were within the respective protocol limits and were in the range of 20.0-25.0 ℃ and 30-63%, respectively.

D. Animal isolation and randomization: ferrets were kept isolated for 7 days, then randomized and observed daily. Ferrets were released from quarantine for randomization and testing based on daily observations indicating overall good health of the animals. After isolation, ferrets were weighed and assigned to treatment groups based on body weight resulting in similar group averages using computerized randomization operations [

Version e.11 (PDS Pathology Data Systems, inc., basel, switzerland)]. Within a group, all body weights are within 20% of their average value. Animals selected for the study received a permanent identification number via the ear tag, and the transponder and respective cage card also identified the study animal via respective number and group. DispensingIs unique in the study.

E. Experiment design: to evaluate M2KO (ΔTM) vaccine efficacy, ferrets were immunized with M2KO (ΔTM) virus, cold-adapted live attenuated virus (FM#6), or with medium (OPTI-MEM) ^TM ) And (5) pseudo-immunization. Animal body weight, body temperature and clinical symptoms were monitored and the immunological response was assessed. 30 male ferrets (Triple F farm, sayr PA) at the beginning of the study, 4 months old, were used for the study. All animal manipulations were performed in either animal biosafety level-2 or biosafety level-3 devices according to protocols approved by the animal care and use committee at IIT Research Institute. Ferrets were monitored for 3 days prior to inoculation to measure body weight and establish a baseline body temperature. Temperature readings were recorded daily by subcutaneous implantation of a transponder (BioMedic data system, seaford, DE) in each ferret. Blood was collected prior to study initiation and serum was tested against influenza antibodies. Ferrets with only HAI (hemagglutination inhibition) titres 40 for a/brisban/10/2007 (H3N 2) were considered seronegative and were used in this study. Study animals were randomized and divided into 5 groups (6 ferrets/group) as shown in table 17. Group 2 (1) &3) Receiving M2KO (delta. TM) virus, group 2 (2&4) FM#6 virus was received. By OPTI-MEM ^TM Pseudo-immunization of one group (5). Within each vaccine group, ferrets were split into 2 vaccine regimens, 6 received challenge vaccination only (challenge only), 6 received challenge vaccination and booster vaccine 28 days after challenge vaccination (challenge/boost). Excitation/enhancement group: intranasal inoculation of ferrets with a single dose of 316 μl 1x10 on days 0 and 28 ⁷ TCID ₅₀ M2KO (delta. TM) virus of (E). Intranasal inoculation of 316. Mu.L 1X10 to the control group on days 0 and 28 ⁷ TCID ₅₀ FM#6 (same dose as M2KO (. DELTA.TM)) or sham 316. Mu.L OPTI-MEM ^TM . Ferret body temperature, weight and clinical symptoms were monitored daily to 14 days post inoculation. From all ferrets (including OPTI-MEM) at days 1, 3, 5, 7, 9 and 14 (for virus titration in cells) and at days 21 and 49 (for antibody titration) after challenge vaccination ^TM Control group) nasal washes were collected. Nasal wash samples were stored at-65 ℃. Blood was collected before inoculation (days-3 to-5) and days 7, 14, 21, 35, 42 and 49, andserum was stored at-65 ℃ until antibody titers were measured by ELISA and HI assays.

Only the excitation group: on day 28, ferrets were vaccinated intranasally with a single dose of 316 μl 1x10 ⁷ TCID ₅₀ M2KO (delta. TM) virus of (E). On day 28, the control group was inoculated intranasally with 316. Mu.L 1X10 ⁷ TCID ₅₀ FM#6 (same dose as M2KO (. DELTA.TM)) or sham 316. Mu.L OPTI-MEM ^TM . Ferret body temperature, weight and clinical symptoms were monitored daily until after 14 days of inoculation. Nasal washes were collected from all ferrets on days 29, 31, 33, 35, 37 and 42 (for virus titration in cells) and on day 49 (for antibody titration). Nasal wash samples were stored at-65 ℃. Blood was collected before inoculation (days 23-25) and on days 35, 42 and 49 and serum was stored at-65 ℃ until antibody titers were measured by ELISA and HAI assays. At 4 weeks after administration of challenge/booster vaccine, a dose of 316 μl of 1x10 at day 56 was used ⁷ TCID ₅₀ Wild type a/brisban/10/2007 (H3N 2) influenza virus attacks all ferrets. Ferret body weight, body temperature, and clinical symptoms were monitored to 14 days post challenge and nasal washes and organs were collected. On days 1, 3, 5, 7, 9 and 14 (days 57, 59, 61, 63, 65 and 70) after challenge, nasal washes were collected from challenged ferrets and samples were saved at-65 ℃ for virus titration in cells. On day 3 post challenge (day 59), animals (3 animals/group, 15 animals total) were euthanized and the following tissue samples were collected: nasal turbinates, trachea and lungs. One portion of the collected samples was fixed with buffered neutral formalin for histological evaluation, and the other portion of the samples was stored at-65 ℃ for virus titration. Blood was collected 14 days after challenge (day 70) and all surviving animals were euthanized.

Table 17: vaccination and sample collection program

¹ At 1x10 ⁷ TCID ₅₀ Intranasal inoculation of doses of (C)

² Only from challenge vaccinationIs collected from animals

³ Organs (turbinates, trachea and lungs) collected from 3 ferrets per group were used for histology and viral titers

F. Virus inoculation: ferrets are vaccinated with either M2KO (delta. TM) virus or FM#6influenza A virus. A bottle of frozen stock was thawed and diluted to the appropriate concentration in phosphate buffered saline solution. Ferrets were anesthetized with ketamine/ranolazine and virus doses were administered intranasally in volumes of 316 μl (for M2KO (Δtm) virus) and 316 μl (for FM #6 virus). To confirm the inoculation titer of M2KO (Δtm) and fm#6 viruses, aliquots of the administration solution were collected before administration (before administration) and after administration (after administration). Aliquots were stored at-65 ℃ for virus titration.

G. Attack virus: ferrets were challenged with influenza a virus, strain a/brisban/10/2007, serotype H3N 2. The virus was stored at about-65 ℃ prior to use. At 1x10 in a volume of 316. Mu.L ⁷ TCID ₅₀ Dose levels of challenge virus used were prepared. Quantitative virus infectivity assay was performed on a portion of the prepared virus challenge solution in IITRI, i.e., TCID ₅₀ And (5) measuring. Virus titer assays were performed according to IITRI standard procedure.

H. Moribund/mortality observations: after challenge, all animals were observed 2 times daily for evidence of mortality or moribund rate. Animals were observed to be 14 days post vaccination and 14 days post challenge.

I. Body weight and body weight changes: body weight was recorded within 2 days of receipt and at randomization. All study animals were weighed prior to inoculation, weighed daily to 14 days after each vaccination, and evaluated daily to 14 days after challenge. Ferrets were monitored 3-5 days prior to inoculation to measure established baseline body temperatures. Temperature readings were recorded daily by subcutaneously implanting a transponder (BioMedic data system, seaford, DE) in each ferret to 14 days after each vaccination and to 14 days after challenge. The change in temperature (in degrees celsius) was recorded for each animal at each time point.

J. Clinical observation: the change in temperature (in degrees celsius) was determined for each ferret every day. Clinical signs, loss of appetite, respiratory signs (such as dyspnea, sneeze, cough, and rhinorrhea) and activity levels were assessed daily. The activity level was assessed using a score based on that described by Reuman, et al, "Assessment of signs of influenza illness in the ferret model," J.Virol, methods 24:27-34 (1989), as follows: 0, alert and fun; 1, alert, but interesting only when stimulated; 2, alert, but not interesting when stimulated; and 3, neither alert nor fun when stimulated. The Relative Inactivity Index (RII) was calculated as the average score per observation (day) of each group of ferrets during the study.

K. Survival inspection: during the course of the study, all study animals were subjected to 2 survival checks per day. Two survival checks were performed simultaneously with clinical observations. A second check is performed later in the same day.

L. nasal wash: ferrets were anesthetized with a mixture of ketamine (25 mg/kg) and ranolazine (2 mg/kg), and 0.5ml of sterile PBS containing penicillin (100U/ml), streptomycin (100 μg/ml), and gentamicin (50 μg/ml) was injected into each nostril, and collected in sample cups when discharged from ferrets. Nasal washes were collected into frozen vials and the volume recovered was recorded.

M. euthanasia: study animals were euthanized by intravenous administration of 150mg/kg sodium pentobarbital. Death was confirmed by the absence of observable heart beat and respiration.

Necropsy: necropsy was performed by Charles River Laboratories, pathology Associates (PAI). The PAI team consisted of 1 supervised pathologist and 2 anatomies. Nasal turbinates, trachea and lungs were harvested. One portion of each tissue was fixed in formalin and the other portion was given IITRI bars for freezing and storage. The tissues harvested for titers were: the right nasal concha, the upper 1/3 of the trachea and the right cranial lobes.

O. histopathological analysis: after each necropsy, tissues were transported to the PAI Chicago device. After receiving, a portion of tissue from all 15 ferrets was embedded in paraffin blocks, sectioned at approximately 5-micron thickness, and stained with hematoxylin and eosin (H & E). All paraffin H & E sections were evaluated under a microscope.

Serum collection: pre-vaccination serum was collected from ferrets (days-3 to-5 for groups 3, 4 and 5; 23-25 for groups 1 and 2). Following inoculation, serum was collected from groups 3, 4 and 5 on days 7, 14, 21, 35, 42, 49 and 70. Serum was collected from groups 1 and 2 on days 35, 42, 49 and 70. Ferrets were anesthetized with a mixture of ketamine (25 mg/kg) and ranolazine (2 mg/kg). Blood samples (approximately 0.5-1.0 mL) were collected from each ferret via the vena cava and processed into serum. Blood was collected into a Serum Gel Z/1.1 tube (Sarstedt inc. Newton, NC) and stored at room temperature for no more than 1 hour, after which Serum was collected. The Serum Gel Z/1.1 tube was centrifuged at 10,000Xg for 3 minutes and Serum was collected.

Q. Hemagglutination Inhibition (HI) assay: serum samples were treated with Receptor Destroying Enzyme (RDE) (Denka Seiken, tokyo, japan) to eliminate non-specific inhibitors of hemagglutination. The RDE was reconstructed according to the manufacturer's instructions. Serum was diluted 1:3 in RDE and incubated in a 37.+ -. 2 ℃ water bath for 18-20 hours. After adding an equal volume of 2.5% (v/v) sodium citrate, the samples were incubated in a 56.+ -. 2 ℃ water bath for 30.+ -. 5 minutes. After RDE treatment, 0.85% nacl was added to each sample to a final serum dilution of 1:10. The diluted samples were then diluted in Phosphate Buffered Saline (PBS) in duplicate to 4 2-fold dilutions (1:10 to 1:80) and then incubated with 4 hemagglutination units of influenza a/brisbane/10/2007 (H3N 2) virus. After incubation, 0.5% avian red blood cells were added to each sample and incubated for 30±5 minutes. The presence or absence of hemagglutination is then scored.

R. viral titer: by TCID in Madin-Darby canine kidney (MDCK) cells ₅₀ The concentration of infectious virus in the virus inoculum samples before and after challenge was determined. Briefly, samples stored at-65 ℃ were thawed and centrifuged to remove cell debris. The resulting supernatant was diluted 10-fold in triplicate in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, carlsbad, calif., USA) containing penicillin/streptomycin, 0.1% gentamicin, 3% NaCO in 96-well microtiter plates ₃ 0.3% BSA fraction V (Sigma St. Louis, MO), 1%MEM vitamin solution (Sigma) and 1% l-glutamine (Mediatech, marassas, VA, USA). After preparation of 10-fold serial dilutions, 100 μl was transferred into individual wells of a 96-well plate containing a monolayer of MDCK cells. At 37 ℃ +/-2 ℃ and 5+/-2% CO ₂ Plates were incubated at 70% humidity. After 48 hours, the wells were observed for cytopathogenic effects (CPE). Supernatants (50 μl) from each well were transferred to 96-well plates and Hemagglutination (HA) activity was determined and recorded. The HA activity of the supernatant was assessed by HA assay using 0.5% packed turkey red blood cells (tRBC). TCID was calculated using the method of Reed LJ and Muench H, "A simple method for estimating% points," am. J. Hygine 27:493-497 (1938) ₅₀ Titer.

S, data analysis: the body weight and body weight gain (loss) and body temperature changes for each individual animal were determined and expressed as the mean and mean standard deviation for each test group.

Results

After intranasal vaccination with M2KO (Δtm) virus or fm#6 virus, ferrets were monitored daily for clinical signs of infection. Nasal washes were collected after challenge vaccination to monitor viral shedding, and serum was collected to measure serum antibody titers. The results are presented in tables 18A, 18B and 18C.

