CN109644775B - Morchella strain YD99 and cultivation method thereof - Google Patents

Abstract

The invention discloses a morchella strain YD99 and a cultivation method thereof. The invention provides a mushroom tripe fungus strain YD99, which belongs to Auricularia rugosa (Auricularia delicata) and is preserved in the China general microbiological culture Collection center of the culture Collection of microorganisms with the address: the microbial research institute of China academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, has a preservation number of CGMCC NO.16099 and a preservation date of 2018, 8 months and 31 days. The agaricus rhinaceus strain YD99 is obtained, market diversity requirements are met, and the agaricus rhinaceus strain is good in marketability and high in dry ear soaking rate. The sporocarp colloid has the characteristics of high quality, good nutrition, high yield, good commodity and good market prospect.

Description

Morchella strain YD99 and cultivation method thereof

Technical Field

The invention relates to the technical field of edible fungi, in particular to a mushroom morel strain YD99 and a cultivation method thereof.

Background

The edible fungi refer to large fungi which can be eaten by people, have the characteristics of being visible by naked eyes and being picked by hands, and have sporocarp with different shapes. Auricularia rugosa (Auricularia delicata, Latin) belongs to Basidiomycota (Basidiomycota), Agaricales (Agaricamycetes), Auriculariales (Aricillaries), Auriculariaceae (Auriculariaceae), and Auricularia (Auricularia). Also named as Tremella fuciformis (Fujian), Tremella fuciformis (Shandong), Tremella fuciformis (Guangxi), Teucrium indicum (Shennongjia), Vermilion (Yunnan), etc. China is the earliest country for cultivating edible fungus in the world, the artificial cultivation of edible fungus has been recorded in more than 1000 years of history in China, the 7 th century of Gongyuan, and the Tang's right of medicine Property treatise (about 581-618). At present, with the vigorous development of the edible fungus industry, agaric fungi are widely cultivated in China, and great economic value and social value are created. In 2017, the total output of black fungus in China reaches more than 600 million tons, and the black fungus is the fourth most cultivated edible fungus in the world. However, of all known edible fungi, about 80 kinds of edible fungi capable of forming fruiting bodies by artificial domestication culture are available, 50 kinds of edible fungi having commercial value and capable of being produced on a large scale are available, and nearly 30 kinds of edible fungi have been used for processing and producing health food and medicines. Therefore, the discovery of new strains of high-quality edible fungi for human cultivation is urgently needed in the field.

The wrinkled agaric has the advantages of food and medicine, is mainly distributed in tropical zone and subtropical zone, is mainly distributed in the south area of south ridge in China, grows on rotten wood of broad-leaved trees, has the functions of moistening lung and enriching blood, reducing blood pressure, relieving cough, relaxing bowels and treating hemorrhoids, can improve the immunity of the organism, and has good prevention and treatment effects on diseases such as coronary heart disease, arteriosclerosis and the like. Because the surface of the fruiting body of the wrinkled agaric has obvious wrinkled pores, the wrinkled agaric is very easy to distinguish from other species of agaric. The agaric has excellent commodity characters and wide distribution in south China, but commercial production is not formed, so that the agaric has very important cultivation value.

With the improvement of living standard of people, more and more people begin to realize the function of edible fungi in the aspect of food therapy health care, but because the prior art has limited domestication and cultivation technology of wild edible fungi, the wild edible fungi which can be artificially cultivated at present have fewer varieties. Therefore, the discovery of the artificial culturable varieties of edible fungi and the cultivation methods thereof are yet to be developed.

Disclosure of Invention

In view of the defects of the prior art, the invention aims to provide a morel mushroom strain YD99 and a cultivation method thereof, and aims to solve the problems that the agaric strains used in the prior production are difficult to artificially cultivate, the agaric is difficult to grow in the artificial cultivation process, the yield is low, and the quality is poor.