Table 18A: effects of vaccination on survival of ferrets and clinical signs of infection.

^a Hemagglutination Inhibition (HI) antibody titer against homologous virus in ferret serum prior to virus inoculation.

^b Clinical signs were observed 3 days after virus inoculation. In addition to sleepiness, findings of clinical signs are given as the number/total of ferrets with signs. Respiratory signs include sneezing.

^c The observations were made for 3 days based on a scoring system determined 2 times per day and calculated as the average score per group of ferrets per observation (day) over a 3-day period. Inoculation ofThe previous relative inactivity index was 0.

Table 18B: viral titers in ferret respiratory organs after challenge

Table 18C: mucosal IgA response in ferrets

All ferrets were vaccinated with M2KO (ΔTM) virus and FM#6 virus. After challenge vaccination, 2 ferrets vaccinated with M2KO (Δtm) virus exhibited respiratory signs (sneezes) on day 8. Following booster vaccination, ferrets vaccinated with fm#6 virus exhibited respiratory signs (sneezes) 7 days post vaccination. Also on OPTI-MEM on day 4 after fortification ^TM Sneezing was observed in ferrets. After challenge vaccination, ferrets vaccinated with M2KO (Δtm) virus and fm#6 virus had relative inactivity indices of 0.07 and 0.27, respectively. This decrease in activity was observed only in one group of each virus after challenge vaccination. No decrease in activity level was observed after booster vaccination. The changes in body weight and temperature after virus inoculation are shown in fig. 22 and 23. No weight loss was observed after vaccination; however, vaccination appears to have an effect on weight gain. Following vaccination, OPTI-MEM ^TM The body weight of control ferrets increased by 20% over the 14 day observation period, whereas the body weight gain of M2KO (Δtm) or FM #6 vaccinated ferrets ranged from 6-15% after challenge and 4-6% after boost. No increase in body temperature was observed in any group after vaccination. The changes in body weight and temperature after challenge are shown in fig. 24 and 25, and the clinical signs are summarized in table 19.

Table 19: effects of viral challenge on survival of ferrets and clinical signs of infection.

^a Clinical signs were observed 3 days after virus inoculation. In addition to sleepiness, findings of clinical signs are given as the number/total of ferrets with signs. Respiratory signs include sneezing.

^b The observations were made for 3 days based on a scoring system determined 2 times per day and calculated as the average score per group of ferrets per observation (day) over a 3-day period. The relative inactivity index before inoculation was 0.

Following challenge with A/Brisban/10/2007 (H3N 2), a 2-4% weight loss was observed in all animals on day 2 post challenge. During the 14 day observation period, the animal body weights remained below their initial weights. OPTI-MEM ^TM Ferrets lose the greatest weight (8%). Weight loss of vaccinated ferrets depends on the vaccine regimen. Ferrets receiving either M2KO (Δtm) or FM #6 challenge-only regimens were relieved by a maximum of 5% and 4%, respectively. Ferrets receiving the fortifier alleviate the following maxima: FM#6 group was 3% and M2KO (ΔTM) group was 2%. On day 2 in OPTI-MEM ^TM Ferret neutralization post-challenge hyperthermia was observed on day 1 in ferrets receiving either M2KO (Δtm) or FM #6 challenge-only regimens (fig. 25). The body temperature of ferrets receiving the fortifier remained within normal ranges.

To determine if vaccination would prevent replication of the challenge virus in the respiratory tract and alleviate organ pathology, the tissue of the challenged ferret was examined histologically on day 3 post-vaccination. Changes in the lungs of animals receiving M2KO (ΔTM) challenge or challenge/boost regimen alone versus OPTI-MEM ^TM An increase in the severity of mixed cell infiltration in the lungs of the group is associated. A slight difference in the incidence of lung infiltration was observed between the M2KO (Δtm) stimulated and M2KO (Δtm) stimulated/fortified groups. With OPTI-MEM ^TM An increase in the severity of mixed cell infiltration in the lungs was also observed in the FM #6 stimulated and FM #6 stimulated/fortified groups compared to the groups. A slight increase in the severity of lung mix cell infiltration was observed in the FM #6 challenged/fortified group relative to the FM #6 challenged group alone. In the turbinates, with OPTI-MEM ^TM In a group comparison the number of groups,animals receiving challenge or challenge/boosting with M2KO (Δtm) virus have a lower severity of respiratory epithelial atrophy. When the challenge group was compared to the challenge/boost M2KO (Δtm) group, there was no turbinate atrophy difference. A slight increase in the severity of respiratory epithelial atrophy was observed in animals receiving the FM #6 challenge/boost regimen relative to animals receiving the FM #6 challenge alone regimen; respiratory epithelial atrophy was lower in severity in all FM #6 animals than in OPTI-MEM ^TM The results observed in the group. With OPTI-MEM ^TM In the M2KO (ΔTM) challenge and challenge/boost groups there was a decrease in the incidence of neutrophilic infiltration into the nasal cavity (lumen) compared to the group. The neutrophilic luminal infiltration in M2KO (ΔTM) alone stimulated group was interpreted as compared to OPTI-MEM ^TM The groups are not different. With OPTI-MEM ^TM There was only a slight increase in severity of luminal neutrophil infiltration in the FM #6 boost and boost/boost groups compared to the group. The concentration of the virus administration solution before and after challenge was 10, respectively ⁷ .83TCID ₅₀ /mL and 10 ⁷ .25TCID ₅₀ /mL, indicating good stability of the challenge material in application.

FIG. 45 shows M2KO (ΔTM) and in the respiratory tract of ferrets

Viral replication.

FIG. 46 shows M2KO (. DELTA.TM.) and in nasal washes after intranasal challenge with A/Brisban/10/2007 (H3N 2) virus

Viral titer.

FIG. 47 shows the use of M2KO (ΔTM) alone and

IgG titers in ferrets after challenge group vaccination.

FIG. 48 shows the use of M2KO (. DELTA.TM) and

excitation-additionIgG titers in ferrets after the strong group vaccination.

FIG. 49 shows the use of M2KO (ΔTM) or

Summary of ELISA IgG titers in ferret serum after vaccination to challenge.

Conclusion(s)

This example shows that intranasal administration of M2KO (Δtm) virus is not associated with any vaccine-related adverse events (elevated body temperature, weight loss, or clinical signs). These results indicate that the M2KO (delta. TM) virus of the present technology can be used in intranasal influenza vaccines.

Example 12: m2KO (delta. TM) virus was not transmitted in ferret model

Summary-this example demonstrates that the M2KO (Δtm) virus is not transmitted in the ferret model. At 1x10 ⁷ TCID ₅₀ Is administered intranasally to 3 female ferrets with M2KO (Δtm) virus. As a control, 1x10 ⁷ TCID ₅₀ Is administered intranasally to a second group of 3 female ferrets a/brisban/10/2007 (H3N 2) virus. 24 hours after inoculation, each donor ferret was introduced into a transmission chamber with 2 raw ferrets (direct contact and aerosol contact). After inoculation, ferrets were observed for mortality to 14 days post inoculation, with daily measurements of body weight, body temperature and clinical signs. Nasal washes were collected from all vaccinated donor ferrets (on days 1, 3, 5, 7, 9) and from all contact (direct and aerosol) ferrets (on days 2, 4, 6, 8, 10) to see shedding of virus. At study inoculation (day 14), nasal washes and serum were collected from all ferrets to assess antibody levels. No clinical signs of infection were observed in the M2KO (Δtm) group; however, ferrets in the a/brisban/10/2007 (H3N 2) group have reduced weight, increased body temperature, and sneeze. After inoculation with brisban/10, donor ferrets showed an increase in body temperature 2 days after challenge and weight loss. The level of activity in any group was not reduced. Ferrets in direct contact with donor ferrets showed a progressive weight gain before day 4 post inoculation. Starting from day 6 after inoculation, at aerosol contact Similar trends were observed in ferrets. Weight loss in contact with ferrets is associated with increased body temperature. Inoculation with M2KO (Δtm) virus did not cause clinical signs of infection in the vaccinated animals. Transmission to contact ferrets is unlikely.

Materials and methods

A. Vaccine material: the M2KO (ΔTM) virus is a recombinant virus as follows: it HAs the internal 6 genes of PR8 (nucleoprotein (NP), polymerase genes (PA, PB1, PB 2), non-structural (NS), matrix (M)), but it does not express functional M2 proteins, as well as HA and NA genes of influenza a/brisban/10/2007-like a/ilex/716/2007 (H3N 2). 1x10 at 316. Mu.L dose ⁷ TCID ₅₀ (50% tissue culture infection dose), M2KO (ΔTM) virus was administered intranasally to animals.

B. Test dose formulation: by combining 1x10 of 45 ⁹ TCID ₅₀ diluting/mL into 1.377mL PBS, preparing 1X10 per 316. Mu.L ⁷ TCID ₅₀ M2KO (. DELTA.TM.) virus administration solution per mL.

C. Animal and animal care: 22 female ferrets were purchased from Triple F farm and 18 ferrets were used for the study. At the start of the study, the animals were approximately 4 months of age. The animals were tested healthy by the supplier and were free of antibodies to infectious diseases. After arrival, the animals were individually housed in suspension wire cages with a slatted bottom, suspended above a waste tray of interleaving paper. Prior to receiving the animals, the animal houses and cages have been cleaned and sterilized according to accepted animal care practices and related standard operating procedures. Certified Teklad Global Ferret Diet #2072 (Teklad diabetes, madison Wis.) and Chicago city tap water were supplied ad libitum and updated at least 1 time per day. Fluorescent lighting in the animal house was maintained at a 12-hour light/dark cycle. During the course of the study, the animal room temperature and relative humidity were within the respective protocol limits and were in the range of 23.0-25.0 ℃ and 36-50%, respectively.

D. Animal isolation and randomization: ferrets were kept isolated for 7 days, then randomized and observed daily. Ferrets were released from quarantine for randomization and testing based on daily observations indicating overall good health of the animals. Partition boardAfter this time, ferrets were weighed and assigned to treatment groups [ Tox ] using computerized randomization operations based on body weight yielding similar group averages

Version e.11 (PDS Pathology Data Systems, inc., basel, switzerland)]. Within a group, all body weights are within 20% of their average value. Animals selected for the study received a permanent identification number via the ear tag, and the transponder and respective cage card also identified the study animal via respective number and group. The assigned authentication number is unique in the study.

E. Experiment design: to evaluate transmissibility of M2KO (ΔTM) virus, ferrets were vaccinated with either M2KO (ΔTM) virus or A/Brisbane/10/2007 (H3N 2) virus. Animal body weight, body temperature, clinical symptoms and viral shedding were monitored and the immunological response was assessed. 18 female ferrets (Triple F farm, sayr PA) at the beginning of the study, 4 months of age, were used for the study. All animal manipulations were performed in either animal biosafety level-2 or level 3 devices. Ferrets were monitored for 3 days prior to inoculation to measure body weight and establish a baseline body temperature. Temperature readings were recorded daily by subcutaneous implantation of a transponder (BioMedic data system, seaford, DE) in each ferret. Blood was collected prior to study initiation and serum was tested for influenza antibodies. Ferrets with only HI titers of 40 against a/brisbane/10/2007 (H3N 2) virus were considered seronegative and were used in this study. Study animals were randomized and divided into 2 groups (9 ferrets/group, 3/transmission chamber) as shown in table 20. Ferrets (chambers A-C) in designated group 1 received M2KO (ΔTM) virus. Ferrets (Chambers A-C) in designated group 2 received A/Brisbane/10/2007 (H3N 2) virus. Within each group, ferrets were divided into vaccinated donors or primary contacts.

TABLE 20 study design

¹ Each chamber consisted of 3 female ferrets: 1 subject toInfected donor ferrets and 2 naive ferrets (1 direct contact and 1 aerosol contact).

² Intranasal inoculation of a single dose of 316 μl 1x10 ⁷ M2KO or 1x10 of TCID50 ⁷ TCID ₅₀ Is a/brisban/10/2007 (H3N 2) virus.

Each group was housed in a separate room and the individuals operating the animals followed a strict workflow pattern to prevent cross-contamination between the two groups. In each group, 1 donor ferrets were intranasally vaccinated with a single dose of 316 μl 1×10 ⁷ TCID ₅₀ M2KO (ΔTM) (group 1) or 1x10 ⁷ TCID ₅₀ (B) A/Brisban/10/2007 (H3N 2) virus (group 2). 24 hours after inoculation, each donor was placed in the same cage containing 1 naive ferret (direct contact) and double-housed in silk cages. Another ferret (aerosol contact) was placed into a separate adjacent wire cage (single containment) within the propagation chamber, which was spaced from the cage of the donor by a distance of 10-12 cm. Ferret body temperature, weight and clinical symptoms were monitored daily to 14 days post inoculation. Nasal washes were collected from all vaccinated donor ferrets (on days 1, 3, 5, 7, 9) and from all contact (direct and aerosol) ferrets (on days 2, 4, 6, 8, 10) for virus titration in cells. Nasal washes were collected from all ferrets on day 14 for antibody titration. Nasal wash samples were stored at-65 ℃.

F. Propagation chamber: each propagation chamber is 2 cubic meters. HEPA filtration is performed using a computerized air handling unit and environmental conditions within the propagation chamber are monitored and controlled. To provide a directed flow of air, HEPA-filtered air is fed through an inlet at one end of the chamber and exits through an outlet at the opposite end of the chamber, filtered with HEPA, and discharged into the chamber. The air exchange rate was 20 complete air changes per hour per chamber, maintaining an air flow of <0.1 m/sec. The chamber was maintained at negative pressure of-0.15 inches of water. Ferrets were housed in wire cages with a slatted bottom, suspended above a waste tray of interleaving paper. Ferrets were double-housed in 32x24x14 cages or single-housed in 24x24x14 wire cages placed within each HEPA-filtered propagation chamber.

G. Virus inoculation: ferrets are vaccinated with M2KO (delta. TM) virus. 1 bottle of frozen stock was thawed and diluted to the appropriate concentration in phosphate buffered saline solution. Ferrets were anesthetized with ketamine/xylazine and M2KO (ΔTM) virus doses were administered intranasally in a volume of 316 μl. To confirm the inoculation titer of the M2KO (Δtm) virus, aliquots of the administration solution were collected before (pre) and after (post) dosing. Aliquots were stored at 65 ℃ for virus titration.

H. Attack virus: control ferrets were vaccinated with influenza a virus strain a/brisban/10/2007 serotype H3N 2. The virus was stored at about-65 ℃ prior to use. At 1x10 in a volume of 316. Mu.L ⁷ TCID ₅₀ Dose levels of challenge virus used were prepared. Quantitative virus infectivity assay of a portion of the prepared virus challenge solution, TCID, was performed in IITRI ₅₀ And (5) measuring. Virus titer assays were performed according to IITRI standard procedure.

I. Moribund/mortality observations: after challenge, all animals were observed 2 times daily for evidence of mortality or moribund rate. Animals were observed to be 14 days post vaccination and 14 days post challenge.

J. Body weight and body weight changes: body weight was recorded within 2 days of receipt and at randomization. All study animals were weighed prior to inoculation, weighed daily to 14 days after each vaccination, and evaluated daily to 14 days after challenge. Ferrets were monitored 3-5 days prior to inoculation to measure established baseline body temperatures. Temperature readings were recorded daily by subcutaneously implanting a transponder (BioMedic data system, seaford, DE) in each ferret to 14 days after each vaccination and to 14 days after challenge. The change in temperature (in degrees celsius) was calculated for each animal at each time point.

K. Clinical observation: the temperature change (in degrees celsius) of each ferret was determined daily. Clinical signs, loss of appetite, respiratory signs (such as dyspnea, sneeze, cough, and rhinorrhea) and activity levels were assessed daily. The activity level was assessed using a score based on that described by Reuman, et al, "Assessment of signs of influenza illness in the ferret model," J.Virol, methods 24:27-34 (1989), as follows: 0, alert and fun; 1, alert, but interesting only when stimulated; 2, alert, but not interesting when stimulated; and 3, neither alert nor fun when stimulated. The Relative Inactivity Index (RII) was calculated as the average score per observation (day) of each group of ferrets during the study.

L. survival check: during the course of the study, all study animals were subjected to 2 survival checks per day. Two survival checks were performed simultaneously with clinical observations. A second check is performed later in the same day.

M. nasal wash: ferrets were anesthetized with a mixture of ketamine (25 mg/kg) and ranolazine (2 mg/kg), and 0.5ml of sterile PBS containing penicillin (100U/ml), streptomycin (100 μg/ml), and gentamicin (50 μg/ml) was injected into each nostril, and collected in sample cups when discharged from ferrets.

N. euthanasia: study animals were euthanized by intravenous administration of 150mg/kg sodium pentobarbital. Death was confirmed by the absence of observable heart beat and respiration. Necropsy was performed on all study animals.

Serum collection: pre-vaccination serum (day-3 to-5) and post-vaccination serum (day 14) were collected from all ferrets. Ferrets were anesthetized with a mixture of ketamine (25 mg/kg) and ranolazine (2 mg/kg). Blood samples (approximately 0.5-1.0 mL) were collected from each ferret via the vena cava and processed into serum. Blood was collected into a Serum Gel Z/1.1 tube (Sarstedt inc. Newton, NC) and stored at room temperature for no more than 1 hour, after which Serum was collected. The Serum Gel Z/1.1 tube was centrifuged at 10,000Xg for 3 minutes and Serum was collected. A single pre-inoculation serum sample was collected and 2 aliquots were prepared from each sample. 1 aliquot was tested prior to study initiation to confirm that ferrets did not contain antibodies to influenza a virus, and 1 aliquot of serum was stored at-65 ℃.

P. Hemagglutination Inhibition (HI) assay: serum samples were treated with Receptor Destroying Enzyme (RDE) (Denka Seiken, tokyo, japan) to eliminate non-specific inhibitors of hemagglutination. The RDE was reconstructed according to the manufacturer's instructions. Serum was diluted 1:3 in RDE and incubated in a 37.+ -. 2 ℃ water bath for 18-20 hours. After adding an equal volume of 2.5% (v/v) sodium citrate, the samples were incubated in a 56.+ -. 2 ℃ water bath for 30.+ -. 5 minutes. After RDE treatment, 0.85% nacl was added to each sample to a final serum dilution of 1:10. The diluted samples were then diluted in Phosphate Buffered Saline (PBS) in duplicate to 4 2-fold dilutions (1:10 to 1:80) and then incubated with 4 hemagglutination units of influenza a/brisbane/10/2007 (H3N 2) virus. After incubation, 0.5% avian red blood cells were added to each sample and incubated for 30±5 minutes. The presence or absence of hemagglutination is then scored.

Viral titer: by TCID in Madin-Darby canine kidney (MDCK) cells ₅₀ The concentration of infectious virus in the virus inoculum samples before and after challenge is determined. Briefly, samples stored at-65 ℃ were thawed and centrifuged to remove cell debris. The resulting supernatant was diluted 10-fold in triplicate in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, carlsbad, calif., USA) containing penicillin/streptomycin, 0.1% gentamicin, 3% NaCO in 96-well microtiter plates ₃ 0.3% BSA fraction V (Sigma St. Louis, MO), 1% MEM vitamin solution (Sigma) and 1% L-glutamine (Meditech, marassas, va., USA). After preparation of 10-fold serial dilutions, 1OOflL was transferred into individual wells of a 96-well plate containing a monolayer of MDCK cells. At 37 ℃ +/-2 ℃ and 5+/-2% CO ₂ Plates were incubated at 70% humidity. After 48 hours, the wells were observed for cytopathogenic effects (CPE). Supernatants (50 μl) from each well were transferred to 96-well plates and Hemagglutination (HA) activity was determined and recorded. The HA activity of the supernatant was assessed by HA assay using 0.5% packed turkey red blood cells (tRBC). TCID was calculated using the method of Reed LJ and Muench H, "A simple method for estimating% points," am. J. Hygine 27:493-497 (1938) ₅₀ Titer.

And R, data analysis: the body weight and body weight gain (loss) and body temperature changes for each individual animal were determined and expressed as the mean and mean standard deviation for each test group.

Results

After inoculating the donor ferret with M2KO (Δtm) virus or influenza a/brisban/10/2007 (H3N 2) virus, the donor ferret is introduced into a transmission chamber containing the original contact ferret. The ferret was monitored daily for clinical signs of infection, nasal washes were collected to monitor viral shedding, and serum was collected to measure serum antibody titers. All ferrets were vaccinated with M2KO (ΔTM) virus and A/Brisbane/10/2007 (Table 21). No clinical signs of disease were observed in ferrets in the M2KO (Δtm) group. 2 of 3 donor ferrets vaccinated with A/Brisbane/10/2007 virus exhibited respiratory signs (sneezes) on days 6 and 8. Direct contact ferrets in all chambers presented sneezes on day 8. No sneezing was observed in aerosol exposure to ferrets. No decrease in activity level was observed.

Table 21: clinical signs in vaccinated donor ferrets and contact ferrets.

^a Hemagglutination Inhibition (HI) antibody titers against homologous viruses in ferret serum prior to virus inoculation.

^b Clinical signs were observed until 14 days after virus inoculation. In addition to sleepiness, findings of clinical signs are given as the number/total of ferrets with signs. Respiratory symptoms are sneezes, with the days of onset of each ferret in brackets.

^c Based on the scoring system, it was determined 2 times per day, observations were continued for 14 days, and calculated as the average score for each group of ferrets per observation (day) over a 14-day period. The relative inactivity index before inoculation was 0.

The changes in body weight and temperature after virus inoculation are shown in fig. 26 and 27. No significant weight loss was observed after inoculation with M2KO (Δtm) virus. The average weight loss for aerosol contact was 1%; however, this is not likely due to exposure to the virus. During the 14 day observation period, the weight gain of M2KO (ΔTM) viral ferrets was 9% (for donor ferrets) and 10-11% (for contact ferrets) (FIG. 26A). Weight gain of A/Brisban/10/2007 was only 3% (for donor ferrets) and 6-8% (for grafting)Ferret) to indicate a viral infection (fig. 26B). In the M2KO (ΔTM) group, body temperature remained within normal levels except for day 3 post-infection (FIG. 27A). The body temperature is lower than the normal value of aerosol contact ferret. This is due to defective or failed temperature transponders, which are recorded in the normal range in other parts of the study. Hyperthermia was observed on day 2 and for aerosol contact on day 7 in a/brisban/10/2007 donor ferrets (fig. 27B). The concentration of the virus administration solution before and after challenge was 10, respectively ^7.50 TCID ₅₀ /mL and 10 ^7.25 TCID ₅₀ /mL, indicating good stability of the challenge material during application.

Figure 50 shows the viral titres in nasal washes from ferrets in a viral transmission study. The data show that M2KO (ΔTM) virus was not transmitted (no virus detected), whereas control Brisb/10 virus was transmitted.

Conclusion(s)

This example shows that ferrets vaccinated with A/Brisban/10/2007 virus showed clinical signs of infection (sneeze, weight loss and transient body temperature rise), whereas ferrets vaccinated with M2KO (ΔTM) virus did not show clinical signs of disease. Thus, inoculation of donor ferrets with M2KO (Δtm) does not appear to cause infection or transmission of the virus via contact or via aerosol. These findings indicate that the M2KO (Δtm) virus of the present technology can be used in intranasal influenza vaccines.

Example 13M 2KO (delta. TM) virus elicits humoral and mucosal immune responses in mice.

This example demonstrates that M2KO (ΔTM) virus causes humoral and mucosal immune responses in mice. M2KO (Δtm) immunogenicity was evaluated in mice and compared to immune responses generated by other vaccination patterns. As shown in table 22, an immunogenicity study was performed containing the following groups: m2KO (ΔTM) virus, 2.PR8 virus (10 pfu), representative live vaccine, 3. Inactivated PR8 virus (Charles River Laboratories, wilmington, mass.), 1 μg, intranasal (IN), 4. Inactivated PR8 virus, 1 μg, intramuscular (IM), or PBS only.

Table 22: vaccine group in immunogenicity studies

Immunogens	Delivery route	Dosage of	Principle of
				M2KO (delta. TM) virus	Intranasal administration	1x10 4 pfu	Comprising a mutation of M2KO (. DELTA.TM) (SEQ ID NO: 1)
PR8 virus	Intranasal administration	10pfu	Representing an immune response associated with a naturally occurring infection and/or live influenza vaccine
				Inactivated PR8, whole virus	Intranasal administration	1μg	Confirming baseline response by intranasally delivered killed influenza virus
Inactivated PR8, whole virus	Intramuscular injection	1μg	Standard delivery route for traditional inactivated influenza vaccines

To test the immunogenicity of the M2KO (ΔTM) virus, mice were vaccinated intranasally with 1.2x10 along with a group of 1 μg of inactivated whole PR8 administered intramuscularly ⁴ pfu M2KO (. DELTA.TM.), 10pfu wild-type PR8, 1 μg inactivated whole PR8 (Charles River Laboratories, wilmington, mass.) or PBS as a control. Serum and tracheal-lung washes were collected from mice 3 weeks after immunization, and anti-PR 8 immunoglobulin G (IgG) and IgA levels were measured by enzyme-linked immunosorbent assay (ELISA). Briefly, ELISA plates were coated with inactivated whole PR8, blocked with Bovine Serum Albumin (BSA), and samples were applied. Mouse IgG and IgA antibodies were detected with horseradish peroxidase-labeled anti-mouse IgG-and IgA-goat antibodies (KPL, inc., gaithersburg, MD) and surebue TMB (KPL, inc.) substrates.