The technical scheme of the invention is as follows:

the invention provides a mushroom tripe ear bacterial strain YD99, which belongs to wrinkled agaric and is preserved in China general microbiological culture Collection center, and the addresses are as follows: the microbial research institute of China academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, with the preservation number of CGMCC NO.16099 and the preservation date of 2018, 8 and 31 days, is named as Tremella (Latin name Auricularia delicata) by biological classification. The mushroom tripe fungus strain YD99 is obtained by domesticating and cultivating the auricularia polytricha strain and then performing systematic breeding.

The morchella strain YD99 is characterized in that:

1. morphological characteristics

Hyphae of morchella strain YD 99: the mycelium is white, fine, uniform and consistent, grows flatly on a culture medium, the edges of bacterial colonies are neat, after the mycelium emerges from ears, the marketability is good, and the dry ear foam expansion rate is high. Colloid of fruit body, ear shape or round shape, no handle, obvious basal part for growing, soft bone after drying, nearly white layer of fruit body, obvious grid fold, yellow to yellow brown sterile face, nearly black after drying, short villus, and spore in sausage shape, colorless and transparent, and single or group growing.

2. Biological Properties

The mushroom toadstool strain YD99 has the following nutrient components: coarse wood chips, fine wood chips, bran and the like, wherein the water content is 59-60 wt%. The culture temperature of mycelium of the morchella strain YD99 is 25-28 ℃, the humidity is 58% -60%, and CO is set₂The concentration is 800 ppm to 1000ppm, and the culture period is 18 d to 25 d. The growth temperature range of the sporocarp is 19-35 ℃, and the optimal temperature is 22-25 ℃. The mycelium is high temperature resistant, and can still recover growth after being placed on a mother culture medium for 24 hours at 42 ℃.

Compared with the prior art, the morchella esculenta YD99 has the characteristics of thick fruiting body and flesh, delicious taste, crisp and tasty mouthfeel, short growth cycle, precocity, strong impurity resistance, high survival rate and the like, effectively improves the commodity characters of the wrinkled agaric such as mouthfeel, texture and the like, and ensures that the product has unique competitiveness in the market.

4. Nutrient composition

The mushroom tripe YD99 contains 1235 kj/100 g of energy, 7.21 g/100 g of protein, 29.3 g/100 g of total dietary fiber, 58.4% of total sugar, 5.26 mg/100 g of sodium, 48.4 g/100 g of carbohydrate, 11% of water, 2.6 g/100 g of ash, 1.5 g/100 g of fat, and 0.159 g/100 g of total saturated fatty acids (methyl dodecanoate, methyl tridecanoate, methyl tetradecanoate, methyl pentadecanoate, methyl heptadecanoate, methyl octadecanoate and methyl eicosanoate), contains 16 amino acids, and respectively: 0.54 g/100 g of aspartic acid, 0.29 g/100 g of threonine, 0.29 g/100 g of serine, 0.68 g/100 g of glutamic acid, 0.29 g/100 g of glycine, 0.4 g/100 g of alanine, 0.36 g/100 g of valine, 0.032 g/100 g of methionine, 0.21 g/100 g of isoleucine, 0.4 g/100 g of leucine, 0.16 g/100 g of tyrosine, 0.26 g/100 g of phenylalanine, 0.28 g/100 g of lysine, 0.12 g/100 g of histidine, 0.3 g/100 g of arginine and 0.26 g/100 g of proline. The total amount of amino acids was 4.87 g/100 g. Research results show that the mushroom tripe YD99 has high content of dietary fiber and plays a good role in digestion, absorption and metabolism of a plurality of nutrient substances in human bodies; meanwhile, the total content of amino acid is higher than that of the agaric, and the agaric plays an important role in the processes of regulating physiological functions and catalyzing metabolism.