As expected, mice in the immunized group exhibited a significant increase in anti-PR 8 antibodies in the serum and tracheal-lung washes compared to PBS only group (fig. 28). The serum anti-PR 8IgG levels were higher in the M2KO (. DELTA.TM.) virus group than in the inactivated PR8 group and were similar to the live PR8 virus. More importantly, anti-PR 8IgA antibodies were present only in serum and tracheal-lung washes of PR8 and M2KO (. DELTA.TM.) immunized mice. These data suggest that M2KO (Δtm) virus can elicit significant humoral and mucosal immune responses in mice.

EXAMPLE 14M 2KO (delta. TM) Virus protects mice from lethal subtype and heterosubtype attacks.

This example demonstrates that M2KO (ΔTM) virus protects mice from lethal subtype and heterosubtype attacks. The protective efficacy of M2KO (delta. TM) virus was evaluated by challenge of immunized mice with either a lethal dose of wild-type PR8 (H1N 1; isotype challenge) or mouse-adapted influenza A/Aichi/2/68 (Aichi; H3N2; heterosubtype challenge) 6 weeks after immunization. Mice immunized with M2KO (Δtm) or 10pfu of PR8 and subsequently challenged with wild-type PR8 did not show any clinical symptoms, including weight loss (fig. 29A). In contrast, naive PBS mice died or were euthanized due to greater than 20% weight loss by day 5. On day 3 post challenge, by in MDCK cells TCID ₅₀ The assay determines viral replication in the respiratory tract of challenged mice. As shown in FIG. 30A, no virus was detected in the lungs of M2KO (. DELTA.TM.) or PR8 immunized mice (limit of detection 10 ^2.75 TCID ₅₀ Organ) to indicate that M2KO (Δtm) would provide a similar sterile immunity to PR8 infection. In contrast, the challenge virus was recovered from the inactivated PR8 and PBS groups.

For the heterosubtype challenge, mice were challenged with aici (H3N 2). Mice immunized with M2KO (Δtm) and wild-type PR8 were challenged, whereas mice receiving inactivated PR8 or PBS were infected (fig. 29). The viral titers in the respiratory tract of the mice at day 3 post challenge in M2KO (Δtm) -vaccinated mice did not show a significant decrease compared to mice in the other groups (fig. 30). These results suggest that the cross-protection observed against the aici challenge can be due in part to the T-cell mediated immune response induced by the M2KO (Δtm) vaccine. In post-challenge sera from challenged mice, hemagglutination Inhibition (HI) antibodies against aici were not detectable (less than 1:40), suggesting that protection was not mediated by neutralizing antibodies.

M2KO (Δtm) virus stimulates humoral and cellular immune responses and confers protective immunity to animals against fatal isotype and heterosubtype challenge, as shown in table 23.

TABLE 23 protection after influenza challenge with subtype (H1N 1) and subtype (H3N 2)

Example 15 relative to

And

m2KO (delta. TM) vaccine of (E)

This example demonstrates that M2KO (ΔTM) virus is compared to live attenuated virus

)、

Efficacy of inactivated influenza vaccine. Live attenuated virus (++) cold-adapted with M2KO (ΔTM) virus>

)、

Mice were immunized with inactivated influenza vaccine or sham immunized with PBS. M2KO (delta. TM) -H3 virus was constructed by inserting the HA and NA coding sequences of influenza A/Brisban/10/2007-like A/Uyghur/716/2007 (H3N 2) into the M2KO (delta. TM.) backbone (SEQ ID NO: 1). Plaque purification from 2009/2010 trivalent vaccine formulation->

I.e., internal genes from the cold-adapted A/AA/6/60 backbone, which contain the HA and NA genes of influenza A/Brisban/10/2007-like A/Uyerba/716/2007 (H3N 2). Will->

The 2009/2010 formulation was used directly as a trivalent formulation.

Serum was obtained at days 7, 14, 21 post immunization to compare the kinetics of antibody responses by ELISA (fig. 31). Ratio of M2KO (. DELTA.TM) -H3 virus (a replication defective virus)

(live influenza virus vaccine that underwent multicyclic replication in an attenuated manner) formed antibodies earlier. Inactivated vaccine->

Has the highest serum antibody titer because it is a concentrated presentation of antigen.

Evaluation of anti-HA mucosal antibodies in serum, lung washes and turbinates by ELISAExists. Vaccine and inactivation

In contrast, M2KO (. DELTA.TM) -H3 and +.>

(two live influenza vaccines) have higher IgA in the respiratory tract (FIG. 32)>

Example 16: comparison of protection and immunogenicity caused by live virus.

10 on days 0 and 28 ⁶ TCID ₅₀ 50 mu l M KO (. DELTA.TM) -H3 (above),

(2009-2010) (H3N 2) IVR-147 (PR 8x brisban/10/2007) intranasal infection of 6 week old female BALB/c mice (anesthetized with isoflurane). IVR-147 is the wild-type form of the M2KO (ΔTM) virus; i.e. containing a functional M2 protein. Sham infected control mice received 50 μl PBS instead of virus. Serum was collected weekly from all mice and analyzed for the presence of anti-HA antibodies by ELISA. As shown in FIG. 33, with->

In contrast, M2KO (ΔTM) virus and IVR-147 produced higher antibody levels with rapid kinetics.

Animals were monitored for body weight to 14 days post infection. The vaccinated mice did not lose any weight. On day 21 post-boost, 3 mice per group were euthanized and their tracheal-lung washes, nasal washes and serum were collected for antibody titer determination (fig. 34A-34C). M2KO (delta. TM) induces body fluids and mucosal antibodies into the serum and respiratory tract

At a level similar to IVR-147.

At 6 weeks post-fortification, 40MLD was used ₅₀ The A/Aichi/2/68 virus of (E) challenged mice intranasally. Mice were observed for weight loss and survival for 14 days (fig. 35A-35B). M2KO (delta. TM) is ensuredProtecting mice against fatal Aichi attacks, e.g. against

Less weight loss (group a) and 100% survival (group B) were indicated. On day 3 post challenge, 3 mice per group were euthanized and their lungs and turbinates were collected for virus titer determination (table 24). M2KO (ΔTM) ratio->

Better control of the attacking virus is shown in table 24.

Table 24 challenge virus titers in the respiratory tract.

Example 17: preparation of M2KO (delta. TM) vaccine against highly pathogenic avian H5n1 influenza virus

Summary: m2KO (ΔTM) is an influenza virus lacking expression of a functional M2 protein. The M2 protein is critical for influenza virus infection initiation and for efficient integration of viral RNA into progeny virions. M2KO (ΔTM) can enter cells and express viral proteins, but infectious progeny viruses cannot be prepared due to deletion of the M2 gene. M2KO (Δtm) is produced in licensed M2 protein expressing cells, but not in unlicensed wild-type cells. M2KO (Δtm) will elicit mucosal and humoral immunity in mice and protect against isotype and heterosubtype lethal attacks.

H5N 1M 2KO (ΔTM) virus contains the HA (avirulence) and NA genes of A/Vietnam/1203/2004 in the M2KO (ΔTM) backbone. "M2KO (ΔTM) backbone" refers to PR8 sequences comprising a mutation of M2KO (ΔTM) (SEQ ID NO: 1). The A/Vietnam/1203/2004 HA (non-toxic) (SEQ ID NO: 24) and NA (SEQ ID NO: 25) sequences used are shown below.

Non-toxic VN1203 HA ORF+PR8 non-coding

AGCAAAAGCAGGGGAAAATAAAAACAACCAAAATGGAGAAAATAGTGCTTCTTTTTGCAATAGTCAGTCTTGTTAAAAGTGATCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACACAATAATGGAAAAGAACGTTACTGTTACACATGCCCAAGACATACTGGAAAAGAAACACAACGGGAAGCTCTGCGATCTAGATGGAGTGAAGCCTCTAATTTTGAGAGATTGTAGCGTAGCTGGATGGCTCCTCGGAAACCCAATGTGTGACGAATTCATCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGGCCAATCCAGTCAATGACCTCTGTTACCCAGGGGATTTCAATGACTATGAAGAATTGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCCCCAAAAGTTCTTGGTCCAGTCATGAAGCCTCATTAGGGGTGAGCTCAGCATGTCCATACCAGGGAAAGTCCTCCTTTTTCAGAAATGTGGTATGGCTTATCAAAAAGAACAGTACATACCCAACAATAAAGAGGAGCTACAATAATACCAACCAAGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCTAATGATGCGGCAGAGCAGACAAAGCTCTATCAAAACCCAACCACCTATATTTCCGTTGGGACATCAACACTAAACCAGAGATTGGTACCAAGAATAGCTACTAGATCCAAAGTAAACGGGCAAAGTGGAAGGATGGAGTTCTTCTGGACAATTTTAAAGCCGAATGATGCAATCAACTTCGAGAGTAATGGAAATTTCATTGCTCCAGAATATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTGAATTGGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAATGGGGGCGATAAACTCTAGCATGCCATTCCACAATATACACCCTCTCACCATTGGGGAATGCCCCAAATATGTGAAATCAAACAGATTAGTCCTTGCGACTGGGCTCAGAAATAGCCCTCAAAGAGAGACTAGAGGATTATTTGGAGCTATAGCAGGTTTTATAGAGGGAGGATGGCAGGGAATGGTAGATGGTTGGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGGTACGCTGCAGACAAAGAATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAACTCGATCATTGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGAATTTAACAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAGATGGAAGACGGGTTCCTAGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAATGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGACAAGGTCCGACTACAGCTTAGGGATAATGCAAAGGAGCTGGGTAACGGTTGTTTCGAGTTCTATCATAAATGTGATAATGAATGTATGGAAAGTGTAAGAAATGGAACGTATGACTACCCGCAGTATTCAGAAGAAGCGAGACTAAAAAGAGAGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAATTTACCAAATACTGTCAATTTATTCTACAGTGGCGAGTTCCCTAGCACTGGCAATCATGGTAGCTGGTCTATCCTTATGGATGTGCTCCAATGGGTCGTTACAATGCAGAATTTGCATTTAAGATTAGAATTTCAGAGATATGAGGAAAAACACCCTTGTTTCTACT

VN1203 NA ORF+PR8 non-coding

AGCAAAAGCAGGGGTTTAAAATGAATCCAAATCAGAAGATAATAACCATCGGATCAATCTGTATGGTAACTGGAATAGTTAGCTTAATGTTACAAATTGGGAACATGATCTCAATATGGGTCAGTCATTCAATTCACACAGGGAATCAACACCAATCTGAACCAATCAGCAATACTAATTTTCTTACTGAGAAAGCTGTGGCTTCAGTAAAATTAGCGGGCAATTCATCTCTTTGCCCCATTAACGGATGGGCTGTATACAGTAAGGACAACAGTATAAGGATCGGTTCCAAGGGGGATGTGTTTGTTATAAGAGAGCCGTTCATCTCATGCTCCCACTTGGAATGCAGAACTTTCTTTTTGACTCAGGGAGCCTTGCTGAATGACAAGCACTCCAATGGGACTGTCAAAGACAGAAGCCCTCACAGAACATTAATGAGTTGTCCTGTGGGTGAGGCTCCCTCCCCATATAACTCAAGGTTTGAGTCTGTTGCTTGGTCAGCAAGTGCTTGCCATGATGGCACCAGTTGGTTGACGATTGGAATTTCTGGCCCAGACAATGGGGCTGTGGCTGTATTGAAATACAATGGCATAATAACAGACACTATCAAGAGTTGGAGGAACAACATACTGAGAACTCAAGAGTCTGAATGTGCATGTGTAAATGGCTCTTGCTTTACTGTAATGACTGACGGACCAAGTAATGGTCAGGCATCACATAAGATCTTCAAAATGGAAAAAGGGAAAGTGGTTAAATCAGTCGAATTGGATGCTCCTAATTATCACTATGAGGAATGCTCCTGTTATCCTAATGCCGGAGAAATCACATGTGTGTGCAGGGATAATTGGCATGGCTCAAATCGGCCATGGGTATCTTTCAATCAAAATTTGGAGTATCAAATAGGATATATATGCAGTGGAGTTTTCGGAGACAATCCACGCCCCAATGATGGAACAGGTAGTTGTGGTCCGGTGTCCTCTAACGGGGCATATGGGGTAAAAGGGTTTTCATTTAAATACGGCAATGGTGTCTGGATCGGGAGAACCAAAAGCACTAATTCCAGGAGCGGCTTTGAAATGATTTGGGATCCAAATGGGTGGACTGAAACGGACAGTAGCTTTTCAGTGAAACAAGATATCGTAGCAATAACTGATTGGTCAGGATATAGCGGGAGTTTTGTCCAGCATCCAGAACTGACAGGACTAGATTGCATAAGACCTTGTTTCTGGGTTGAGTTGATCAGAGGGCGGCCCAAAGAGAGCACAATTTGGACTAGTGGGAGCAGCATATCTTTTTGTGGTGTAAATAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCCGAGTTGCCATTCACCATTGACAAGTAGTCTGTTCAAAAAACTCCTTGTTTCTACT

Preparation of H5N 1M 2KO (ΔTM): based on the CDC sequence of each gene (CDC ID:2004706280, accession numbers: EF541467 and EF 541403), by

Gene Synthesis to chemically synthesize A/Vietnam/1203/2004 (H5N 1) nontoxic HA and NA. The sequence of the construct was confirmed and subcloned into the appropriate vector to allow seed virus preparation using standard protocols.