5. Cultivation technique

Preparing a mother seed: the mother culture medium of the morchella strain YD99 is a PDA culture medium: the potato peeling agent comprises 200g of peeled potatoes, 20g of glucose, 20g of agar and 1000mL of water, and the pH = 6.5-6.7. Cutting peeled potato into 1cm pieces³And (3) boiling the mixture in boiling water for 15-20 min, filtering the mixture by 6 layers of gauze, boiling the filtrate again, adding agar, stirring the mixture continuously, adding glucose after the agar is completely dissolved, and fixing the volume to 1000 mL. Loading into a test tube or a triangular flask, and sealing with a rubber plug or a cotton plug and covering with aluminum foil paper. Sterilizing at 121 deg.C under high pressure for 30 min. Cooling to about 25 ℃, inoculating the morchella strain YD99 into an ultraclean workbench, then putting into a constant-temperature incubator at 25 ℃, culturing in dark light for about 12 days, and then growing the mother seeds.

Making original seeds of the mushroom tripe YD99 branches: dispersing and soaking the prepared branches into lime water with the water content of 0.5 wt%, taking out the branches until the branches are soaked to be free of white cores, draining excessive water on the surfaces of the branches, enabling the surfaces of the branches to be fully stained with wheat bran with the water content of 50 wt%, putting each 30 branches into a group of fungus bags with the specification of 12cm multiplied by 20cm, filling gaps in the fungus bags with the wheat bran with the water content of 55 wt%, and inserting a plug in the middle of each group of branches to serve as a reserved inoculation opening. Sterilizing at 121 deg.C for 60min, and cooling to below 60 deg.C when the pressure of autoclave is 0 MPa. And (3) placing the sterilized branches into a super-clean workbench, cooling to 25-30 ℃, inoculating under an aseptic condition, inoculating the prepared mushroom tripe YD99 mother seeds, marking the inoculated branches, placing into a constant-temperature incubator at 25 ℃, culturing in dark light for about 30-35 days, and growing the original seeds.

Preparing a fungus bag of the mushroom tripe YD 99: the formula of the fungus bag for producing the mushroom tripe YD99 comprises the following components: 65 wt% of coarse sawdust, 20.30 wt% of fine sawdust, 12.20 wt% of wheat bran, 1.65 wt% of gypsum, 0.85 wt% of lime and 59 wt% of water, wherein the pH value is adjusted to be 7.5-8.0 before sterilization. Accurately weighing coarse sawdust according to the formula requirement, pre-wetting the coarse sawdust in advance for 24 hours, accurately weighing various raw materials, uniformly mixing the fine sawdust with wheat bran, uniformly mixing bean flour, lime and gypsum, mixing the fine sawdust and the pre-wetted coarse sawdust together after the fine sawdust and the wheat bran are uniformly mixed, adding water to adjust the water content to be 59 wt%, and fully and uniformly mixing all the raw materials. Bagging is carried out by using a horizontal bagging machine, and 1.25kg of each strain is guaranteed. Inserting a plug rod into a preformed hole for feeding the redundant fungus bag nest above the fungus bag, wherein the preformed hole is convenient for accessing the original strain of the prepared mushroom tripe YD 99. Placing the prepared fungus bags in a normal pressure sterilization pot, and keeping for 12h after the temperature in the pot is raised to 100 ℃. After the sterilization is finished, the fungus bags are taken out of the pot when the temperature in the pot is reduced to below 60 ℃, the fungus bags are placed into an inoculation box, and the chlorine dioxide medicament is used for carrying out medicinal fumigation treatment, so that the inoculation operation can be carried out when the medicinal flavor is reduced and the smoke is scattered completely.

And (3) fungus bag culture of mushroom tripe YD 99: the culture room is disinfected three days before the fungus bags enter, environment monitoring is carried out, and the fungus bags can be placed for culture after the fungus bags are detected to be qualified. And (4) placing the bacterium bag which is inoculated in the qualified environment in a culture room for culture, and performing fumigation treatment on the bacterium bag in the first three days of entering the culture room. The temperature of the culture room is kept at 25 +/-1 ℃ for 7 days before the culture of the fungus bags, the temperature of the culture room is reduced to 23 +/-1 ℃ for 7-15 days, and the temperature is reduced to 20 +/-1 ℃ after the culture of the fungus bags is carried out for 15 days. The bags were placed in the chamber 7 days later, and ventilated twice every day at 8 am and 6 am. And (5) carrying out the ear outlet work after the fungus bag is cultured.

And (3) accelerating germination management of mushroom tripe YD 99: and classifying the cultured fungus packs according to the numbers, and treating each numbered fungus pack independently. Adjust the puncher before using, 18 rows of gyro wheels of installation and each gyro wheel interval equal on the puncher, adjust the degree of depth of punching and be 5~ 8mm, and the puncher surface that has adjusted is disinfected with 75% alcohol, can punch the fungus package after accomplishing the adjustment and disinfecting, and every fungus package punches 234~280, and the fungus package that will accomplish to punch is good according to the serial number, carries out vernalization work. And covering a plastic film and a straw curtain on the perforated fungus bags to ensure the temperature and the humidity. The humidity is controlled to be 80-85%, namely a thin layer of water vapor is always kept on the surface of the fungus bag, and watering work cannot be carried out when the temperature is lower than 16 ℃; during the germination accelerating period, the consumption of oxygen by the fungus bags is small, large ventilation is not needed, and ventilation is only ensured to be performed at about ten o' clock in the morning; the optimal temperature of the mushroom tripe YD99 during germination accelerating is 20-26 ℃, direct sunlight is avoided during germination accelerating, and scattered light is beneficial to forming primordia.

And (3) mushroom tripe YD99 fruiting management: ear emergence management mainly comprises two stages, namely an primordial differentiation ear stage and an ear unfolding stage. The air humidity of the primordial differentiation lug stage is always kept at 85-90%, and the times of avoiding dry-wet alternation are reduced; the temperature is controlled to be 20-26 ℃, and the temperature is prevented from exceeding 30 ℃; the primordium differentiation stage needs high-concentration oxygen, ventilation is increased, and the concentration of carbon dioxide is not higher than 1000 ppm. When the primordium is differentiated into 1 cm-sized lugs, the watering is stopped for 48h, and after the lugs are completely dried, the watering is carried out again. And (3) a lug expanding stage, stopping watering when the temperature is lower than 19 ℃, and watering for 3min every time every four hours when the temperature is between 19 and 25 ℃ by taking the total moisture of the mushroom tripe YD99 lugs as a standard.

Has the advantages that: the morchella strain YD99 provided by the invention meets the market diversity requirements, and has good marketability and high dry ear soaking rate. The sporocarp colloid has the characteristics of high quality, good nutrition, high yield, good commodity and good market prospect.

Drawings

FIG. 1 is a DNA agarose gel electrophoresis picture of a strain to be detected.

FIG. 2 is a phylogenetic tree of Morchella strain YD 99.

Detailed Description

The present invention provides a morchella strain YD99 and a cultivation method thereof, and the present invention is further described in detail below in order to make the purpose, technical scheme and effect of the present invention clearer and clearer. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

EXAMPLE 1 isolation and purification procedure of Strain "Auricularia auricula 01

1) The strain of Auricularia auricula collected in Jiangxi province is naturally aired, and the specimens are preserved in the engineering research center of edible fungi education department of Jilin agriculture university.

2) Preparation of culture Medium

PDA culture medium: peeled potato 200g, glucose 20g, agar 20g, water 1000ml, pH = 6.6. Cutting peeled potato into 1cm pieces³Decocting in boiling water for 18 min, filtering with 6 layers of gauze, boiling the filtrate again, adding agar, stirring, adding glucose after agar is completely dissolved, and metering to 1000 ml. The mixture is put into a test tube, and the rubber plug is sealed and covered with aluminum foil paper. Sterilizing at 121 deg.C under high pressure for 30 min.