M2KO (. DELTA.TM.) VN1203avHA, NA (H5N 1M 2KO (. DELTA.TM)) virus was amplified in M2CK cells (MDCK cells stably expressing M2 protein), and the supernatant was freed from cell debris and concentrated 100-fold by Centricon Plus-70 (Millipore). The virus was used as an immunogen in the mouse study.

Mouse study design: mice (7-8 week old, female BALB/c) were inoculated intranasally with H5N 1M 2KO (. DELTA.TM) (10) ⁶ TCID ₅₀ /smallMouse), M2KO (. DELTA.TM.) CA07HA, NA (10) ⁶ TCID ₅₀ Mice), or intramuscularly administered VN1203 protein (1.5 μg). Body weight and clinical symptoms were observed until 14 days post inoculation. Serum was collected at days 7, 14, 21 post inoculation. Mice were boosted on day 28 with a new challenge group started at the same time.

Boost and 'challenge only' groups: on day 28, use 10 ⁶ The second immunization of pfu/mice boosted mice previously vaccinated with H5N1M2KO (. DELTA.TM.). At the same time, the 'challenge only' groups were given their first dose. After inoculation on day 28, weight loss was tracked for all groups. Mice receiving a booster dose of M2KO (Δtm) vaccine lost up to 5% of their body weight. The 'boost only' group reduced their body weight by up to 10%.

TABLE 25 vaccine groups in mouse studies

H5N1M2KO (Δtm) causes IgG antibody titers against HA: serum was obtained from mice on days 7, 14, 21 post inoculation and analyzed for antibodies to hemagglutinin by ELISA. M2KO (ΔTM) produced at least 100-fold higher titers than H5HA protein (FIG. 36). Mice were boosted on day 28 and serum was obtained after 1 week (day 35). M2KO (ΔTM) titer was 130-fold enhanced, while HA protein was only 13-fold enhanced. The M2KO (. DELTA.TM.) alone group showed as high an IgG titer as the first week of the challenge-boost group when blood was drawn on the first week of day 35.

With lethal doses of Vietnam/1203/2004 virus (20 MLD ₅₀ ) Mice were challenged. All H5N1M2KO (Δtm) vaccinated (challenge and challenge-boost only) mice survived (fig. 54 and 55). The high survival rate of 5 months post-immunization challenged mice suggests that the H5N1M2KO (Δtm) vaccine would elicit a memory response. The challenged mice received only one dose of vaccine 4 weeks after immunization, indicating that the M2KO (Δtm) vaccine would stimulate a strong immune response. H5N1 challenge also lasted 5 months in H1N1pdm M2KO (. DELTA.TM.) immunized mice, indicating that M2KO (. DELTA.TM.) would trigger crossover that provided protection against heterologous challenge Reactive immune response.

EXAMPLE 18H 1N1pdm:

CA07 versus M2KO (. DELTA.TM.) CA07

HA and NA cDNA clones of a/california/07/2009 (CA 07) (H1N 1 pdm) were prepared by standard molecular biology protocols. The sequences of the constructs were confirmed using standard protocols and subcloned into appropriate vectors to allow the preparation of seed M2KO (ΔTM) virus and M2WTCA07/PR8 virus. From among MDCK cells

2011-2012 vaccine lot number B11K1802 plaque purification +.>

CA07 (H1N 1 pdm). The A/California/07/2009 (CA 07) HA (SEQ ID NO: 26) and NA (SEQ ID NO: 27) sequences used are shown below.

A/California/07/2009 (H1N 1) HA in M2K0TMdel

AGCAAAAGCAGGGGAAAACAAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGTCCTACATTGTGGAAACACCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAMGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCRAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAAACACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATATCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAGAAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCATGAGAAAAAAACACCCTTGTTTCTACT

A/(California/07/2009 (H1N 1) NA in M2K0TMdel

AGCAAAAGCAGGAGTTTAAAATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATATTACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGAAACATGCAATCAAAGCGTCATTACTTATGAAAACAACACTTGGGTAAATCAGACATATGTTAACATCAGCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTGTAAGAATCGGTTCCAAGGGGGATGTGTTTGTCATAAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGCATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTAATGGACAGGCCTCATACAAGATCTTCAGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATCACTATGAGGAATGCTCCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGGTTTTCATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAATGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCATTGACAAGTAATTTGTTCAAAAAACTCCTTGTTTCTACT

Mice (7-8 week old, female BALB/c) were inoculated intranasally with M2KO (. DELTA.TM) CA07 (10) ⁶ TCID ₅₀ Mouse), M2WT CA07 (10) ⁶ TCID ₅₀ Mouse), a,

CA07(10 ⁶ TCID ₅₀ Mice) or OPTI-MEM as a primary control ^TM . Body weight and clinical symptoms were observed until 14 days post inoculation. FIG. 37 shows that M2KO (. DELTA.TM) and +.>

Vaccinated mice did not lose weight, whereas WT M2-containing viruses lost weight and developed and infected. These results confirm that deletion of the M2 gene attenuated the virus and that M2KO (Δtm) was attenuated.

FIG. 38 shows M2KO (. DELTA.TM), fluMist,

And M2 wild-type viral titer lung and nasal termination. Lungs and turbinates were harvested on day 3 post vaccination for virus titration on cells. In M2KO (. DELTA.TM.) immunized mice, no virus was detected in the lung or nasal turbinates. In contrast, the ∈10>

There is indeed viral replication in the lungs and turbinates, albeit at lower levels than the wild-type virus.

FIG. 39 determination of M2KO (. DELTA.TM) and in serum collected on days 7, 14 and 21 after inoculation by ELISA

Titer and anti-HA IgG titer. M2KO (ΔTM) induces a higher response than +.>

The response is detected earlier. By day 21, 2 viruses reached peak antibody levels.

FIG. 40 shows the use of 40MLD ₅₀ The percent survival of mice challenged 12 weeks after the heterologous, mouse-adapted influenza a/Aichi/2/1968 (H3N 2) immunization. Changes in body weight and clinical symptoms were observed to 14 days post challenge. All M2KO (. DELTA.TM) (H1N 1pdm HA, NA) -immunized mice were protected from Aichi (H3N 2) challenge, but only 80%

(H1N 1pdm HA, NA) is protected. Survival->

Mice lost approximately 20% of their body weight, while M2KO (Δtm) mice lost about 10% of their body weight.

Table 26 shows the viral titers of lung and turbinates collected on day 3 post challenge. M2KO (ΔTM) and

challenge virus replication in the lungs and turbinates was controlled to similar levels, while primary mice exhibited 1 log higher viral titers in the lungs and turbinates.

BAL was collected 3 days after challenge and stained with immunostained surface markers by flow cytometry to detect CD8+CD4+, CD8+CD4-, CD8-CD4+, CD8-CD 4-cell populations. The larger population of CD4+ and CD8+ cells in vaccinated mice compared to naive mice indicates M2KO (ΔTM) challenge and

similar cellular responses. M2KO (delta. TM) vaccinationMice with seedlings have a ratio->

A larger cd8+cd4-cell population (49% versus 40%) (fig. 41).

Table 26 viral titers of the respiratory tract of mice.

Example 19 relative to

And M2KO (delta. TM) mRNA expression by wild-type virus

In certain embodiments, the M2KO (Δtm) virus is produced in cells that stably trans-provide the M2 protein, thereby producing a virus that has a functional M2 protein in the viral membrane, but does not encode M2 in its genome. Thus, we hypothesize that the M2KO (ΔTM) virus behaves similarly to the initial infection and first round replication of the wild-type virus in normal cells. We propose that mRNA levels of viral antigens are similar to wild-type levels at early stages of infection and stimulate an effective immune response faster than attenuated replicating viral vaccines.

At a multiplicity of infection of 0.5 with M2KO (. DELTA.TM),

And wild-type virus infection of human lung cancer (a 549) cells. Unadsorbed virus was removed by washing 5 times with PBS. After addition of the virus growth medium, the infected cells were placed in CO at 35 ℃ ₂ In an incubator. Trypsin was not added to the growth medium to ensure single cycle replication of all viruses. Cell monolayers were harvested and RNA was extracted 4, 9 and 22 hours post infection.

Total RNA (100 ng) from control and infected A549 cells was used for quantitative RT-PCR analysis. cDNA was synthesized with oligo-dT primer and Superscript II reverse transcriptase (Invitrogen), and quantified by real-time quantitative PCR analysis using gene-specific primers for early influenza gene M1 and late influenza gene HA and cytokine IP-10 gene. The reaction was performed using SYBR Green reagent (Invitrogen, carlsbad) according to the manufacturer's instructions.

The reaction efficiency was calculated using serial 10-fold dilutions of the housekeeping gene gamma-actin and the sample gene. Reactions were performed on an ABI 7300 real-time PCR system (Applied Biosystems, foster City, calif., USA) using the thermal protocol: stage 1, keeping at 50 ℃ for 30min; stage 2, maintaining at 95 ℃ for 15min; stage 3:94℃for 15 seconds and 55℃for 30 seconds; and 72℃for 30 seconds, repeating 30 cycles. All quantification (threshold cycle [ CT ] values) were normalized to the value of the housekeeping gene to yield Δct, and the difference between the Δct value of the sample and the Δct value of the reference (wild-type sample) was calculated as- ΔΔct. The relative level of mRNA expression was expressed as 2-DeltaCT.

At 4 hours post infection, M2KO (Δtm) virus HA mRNA expression was similar to wild-type M2 virus with respect to H3 (table 27), PR8 (table 28) and H1N1pdm (fig. 42). Cold adapted due to slower replication kinetics

Less than wild-type and M2KO (ΔTM) at early time points. At M1 (early time point gene), mRNA expression was tested and similar results were observed (table 27, fig. 42). These results suggest that M2KO (Δtm) produces similar levels of mRNA in early infectious cycles to de novo produce viral antigens that produce a 'danger signal' similar to wild-type virus and induce an effective immune response.

Table 27 relative mRNA expression of the H3HA gene.

Table 28 relative mRNA expression of PR8HA and M1 genes.

Example 20: preparation of M2Vero producer cells

The M2 gene of PR8 virus was cloned into the expression vector pCMV-SC (Stratagene, la Jolla, calif.) by standard molecular techniques to prepare pCMV-PR8-M2. The plasmid was digested with EcoR1 to confirm the presence of the 300bp M2 gene and the 4.5Kb vector, as shown in FIG. 43. The sequence of the plasmid containing the M2 gene insert was confirmed as shown in FIGS. 44A to 44D.

Preparation of M2Vero cells: the previously described pCMV-PR8-M2 plasmid containing the neomycin resistance gene was transfected into Vero cells (ATCC CCL-81) using the TransIT-LT 1 transfection reagent (Mirus) according to the manufacturer's instructions. Briefly, the day before transfection, at 5X10 ⁵ Vero cells were plated on individual cells/100-mm trays. On day 1, 10. Mu.g of plasmid DNA was mixed with 20. Mu.g of Trans IT-LT1 in 0.3ml of OptiMEM (Invitrogen) and with these cells at 37℃in 5% CO ₂ Incubation was carried out overnight. On day 2, the transfection mixture was replaced with complete medium, which was Modified Eagle Medium (MEM) supplemented with 5% new born calf serum. The medium also contained 1mg/ml geneticin (Invitrogen), a broad spectrum antibiotic used to select mammalian cells expressing neomycin protein. Resistant cells (Vero cells stably expressing the M2 gene) began to grow in selection medium, which was replaced with fresh selection medium, and geneticin-resistant clones were isolated by limiting dilution in TC-96 plates. Surface expression of the M2 protein was confirmed by immunostaining using the M2-specific monoclonal antibody 14C2 (Santa Cruz Biotechnology).

Infection of parental and modified M2Vero cells with M2KO (Δtm) virus: the ability of M2Vero cells to act as producer cells for M2KO (Δtm) virus was tested by infection with M2KO (Δtm) -PR8 virus. Briefly, using standard influenza infection protocols, 10-fold serial dilutions of M2KO (ΔTM) -PR8 virus (10 ^-1 -10 ^-6 ) Infection of monolayer M2Vero and parental Vero cells. Infected cells were incubated at 35 ℃ and cytopathic effects (CPE) were observed daily. Only M2Vero cells showed CPE indicative of viral growth. From 10 on day 4 ^-3 Supernatant was harvested from wells and passed through TCID ₅₀ Assay viral titers were determined on MDCK cells (M2 CK) stably expressing the M2 gene. M2KO (. DELTA.TM) -PR8 virus titer on M2Vero cells was 10 ^6.75 TCID ₅₀ /ml, thus indicating that M2Vero cells can serve as production cells for the preparation of M2KO (Δtm) vaccine.

Example 21: intradermal delivery of influenza vaccines

This example demonstrates the immunogenicity of the seasonal influenza vaccine FluLaval (2011-2012 formulation) when administered Intramuscularly (IM), intradermally (ID), and using a subcutaneous microneedle device, such as the device described in published U.S. patent application 2011/0172609. Hairless guinea pigs were vaccinated on day 0 and the selected groups were boosted on day 30. Serum was collected on days 0, 30 and 60 and analyzed for hemagglutinin-specific IgG responses by enzyme-linked immunosorbent assay (ELISA).

The results are shown in FIGS. 51-53. The data show qualitative absorbance against antibody levels for 3 strains formulated in seasonal influenza vaccine FluLaval: a/california/7/2009 NYMC X-181, a/victoria/210/2009 NYMC X-187 (a/peltier/16/2009-like virus) and B/brisban/60/2008. On day 30, IM and ID delivery produced the same IgG response to all viral HA. The ID challenge group only showed higher titers at day 60, suggesting that ID delivery induced persistent immunity against all viral HA.

Sequence listing

<110> Fu's health Co., ltd (FLUGEN, INC.)