3) Strain isolation (tissue isolation) of "wrinkled Auricularia 01

Placing PDA slant test tube, sterile culture dish, penicillin, tweezers, etc. into a superclean bench, and ultraviolet sterilizing for 30 min. After the ultraviolet sterilization is finished, the hands, the tweezers and the ear pieces to be separated are disinfected by 75% alcohol cotton, so that the base number of mixed bacteria is reduced. 10 ml of 75% alcohol and one penicillin was added to each of the two plates, and the plates were named as No.1 and No. 2. Removing the inward-rolling part of the edge of the white variant ear with forceps, and clamping to obtain a part of about 3 mm in the smooth part of the ear without wrinkles²The required quantity of the ear slices is put into a No.1 culture dish and placed for 1min, then the ear slices are taken out and put into a No. 2 culture dish and placed for 1min, and the sterilized and cooled tweezers are used for clamping the ear slices to quickly shuttle from the flame of the alcohol lamp for 1 s and then put into a test tube. And (4) placing the separated test tube into a constant-temperature incubator at 26 ℃ for culture. And after 5 days of culture, picking out the regularly grown front-end hyphae in the culture dish, quickly transferring the front-end hyphae to another PDA slant culture medium or the culture dish for purification culture, taking the front-end hyphae as pure strains, and placing the pure strains in a constant-temperature incubator at 26 ℃ for culture. And (3) selecting a strain with thick, dense and uniform hyphae and high hyphae growth speed, and numbering the strain as the wrinkled agaric 02.

Example 2 separation and purification of Mycoleptodonoides aitchisonii Strain "Tremella 02

1) The technical route is as follows: preparing a nutrient agar culture medium → preparing a liquid strain → preparing a culture medium → inoculating and culturing → accelerating germination and growing of ears → selecting a mushroom tripe YD99 strain.

2) Preparation of nutrient agar culture medium

Putting 10 g of peptone, 10 g of glucose, 5g of sodium chloride and 5g of beef extract into a large beaker; adding 1000ml of water, and after completely dissolving, adjusting the pH value to 6.8-7.5; subpackaging in small triangular bottles (200 ml), plugging with kraft paper for sealing; the sterilization and heat preservation time of the culture medium is 121 ℃ and 15 min.

3) Liquid strain preparation

Uncovering the flat plate cover by using an uncovering clamp, and clamping the flat plate by using a clamp for supporting the flat plate; scraping off aerial hyphae of the agaric 02 wrinkled on the surface of the flat plate by using an inoculation hook; uniformly cutting 4 mm-sized strain blocks of the auricularia auricula 02 at a position 2cm away from the old inoculation block by using an inoculation knife; fixing the flat plate in a clamp for supporting the flat plate, placing the flat plate on a tripod to burn an inoculation hook, and placing the flat plate on a tool rack for cooling; taking off the aluminum platinum paper, pulling out the bottle stopper by using crucible tongs, and placing the crucible tongs and the bottle stopper on a tool rack to keep the bottle stopper free of object contact; taking 4 pieces of strain of the wrinkled agaric 02 by using an inoculation hook, and transferring the strain into a shake flask; covering the bottle stopper, and sealing aluminum platinum paper; the date of the mother culture and the date of inoculation are recorded on a shake flask and are placed into a shaking table for cultivation at 25 ℃ and 180 r/min.

4) Cultivation medium preparation

Wood chip culture medium: 65 wt% of coarse wood chips, 20.30 wt% of fine wood chips, 12.20 wt% of wheat bran, 1.65 wt% of gypsum, 0.85 wt% of lime, 59 wt% of water content, and adjusting the pH =7.8 before sterilization. Accurately weighing coarse sawdust according to the formula requirement, pre-wetting the coarse sawdust in advance for 24 hours, accurately weighing various raw materials, uniformly mixing the fine sawdust with wheat bran, uniformly mixing bean flour, lime and gypsum, mixing the fine sawdust and the pre-wetted coarse sawdust together after the fine sawdust and the wheat bran are uniformly mixed, adding water to adjust the water content to be 59%, and fully and uniformly mixing all the raw materials. Bagging is carried out by using a horizontal bagging machine, and 1.25kg of each strain is guaranteed. And inserting the plug rod into a preformed hole for feeding the redundant fungus bags above the fungus bags, wherein the preformed hole is convenient for inoculation. Placing the prepared fungus bags in a normal pressure sterilization pot, and keeping for 12h after the temperature in the pot is raised to 100 ℃. After the sterilization is finished, the fungus bags are taken out of the pot when the temperature in the pot is reduced to below 60 ℃, the fungus bags are placed into an inoculation box, and the chlorine dioxide medicament is used for carrying out medicinal fumigation treatment, so that the inoculation operation can be carried out when the medicinal flavor is reduced and the smoke is scattered completely.