<120> influenza virus mutant and use thereof

<130> TD181003575US2

<140> PCT/US2012/043606

<141> 2012-06-21

<150> US 61/501,034

<151> 2011-06-24

<160> 33

<170> patent In version 3.5

<210> 1

<211> 976

<212> DNA

<213> influenza A Virus

<400> 1

agcaaaagca ggtagatatt gaaagatgag tcttctaacc gaggtcgaaa cgtacgtact 60

ctctatcatc ccgtcaggcc ccctcaaagc cgagatcgca cagagacttg aagatgtctt 120

tgcagggaag aacaccgatc ttgaggttct catggaatgg ctaaagacaa gaccaatcct 180

gtcacctctg actaagggga ttttaggatt tgtgttcacg ctcaccgtgc ccagtgagcg 240

aggactgcag cgtagacgct ttgtccaaaa tgcccttaat gggaacgggg atccaaataa 300

catggacaaa gcagttaaac tgtataggaa gctcaagagg gagataacat tccatggggc 360

caaagaaatc tcactcagtt attctgctgg tgcacttgcc agttgtatgg gcctcatata 420

caacaggatg ggggctgtga ccactgaagt ggcatttggc ctggtatgtg caacctgtga 480

acagattgct gactcccagc atcggtctca taggcaaatg gtgacaacaa ccaatccact 540

aatcagacat gagaacagaa tggttttagc cagcactaca gctaaggcta tggagcaaat 600

ggctggatcg agtgagcaag cagcagaggc catggaggtt gctagtcagg ctagacaaat 660

ggtgcaagcg atgagaacca ttgggactca tcctagctcc agtgctggtc tgaaaaatga 720

tcttcttgaa aatttgcagg cctatcagaa acgaatgggg gtgcagatgc aacggttcaa 780

gtgattaata ggatcgtctt tttttcaaat gcatttaccg tcgctttaaa tacggactga 840

aaggagggcc ttctacggaa ggagtgccaa agtctatgag ggaagaatat cgaaaggaac 900

agcagagtgc tgtggatgct gacgatggtc attttgtcag catagagctg gagtaaaaaa 960

ctaccttgtt tctact 976

<210> 2

<211> 1027

<212> DNA

<213> influenza A Virus

<400> 2

agcaaaagca ggtagatatt gaaagatgag tcttctaacc gaggtcgaaa cctacgtact 60

ctctatcatc ccgtcaggcc ccctcaaagc cgagatcgca cagagacttg aagatgtctt 120

tgcagggaag aacaccgatc ttgaggttct catggaatgg ctaaagacaa gaccaatcct 180

gtcacctctg actaagggga ttttaggatt tgtgttcacg ctcaccgtgc ccagtgagcg 240

aggactgcag cgtagacgct ttgtccaaaa tgcccttaat gggaacgggg atccaaataa 300

catggacaaa gcagttaaac tgtataggaa gctcaagagg gagataacat tccatggggc 360

caaagaaatc tcactcagtt attctgctgg tgcacttgcc agttgtatgg gcctcatata 420

caacaggatg ggggctgtga ccactgaagt ggcatttggc ctggtatgtg caacctgtga 480

acagattgct gactcccagc atcggtctca taggcaaatg gtgacaacaa ccaatccact 540

aatcagacat gagaacagaa tggttttagc cagcactaca gctaaggcta tggagcaaat 600

ggctggatcg agtgagcaag cagcagaggc catggaggtt gctagtcagg ctagacaaat 660

ggtgcaagcg atgagaacca ttgggactca tcctagctcc agtgctggtc tgaaaaatga 720

tcttcttgaa aatttgcagg cctatcagaa acgaatgggg gtgcagatgc aacggttcaa 780

gtgattaata gactattgcc gcaaatatca ttgggatctt gcacttgaca ttgtggattc 840

ttgatcgtct ttttttcaaa tgcatttacc gtcgctttaa atacggactg aaaggagggc 900

cttctacgga aggagtgcca aagtctatga gggaagaata tcgaaaggaa cagcagagtg 960

ctgtggatgc tgacgatggt cattttgtca gcatagagct ggagtaaaaa actaccttgt 1020

ttctact 1027

<210> 3

<211> 976

<212> DNA

<213> influenza A Virus

<400> 3

agcaaaagca ggtagatatt gaaagatgag tcttctaacc gaggtcgaaa cctacgtact 60

ctctatcatc ccgtcaggcc ccctcaaagc cgagatcgca cagagacttg aagatgtctt 120

tgcagggaag aacaccgatc ttgaggttct catggaatgg ctaaagacaa gaccaatcct 180

gtcacctctg actaagggga ttttaggatt tgtgttcacg ctcaccgtgc ccagtgagcg 240

aggactgcag cgtagacgct ttgtccaaaa tgcccttaat gggaacgggg atccaaataa 300

catggacaaa gcagttaaac tgtataggaa gctcaagagg gagataacat tccatggggc 360

caaagaaatc tcactcagtt attctgctgg tgcacttgcc agttgtatgg gcctcatata 420

caacaggatg ggggctgtga ccactgaagt ggcatttggc ctggtatgtg caacctgtga 480

acagattgct gactcccagc atcggtctca taggcaaatg gtgacaacaa ccaatccact 540

aatcagacat gagaacagaa tggttttagc cagcactaca gctaaggcta tggagcaaat 600

ggctggatcg agtgagcaag cagcagaggc catggaggtt gctagtcagg ctagacaaat 660

ggtgcaagcg atgagaacca ttgggactca tcctagctcc agtgctggtc tgaaaaatga 720

tcttcttgaa aatttgcagg cctatcagaa acgaatgggg gtgcagatgc aacggttcaa 780

gtgattaata ggatcgtctt tttttcaaat gcatttaccg tcgctttaaa tacggactga 840

aaggagggcc ttctacggaa ggagtgccaa agtctatgag ggaagaatat cgaaaggaac 900

agcagagtgc tgtggatgct gacgatggtc attttgtcag catagagctg gagtaaaaaa 960

ctaccttgtt tctact 976

<210> 4

<211> 24

<212> PRT

<213> influenza A Virus

<400> 4

Met Ser Leu Leu Thr Glu Val Glu Thr Pro Ile Arg Asn Glu Trp Gly

1 5 10 15

Cys Arg Cys Asn Gly Ser Ser Asp

20

<210> 5

<211> 97

<212> PRT

<213> influenza A Virus

<400> 5

Met Ser Leu Leu Thr Glu Val Glu Thr Pro Ile Arg Asn Glu Trp Gly

1 5 10 15

Cys Arg Cys Asn Gly Ser Ser Asp Pro Leu Thr Ile Ala Ala Asn Ile

20 25 30

Ile Gly Ile Leu His Leu Thr Leu Trp Ile Leu Asp Arg Leu Phe Phe

35 40 45

Lys Cys Ile Tyr Arg Arg Phe Lys Tyr Gly Leu Lys Gly Gly Pro Ser

50 55 60

Thr Glu Gly Val Pro Lys Ser Met Arg Glu Glu Tyr Arg Lys Glu Gln

65 70 75 80

Gln Ser Ala Val Asp Ala Asp Asp Gly His Phe Val Ser Ile Glu Leu

85 90 95

Glu

<210> 6

<211> 86

<212> PRT

<213> influenza A Virus

<400> 6

Met Ser Leu Leu Thr Glu Val Glu Thr Pro Ile Arg Asn Glu Trp Gly

1 5 10 15

Cys Arg Cys Asn Gly Ser Ser Asp Pro Leu Thr Ile Ala Ala Asn Ile

20 25 30

Ile Gly Ile Leu His Leu Thr Leu Trp Ile Leu Phe Lys Tyr Gly Leu

35 40 45

Lys Gly Gly Pro Ser Thr Glu Gly Val Pro Lys Ser Met Arg Glu Glu

50 55 60

Tyr Arg Lys Glu Gln Gln Ser Ala Val Asp Ala Asp Asp Gly His Phe

65 70 75 80

Val Ser Ile Glu Leu Glu

85

<210> 7

<211> 92

<212> PRT

<213> influenza A Virus

<400> 7

Met Ser Leu Leu Thr Glu Val Glu Thr Pro Ile Arg Asn Glu Trp Gly

1 5 10 15

Cys Arg Cys Asn Gly Ser Ser Asp Pro Leu Thr Ile Ala Ala Asn Ile

20 25 30

Ile Gly Ile Leu His Leu Thr Leu Trp Ile Leu Lys Cys Ile Tyr Arg

35 40 45

Arg Phe Lys Tyr Gly Leu Lys Gly Gly Pro Ser Thr Glu Gly Val Pro

50 55 60

Lys Ser Met Arg Glu Glu Tyr Arg Lys Glu Gln Gln Ser Ala Val Asp

65 70 75 80

Ala Asp Asp Gly His Phe Val Ser Ile Glu Leu Glu

85 90

<210> 8

<211> 95

<212> PRT

<213> influenza A Virus

<400> 8

Met Ser Leu Leu Thr Glu Val Glu Thr Pro Ile Arg Asn Glu Trp Gly

1 5 10 15

Cys Arg Cys Asn Gly Ser Ser Asp Pro Leu Thr Ile Ala Ala Asn Ile

20 25 30

Ile Gly Ile Leu His Leu Thr Leu Trp Ile Leu Leu Phe Phe Lys Cys

35 40 45

Ile Tyr Arg Arg Phe Lys Tyr Gly Leu Lys Gly Gly Pro Ser Thr Glu

50 55 60

Gly Val Pro Lys Ser Met Arg Glu Glu Tyr Arg Lys Glu Gln Gln Ser

65 70 75 80

Ala Val Asp Ala Asp Asp Gly His Phe Val Ser Ile Glu Leu Glu

85 90 95

<210> 9

<211> 294

<212> DNA

<213> influenza A Virus

<400> 9

atgagtcttc taaccgaggt cgaaacgcct atcagaaacg aatgggggtg cagatgcaac 60

ggttcaagtg atcctctcac tattgccgca aatatcattg ggatcttgca cttgacattg 120

tggattcttg atcgtctttt tttcaaatgc atttaccgtc gctttaaata cggactgaaa 180

ggagggcctt ctacggaagg agtgccaaag tctatgaggg aagaatatcg aaaggaacag 240

cagagtgctg tggatgctga cgatggtcat tttgtcagca tagagctgga gtaa 294

<210> 10

<211> 43

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 10

acacaccgtc tctaggatcg tctttttttc aaatgcattt acc 43

<210> 11

<211> 38

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 11

cacacacgtc tcctattagt agaaacaagg tagttttt 38

<210> 12

<211> 38

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 12

acacaccgtc tcatcctatt aatcacttga accgttgc 38

<210> 13

<211> 31

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 13

cacacacgtc tccgggagca aaagcaggta g 31

<210> 14

<211> 35

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthetic primers

<400> 14

acacaccgtc tccctacgta ctctctatca tcccg 35

<210> 15

<211> 38

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthetic primers

<400> 15

cacacacgtc tcctattagt agaaacaagg tagttttt 38

<210> 16

<211> 54

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 16

gggagcaaaa gcaggtagat attgaaagat gagtcttcta accgaggtcg aaac 54

<210> 17

<211> 54

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 17

gtaggtttcg acctcggtta gaagactcat ctttcaatat ctacctgctt ttgc 54

<210> 18

<211> 35

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthetic primers

<400> 18

acacaccgtc tccctacgta ctctctatca tcccg 35

<210> 19

<211> 38

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthetic primers

<400> 19

cacacacgtc tcctattagt agaaacaagg tagttttt 38

<210> 20

<211> 54

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 20

gggagcaaaa gcaggtagat attgaaagat gagtcttcta accgaggtcg aaac 54

<210> 21

<211> 54

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of oligonucleotide

<400> 21

gtaggtttcg acctcggtta gaagactcat ctttcaatat ctacctgctt ttgc 54

<210> 22

<211> 31

<212> DNA

<213> influenza A Virus

<400> 22

caacggttca agtgattaat aaactattgc c 31

<210> 23

<211> 31

<212> DNA

<213> influenza A Virus

<400> 23

caacggttca agtgattggt ggactgttgc c 31

<210> 24

<211> 1772

<212> DNA

<213> influenza A Virus

<400> 24

agcaaaagca ggggaaaata aaaacaacca aaatggagaa aatagtgctt ctttttgcaa 60

tagtcagtct tgttaaaagt gatcagattt gcattggtta ccatgcaaac aactcgacag 120

agcaggttga cacaataatg gaaaagaacg ttactgttac acatgcccaa gacatactgg 180

aaaagaaaca caacgggaag ctctgcgatc tagatggagt gaagcctcta attttgagag 240

attgtagcgt agctggatgg ctcctcggaa acccaatgtg tgacgaattc atcaatgtgc 300

cggaatggtc ttacatagtg gagaaggcca atccagtcaa tgacctctgt tacccagggg 360

atttcaatga ctatgaagaa ttgaaacacc tattgagcag aataaaccat tttgagaaaa 420

ttcagatcat ccccaaaagt tcttggtcca gtcatgaagc ctcattaggg gtgagctcag 480

catgtccata ccagggaaag tcctcctttt tcagaaatgt ggtatggctt atcaaaaaga 540

acagtacata cccaacaata aagaggagct acaataatac caaccaagaa gatcttttgg 600

tactgtgggg gattcaccat cctaatgatg cggcagagca gacaaagctc tatcaaaacc 660

caaccaccta tatttccgtt gggacatcaa cactaaacca gagattggta ccaagaatag 720

ctactagatc caaagtaaac gggcaaagtg gaaggatgga gttcttctgg acaattttaa 780

agccgaatga tgcaatcaac ttcgagagta atggaaattt cattgctcca gaatatgcat 840

acaaaattgt caagaaaggg gactcaacaa ttatgaaaag tgaattggaa tatggtaact 900

gcaacaccaa gtgtcaaact ccaatggggg cgataaactc tagcatgcca ttccacaata 960

tacaccctct caccattggg gaatgcccca aatatgtgaa atcaaacaga ttagtccttg 1020

cgactgggct cagaaatagc cctcaaagag agactagagg attatttgga gctatagcag 1080

gttttataga gggaggatgg cagggaatgg tagatggttg gtatgggtac caccatagca 1140

atgagcaggg gagtgggtac gctgcagaca aagaatccac tcaaaaggca atagatggag 1200

tcaccaataa ggtcaactcg atcattgaca aaatgaacac tcagtttgag gccgttggaa 1260

gggaatttaa caacttagaa aggagaatag agaatttaaa caagaagatg gaagacgggt 1320

tcctagatgt ctggacttat aatgctgaac ttctggttct catggaaaat gagagaactc 1380

tagactttca tgactcaaat gtcaagaacc tttacgacaa ggtccgacta cagcttaggg 1440

ataatgcaaa ggagctgggt aacggttgtt tcgagttcta tcataaatgt gataatgaat 1500

gtatggaaag tgtaagaaat ggaacgtatg actacccgca gtattcagaa gaagcgagac 1560

taaaaagaga ggaaataagt ggagtaaaat tggaatcaat aggaatttac caaatactgt 1620

caatttattc tacagtggcg agttccctag cactggcaat catggtagct ggtctatcct 1680

tatggatgtg ctccaatggg tcgttacaat gcagaatttg catttaagat tagaatttca 1740

gagatatgag gaaaaacacc cttgtttcta ct 1772

<210> 25

<211> 1398

<212> DNA

<213> influenza A Virus

<400> 25

agcaaaagca ggggtttaaa atgaatccaa atcagaagat aataaccatc ggatcaatct 60

gtatggtaac tggaatagtt agcttaatgt tacaaattgg gaacatgatc tcaatatggg 120

tcagtcattc aattcacaca gggaatcaac accaatctga accaatcagc aatactaatt 180

ttcttactga gaaagctgtg gcttcagtaa aattagcggg caattcatct ctttgcccca 240

ttaacggatg ggctgtatac agtaaggaca acagtataag gatcggttcc aagggggatg 300

tgtttgttat aagagagccg ttcatctcat gctcccactt ggaatgcaga actttctttt 360

tgactcaggg agccttgctg aatgacaagc actccaatgg gactgtcaaa gacagaagcc 420

ctcacagaac attaatgagt tgtcctgtgg gtgaggctcc ctccccatat aactcaaggt 480

ttgagtctgt tgcttggtca gcaagtgctt gccatgatgg caccagttgg ttgacgattg 540

gaatttctgg cccagacaat ggggctgtgg ctgtattgaa atacaatggc ataataacag 600

acactatcaa gagttggagg aacaacatac tgagaactca agagtctgaa tgtgcatgtg 660

taaatggctc ttgctttact gtaatgactg acggaccaag taatggtcag gcatcacata 720

agatcttcaa aatggaaaaa gggaaagtgg ttaaatcagt cgaattggat gctcctaatt 780

atcactatga ggaatgctcc tgttatccta atgccggaga aatcacatgt gtgtgcaggg 840

ataattggca tggctcaaat cggccatggg tatctttcaa tcaaaatttg gagtatcaaa 900

taggatatat atgcagtgga gttttcggag acaatccacg ccccaatgat ggaacaggta 960

gttgtggtcc ggtgtcctct aacggggcat atggggtaaa agggttttca tttaaatacg 1020

gcaatggtgt ctggatcggg agaaccaaaa gcactaattc caggagcggc tttgaaatga 1080

tttgggatcc aaatgggtgg actgaaacgg acagtagctt ttcagtgaaa caagatatcg 1140

tagcaataac tgattggtca ggatatagcg ggagttttgt ccagcatcca gaactgacag 1200

gactagattg cataagacct tgtttctggg ttgagttgat cagagggcgg cccaaagaga 1260

gcacaatttg gactagtggg agcagcatat ctttttgtgg tgtaaatagt gacactgtgg 1320

gttggtcttg gccagacggt gccgagttgc cattcaccat tgacaagtag tctgttcaaa 1380

aaactccttg tttctact 1398

<210> 26

<211> 1779

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of polynucleotides

<400> 26

agcaaaagca ggggaaaaca aaagcaacaa aaatgaaggc aatactagta gttctgctat 60

atacatttgc aaccgcaaat gcagacacat tatgtatagg ttatcatgcg aacaattcaa 120

cagacactgt agacacagta ctagaaaaga atgtaacagt aacacactct gttaaccttc 180

tagaagacaa gcataacggg aaactatgca aactaagagg ggtagcccca ttgcatttgg 240

gtaaatgtaa cattgctggc tggatcctgg gaaatccaga gtgtgaatca ctctccacag 300

caagctcatg gtcctacatt gtggaaacac ctagttcaga caatggaacg tgttacccag 360

gagatttcat cgattatgag gagctaagag agcaattgag ctcagtgtca tcatttgaaa 420

ggtttgagat attccccaag acaagttcat ggcccaatca tgactcgaac aaaggtgtaa 480

cggcagcatg tcctcatgct ggagcaaaaa gcttctacaa aaatttaata tggctagtta 540

aaaaaggaaa ttcataccca aagctcagca aatcctacat taatgataaa gggaaagaag 600

tcctcgtgct atggggcatt caccatccat ctactagtgc tgaccaacaa agtctctatc 660

agaatgcaga tgcatatgtt tttgtggggt catcaagata cagcaagamg ttcaagccgg 720

aaatagcaat aagacccaaa gtgagggatc ragaagggag aatgaactat tactggacac 780

tagtagagcc gggagacaaa ataacattcg aagcaactgg aaatctagtg gtaccgagat 840

atgcattcgc aatggaaaga aatgctggat ctggtattat catttcagat acaccagtcc 900

acgattgcaa tacaacttgt caaacaccca agggtgctat aaacaccagc ctcccatttc 960

agaatataca tccgatcaca attggaaaat gtccaaaata tgtaaaaagc acaaaattga 1020

gactggccac aggattgagg aatatcccgt ctattcaatc tagaggccta tttggggcca 1080

ttgccggttt cattgaaggg gggtggacag ggatggtaga tggatggtac ggttatcacc 1140

atcaaaatga gcaggggtca ggatatgcag ccgacctgaa gagcacacag aatgccattg 1200

acgagattac taacaaagta aattctgtta ttgaaaagat gaatacacag ttcacagcag 1260

taggtaaaga gttcaaccac ctggaaaaaa gaatagagaa tttaaataaa aaagttgatg 1320

atggtttcct ggacatttgg acttacaatg ccgaactgtt ggttctattg gaaaatgaaa 1380

gaactttgga ctaccacgat tcaaatgtga agaacttata tgaaaaggta agaagccagc 1440

taaaaaacaa tgccaaggaa attggaaacg gctgctttga attttaccac aaatgcgata 1500

acacgtgcat ggaaagtgtc aaaaatggga cttatgacta cccaaaatac tcagaggaag 1560

caaaattaaa cagagaagaa atagatgggg taaagctgga atcaacaagg atttaccaga 1620

ttttggcgat ctattcaact gtcgccagtt cattggtact ggtagtctcc ctgggggcaa 1680