5) Inoculation and culture

According to the aseptic operation specification, liquid strains are inoculated into the cultivation bags according to 25 ml per bag, and the fungus bags which are inoculated are placed in a constant-temperature incubator. The temperature of the culture room is kept at 25 ℃ for the first 7 days of the culture of the fungus bags, the temperature of the culture room is reduced to 23 ℃ for 10 days, and the temperature is reduced to 20 ℃ after the culture of the fungus bags is carried out for 15 days. The bags were placed in the chamber 7 days later, and ventilated twice every day at 8 am and 6 am. And (5) carrying out the ear outlet work after the fungus bag is cultured. Recording the indoor temperature of the early, middle and late culture rooms and the time for hypha to grow over the fungus bags.

6) Accelerating germination and growing ear

And classifying the cultured fungus packs according to the numbers, and treating each numbered fungus pack independently. Adjust the puncher before using, 18 rows of gyro wheels of installation and each gyro wheel interval equal on the puncher, adjust the degree of depth of punching and be 6 mm, and the puncher surface that has adjusted is disinfected with 75% alcohol, can punch the fungus package after accomplishing the adjustment and disinfecting, and every fungus package punches 260, and the fungus package that will accomplish to punch is good according to the serial number, carries out vernalization work.

The humidity is controlled to be 82 percent, namely a thin layer of water vapor always exists on the surface of the fungus bag, and the watering work cannot be carried out when the temperature is lower than 16 ℃; during the germination accelerating period, the consumption of oxygen by the fungus bags is small, large ventilation is not needed, and ventilation is only ensured to be performed at about ten o' clock in the morning; the optimal temperature during the germination accelerating period is 20-26 ℃, direct sunlight is avoided during the germination accelerating period, and scattered light is helpful for the formation of primordia. And recording the temperature and humidity of the space and the forming time of the primordium of each numbered fungus package.

After primordium is formed on the surface of the fungus bag, the air humidity is always kept 88%, and the times of avoiding alternation of dry and wet are reduced; controlling the temperature at 22 deg.C, avoiding the temperature exceeding 30 deg.C, requiring high concentration oxygen in the primordial differentiation stage, increasing ventilation, and adding CO₂The concentration should not be higher than 1000 ppm. When the primordia differentiate to 1cm largeStopping watering for 48h when the ear is small, and watering again after the ear is completely dry. And a lug expanding stage, namely stopping watering when the temperature is lower than 19 ℃, and watering for 3min every time every four hours when the temperature is between 22 ℃, wherein the standard that the mushroom tripe YD99 lugs are completely wetted is taken as a standard. Recording the temperature and humidity of the early, middle and late spaces and the unfolding time of the fungus sacks with the numbers.

Selecting a mushroom tripe YD99 strain: through systematic screening, a tremella fuciformis specimen with thick and strong auricle, round and neat character and better pattern is obtained from 3200 pieces of tremella fuciformis strains, and the specimen and the strain which is subjected to tissue separation and purification are named as mushroom tripe YD 99.

Example 4 biological Property experiments

1) Growth rate test

Inoculating the activated strain into PDA culture medium with a hole puncher with diameter of 7mm, and culturing in a constant temperature incubator at 26 deg.C. And (5) designing for repetition, recording the growth distance of hyphae every 24 hours by taking the inoculation time as a standard, and finishing measurement when the hyphae grow over the PDA culture medium.