tcagtttctg gatgtgctct aatgggtctc tacagtgtag aatatgtatt taacattagg 1740

atttcagaag catgagaaaa aaacaccctt gtttctact 1779

<210> 27

<211> 1458

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of polynucleotides

<400> 27

agcaaaagca ggagtttaaa atgaatccaa accaaaagat aataaccatt ggttcggtct 60

gtatgacaat tggaatggct aacttaatat tacaaattgg aaacataatc tcaatatgga 120

ttagccactc aattcaactt gggaatcaaa atcagattga aacatgcaat caaagcgtca 180

ttacttatga aaacaacact tgggtaaatc agacatatgt taacatcagc aacaccaact 240

ttgctgctgg acagtcagtg gtttccgtga aattagcggg caattcctct ctctgccctg 300

ttagtggatg ggctatatac agtaaagaca acagtgtaag aatcggttcc aagggggatg 360

tgtttgtcat aagggaacca ttcatatcat gctccccctt ggaatgcaga accttcttct 420

tgactcaagg ggccttgcta aatgacaaac attccaatgg aaccattaaa gacaggagcc 480

catatcgaac cctaatgagc tgtcctattg gtgaagttcc ctctccatac aactcaagat 540

ttgagtcagt cgcttggtca gcaagtgctt gtcatgatgg catcaattgg ctaacaattg 600

gaatttctgg cccagacaat ggggcagtgg ctgtgttaaa gtacaacggc ataataacag 660

acactatcaa gagttggaga aacaatatat tgagaacaca agagtctgaa tgtgcatgtg 720

taaatggttc ttgctttact gtaatgaccg atggaccaag taatggacag gcctcataca 780

agatcttcag aatagaaaag ggaaagatag tcaaatcagt cgaaatgaat gcccctaatt 840

atcactatga ggaatgctcc tgttatcctg attctagtga aatcacatgt gtgtgcaggg 900

ataactggca tggctcgaat cgaccgtggg tgtctttcaa ccagaatctg gaatatcaga 960

taggatacat atgcagtggg attttcggag acaatccacg ccctaatgat aagacaggca 1020

gttgtggtcc agtatcgtct aatggagcaa atggagtaaa agggttttca ttcaaatacg 1080

gcaatggtgt ttggataggg agaactaaaa gcattagttc aagaaacggt tttgagatga 1140

tttgggatcc gaacggatgg actgggacag acaataactt ctcaataaag caagatatcg 1200

taggaataaa tgagtggtca ggatatagcg ggagttttgt tcagcatcca gaactaacag 1260

ggctggattg tataagacct tgcttctggg ttgaactaat cagagggcga cccaaagaga 1320

acacaatctg gactagcggg agcagcatat ccttttgtgg tgtaaacagt gacactgtgg 1380

gttggtcttg gccagacggt gctgagttgc catttaccat tgacaagtaa tttgttcaaa 1440

aaactccttg tttctact 1458

<210> 28

<211> 1027

<212> DNA

<213> influenza A Virus

<400> 28

agcaaaagca ggtagatatt gaaagatgag tcttctaacc gaggtcgaaa cgtacgtact 60

ctctatcatc ccgtcaggcc ccctcaaagc cgagatcgca cagagacttg aagatgtctt 120

tgcagggaag aacaccgatc ttgaggttct catggaatgg ctaaagacaa gaccaatcct 180

gtcacctctg actaagggga ttttaggatt tgtgttcacg ctcaccgtgc ccagtgagcg 240

aggactgcag cgtagacgct ttgtccaaaa tgcccttaat gggaacgggg atccaaataa 300

catggacaaa gcagttaaac tgtataggaa gctcaagagg gagataacat tccatggggc 360

caaagaaatc tcactcagtt attctgctgg tgcacttgcc agttgtatgg gcctcatata 420

caacaggatg ggggctgtga ccactgaagt ggcatttggc ctggtatgtg caacctgtga 480

acagattgct gactcccagc atcggtctca taggcaaatg gtgacaacaa ccaatccact 540

aatcagacat gagaacagaa tggttttagc cagcactaca gctaaggcta tggagcaaat 600

ggctggatcg agtgagcaag cagcagaggc catggaggtt gctagtcagg ctagacaaat 660

ggtgcaagcg atgagaacca ttgggactca tcctagctcc agtgctggtc tgaaaaatga 720

tcttcttgaa aatttgcagg cctatcagaa acgaatgggg gtgcagatgc aacggttcaa 780

gtgatcctct cactattgcc gcaaatatca ttgggatctt gcacttgaca ttgtggattc 840

ttgatcgtct ttttttcaaa tgcatttacc gtcgctttaa atacggactg aaaggagggc 900

cttctacgga aggagtgcca aagtctatga gggaagaata tcgaaaggaa cagcagagtg 960

ctgtggatgc tgacgatggt cattttgtca gcatagagct ggagtaaaaa actaccttgt 1020

ttctact 1027

<210> 29

<211> 1470

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of polynucleotides

<400> 29

atgcattagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga 60

gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg 120

cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg 180

acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca 240

tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc 300

ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc 360

tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc 420

acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa 480

tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag 540

gcgtgtacgg tgggaggtct atataagcag agctggttta gtgaaccgtc agatccgcta 600

gcgattacgc caagctcgaa attaaccctc actaaaggga acaaaagctg gagctccact 660

gtggaattcg cccttggccg ccatgagtct tctaaccgag gtcgaaacgc ctatcagaaa 720

cgaatggggg tgcagatgca acggttcaag tgatcctctc actattgccg caaatatcat 780

tgggatcttg cacttgacat tgtggattct tgatcgtctt tttttcaaat gcatttaccg 840

tcgctttaaa tacggactga aaggagggcc ttctacggaa ggagtgccaa agtctatcag 900

ggaagaatat cgaaaggaac agcagagtgc tgtggatgct gacgatggtc attttgtcag 960

catagagctg gagtaatagg ccaagggcga attccacatt gggctcgagg gggggcccgg 1020

taccttaatt aattaaggta ccaggtaagt gtacccaatt cgccctatag tgagtcgtat 1080

tacaattcac tcgatcggct cgctgatcag cctcgactgt gccttctagt tgccagccat 1140

ctgttgtttg cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc 1200

tttcctaata aaatgaggaa attgcatcgc attgtctgag taggtgccat tctattctgg 1260

ggggtggggt ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg 1320

gggaacgcgt aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa 1380

atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa 1440

tagaccgaga tagggttgag tgttgttcca 1470

<210> 30

<211> 594

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of polynucleotides

<400> 30

atgcattagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga 60

gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg 120

cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg 180

acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca 240

tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc 300

ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc 360

tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc 420

acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa 480

tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag 540

gcgtgtacgg tgggaggtct atataagcag agctggttta gtgaaccgtc agat 594

<210> 31

<211> 731

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of polynucleotides

<400> 31

ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt 60

catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt 120

tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca 180

ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg 240

cggtaggcgt gtacggtggg aggtctatat aagcagagct ggtttagtga accgtcagat 300

ccgctagcga ttacgccaag ctcgaaatta accctcacta aagggaacaa aagctggagc 360

tccactgtgg aattcgccct tggccgccat gagtcttcta accgaggtcg aaacgcctat 420

cagaaacgaa tgggggtgca gatgcaacgg ttcaagtgat cctctcacta ttgccgcaaa 480

tatcattggg atcttgcact tgacattgtg gattcttgat cgtctttttt tcaaatgcat 540

ttaccgtcgc tttaaatacg gactgaaagg agggccttct acggaaggag tgccaaagtc 600

tatcagggaa gaatatcgaa aggaacagca gagtgctgtg gatgctgacg atggtcattt 660

tgtcagcata gagctggagt aataggccaa gggcgaattc cacattgggc tcgagggggg 720

gcccggtacc t 731

<210> 32

<211> 811

<212> DNA

<213> artificial sequence

<220>

<223> description of artificial sequence: synthesis of polynucleotides

<400> 32

tgtggaattc gcccttggcc gccatgagtc ttctaaccga ggtcgaaacg cctatcagaa 60

acgaatgggg gtgcagatgc aacggttcaa gtgatcctct cactattgcc gcaaatatca 120

ttgggatctt gcacttgaca ttgtggattc ttgatcgtct ttttttcaaa tgcatttacc 180

gtcgctttaa atacggactg aaaggagggc cttctacgga aggagtgcca aagtctatca 240

gggaagaata tcgaaaggaa cagcagagtg ctgtggatgc tgacgatggt cattttgtca 300

gcatagagct ggagtaatag gccaagggcg aattccacat tgggctcgag ggggggcccg 360

gtaccttaat taattaaggt accaggtaag tgtacccaat tcgccctata gtgagtcgta 420

ttacaattca ctcgatcggc tcgctgatca gcctcgactg tgccttctag ttgccagcca 480

tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc 540

ctttcctaat aaaatgagga aattgcatcg cattgtctga gtaggtgcca ttctattctg 600

gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct 660

ggggaacgcg taaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta 720

aatcagctca ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga 780

atagaccgag atagggttga gtgttgttcc a 811

<210> 33

<211> 294

<212> DNA

<213> influenza A Virus

<400> 33

atgagtcttc taaccgaggt cgaaacgcct atcagaaacg aatgggggtg cagatgcaac 60

ggttcaagtg atcctctcac tattgccgca aatatcattg ggatcttgca cttgacattg 120

tggattcttg atcgtctttt tttcaaatgc atttaccgtc gctttaaata cggactgaaa 180

ggagggcctt ctacggaagg agtgccaaag tctatcaggg aagaatatcg aaaggaacag 240

cagagtgctg tggatgctga cgatggtcat tttgtcagca tagagctgga gtaa 294

Claims (28)

1. A recombinant influenza a virus whose M gene is a mutant M gene, wherein the mutation in the M gene is: 1) Nucleotides 786 to 791 of SEQ ID NO. 28 or at positions corresponding to nucleotides 786 to 791 of SEQ ID NO. 28 with respect to the coding sequence of the M gene are replaced by two stop codons, and 2) a deletion of nucleotides 792 to 842 of SEQ ID NO. 28 or at positions corresponding to nucleotides 792 to 842 of SEQ ID NO. 28 with respect to the coding sequence of the M gene,

Wherein the two stop codons are TAA TAG.

2. The recombinant influenza a virus of claim 1, wherein mutation of the M gene results in failure of the virus to express the M2 protein or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID No. 4.

3. The recombinant influenza a virus of claim 1, wherein the mutant M gene does not revert to wild-type or a non-wild-type sequence encoding a functional M2 protein in an in vitro host cell system for at least 10 generations, wherein the host cell is modified to produce a mutant gene in wild-type form, thereby providing a gene product back to the virus.

4. The recombinant influenza a virus of claim 1, wherein the virus is non-pathogenic in a mammal infected with the virus.

5. A recombinant influenza a virus according to claim 3 wherein the in vitro host cell system comprises chinese hamster ovary cells or Vero cells.

6. A recombinant influenza a virus whose M gene is a mutant M gene, wherein the mutation in the M gene is: 1) Nucleotides 786 to 791 of SEQ ID NO. 28 or at positions 786 to 791 corresponding to SEQ ID NO. 28 with respect to the coding sequence of the M gene are replaced by two stop codons, and 2) a G to C substitution at nucleotide 52 of SEQ ID NO. 28 or at positions 52 corresponding to SEQ ID NO. 28 with respect to the coding sequence of the M gene,

Wherein the two stop codons are TAA TAG.

7. The recombinant influenza a virus of claim 6, wherein mutation of the M gene results in failure of the virus to express the M2 protein or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID No. 4.

8. A recombinant influenza a virus whose M gene is a mutant M gene, wherein the mutation in the M gene is: 1) the nucleotides 786-791 of SEQ ID NO. 28 or at the position corresponding to nucleotides 786-791 of SEQ ID NO. 28 with respect to the coding sequence of the M gene are replaced by two stop codons, 2) the deletion of nucleotides 792-842 of SEQ ID NO. 28 or at the position corresponding to nucleotides 792-842 of SEQ ID NO. 28 with respect to the coding sequence of the M gene, and 3) the substitution of G to C at nucleotide 52 of SEQ ID NO. 28 or at the position corresponding to nucleotide 52 of SEQ ID NO. 28 with respect to the coding sequence of the M gene,

wherein the two stop codons are TAA TAG.

9. The recombinant influenza a virus of claim 8, wherein mutation of the M gene results in failure of the virus to express the M2 protein or results in the virus expressing a truncated M2 protein having the amino acid sequence of SEQ ID No. 4.

10. A composition comprising the recombinant influenza a virus of claim 1.

11. The composition of claim 10, wherein mutation of the M gene results in failure of the virus to express the M2 protein or results in expression of a truncated M2 protein having the amino acid sequence of SEQ ID No. 4 by the virus.

12. The composition of claim 10, wherein the composition is non-pathogenic to a mammal to which the composition is administered.

13. The composition of claim 10, further comprising an adjuvant.

14. A method for propagating a recombinant influenza virus, the method comprising: contacting a host cell with the recombinant influenza a virus of claim 1; and incubating the host cell for a sufficient time under conditions suitable for replication of the virus, wherein the host cell is modified to produce the wild-type form of the influenza M gene, thereby providing the gene product back to the virus.

15. The method of claim 14, further comprising isolating progeny virus particles.

16. The method of claim 15, further comprising formulating the viral particle into a vaccine.

17. The method of claim 14, wherein the virus is unable to express an M2 protein or the virus expresses a truncated M2 protein having the amino acid sequence of SEQ ID No. 4.

18. The method of claim 14, wherein the virus is non-pathogenic to a mammal to which the virus is administered.

19. The method of claim 14, wherein the mutant M gene does not revert to wild-type or a non-wild-type sequence encoding a functional M2 protein in the host cell for at least 10 passages.

20. The method of claim 14, wherein the host cell is a CHO cell or a Vero cell.

21. A host cell comprising a heterologous nucleotide sequence encoding an influenza a virus M2 ion channel protein, wherein the host cell is a non-animal plant variety, and wherein the host cell further comprises a recombinant influenza a virus according to any one of claims 1 to 9.

22. The host cell of claim 21, wherein the heterologous nucleotide sequence is selected from the group consisting of:

(a) The nucleotide sequence shown in SEQ ID NO. 28;

(b) The nucleotide sequence shown in SEQ ID NO. 9; and

(c) A nucleotide sequence encoding a polypeptide having the amino acid sequence shown in SEQ ID NO. 5.

23. The host cell of claim 21, wherein the virus does not express a functional M2 protein.

24. The host cell of claim 23, wherein the mutant M gene consists of a nucleotide sequence selected from the group consisting of:

(i) The nucleotide sequence shown in SEQ ID NO. 1;

(ii) The nucleotide sequence shown in SEQ ID NO. 2;

(iii) The nucleotide sequence shown in SEQ ID NO. 3.

25. The host cell of claim 23, wherein the mutation in the M gene is: the nucleotides at positions 786-791 corresponding to SEQ ID NO. 28 are replaced with two stop codons, and the nucleotides at positions 792-842 corresponding to SEQ ID NO. 28 are deleted, wherein the two stop codons are TAA TAGs.

26. The host cell of claim 21, wherein the host cell is modified to express a 2, 6-sialic acid receptor.

27. The host cell of claim 21, wherein the host cell is a eukaryotic cell.

28. The host cell of claim 26, wherein the host cell is a Vero cell or a chinese hamster ovary cell.

Images