PDA culture medium is used as basic culture medium, starch, lactose, sucrose, glucose and dextrin are treated with 5 carbon sources, peptone, yeast extract powder and beef extract are treated with 3 nitrogen sources, each treatment is repeated for 5 times, and the growth rate and growth vigor of hyphae are recorded.

Inoculating activated strain into PDA plate culture medium with a hole puncher having a diameter of 7mm, and culturing at 15 deg.C, 20 deg.C, 25 deg.C, 30 deg.C and pH 5, 5.5, 6, 7, and 8. 5 replicates were set for each treatment and hyphal growth rate and vigor were recorded.

The results of the experiment are reported in the following table:

TABLE 1 growth Rate

Table 2, influence of different carbon sources on growth of hypha of the fungus tripe YD99 strain

TABLE 3 influence of different nitrogen sources on the growth of hypha of the strain Mylar Coprinus comatus YD99

As can be seen from tables 1, 2 and 3, the growth rate of the mushroom tripe YD99 is 0.625cm/d, and the most suitable carbon source is sucrose, lactose and dextrin in terms of the growth rate and the hypha concentration; the most suitable nitrogen source is yeast extract powder.

2) Effect of temperature and pH on the growth of the hyphae of Mylar Coprinus comatus YD99

TABLE 4 influence of temperature on the growth of hyphae of the mushroom tripe YD99

TABLE 5 Effect of PH on mycelial growth of Cochlearia gigantea YD99

The optimal growth temperature is 30 ℃, and hyphae grow faster and are stronger. Hyphae can grow at pH 6, with an optimum pH of 6, and a secondary pH of 5.5.

Example 5 agronomic trait experiments on Gaster Sus Domestica YD99

In this example, the fruiting bodies of the respective strains harvested in example 4 were stored in a reserved sample, and morphological characteristics of dry and fresh ear pieces were recorded (since the experiments all used a small-hole ear-forming method, the diameter of the harvested fruiting body was controlled to 5.0 cm, and the diameter of the ear piece was not recorded). The ear slices have more folds and form grids, the thickness of the ear slices is 2mm, the weight of each hundred slices is 256g, the color of the ventral surface of a dry ear is light reddish brown, the color of the back surface of the dry ear is light reddish brown, the mushroom tripe YD99 is expressed as a single slice when the commercial property is the best through the integral analysis, and the ear slices are tidy when the small holes are out of the ears.

Example 6 large subunit LSU assay:

in this example, LSU sequencing was performed by the Committee for the Biotechnology engineering (Shanghai) Inc. (hereinafter referred to as "Producer"), and included the following procedures:

and (3) extracting a genome: extracting according to the instruction of the kit for extracting the genome DNA of the fungal organism. The resulting DNA solution was stored at-20 ℃ and refrigerated for further use.

PCR amplification and system establishment (25. mu.L): the detected DNA is used for identifying the species relationship by using LROR and LR7 as upstream and downstream primers,

LROR sequence is 5-ACCCGCTGAACTTAAGC-3';

LR7 had the sequence 5'-TACTACCACCAAGATCT-3', 10 XBuffer 2.5. mu.l, MgCl₂2.5. mu.l, dNTP 0.6. mu.l, upstream primer (pmol/L) 1. mu.l, downstream primer (pmol/L) 1. mu.l, genomic DNA (. mu.L) 5. mu.l, Taq DNA Polymerase (5U/L) 0.25. mu.l, ddH₂O14.65. mu.l. PCR procedure: pre-denaturation at 94 ℃ for 1 min; denaturation at 94 ℃ for 30 s; annealing at 50 deg.C for 1 min; extension 72 ℃ for 90 s, 34 cycles; stretching for 10 min at 72 ℃.

The LSU sequence sequencing result of the strain auricularia auricula 02 of the experiment is as follows:

gattcccctagtaacggcgagtgaagcgggaagagctcaaatttgaaatctggcggcctcaggtcgtccgagttgtaatctagagaggtgttttccgtgccggaccgtgtacaagtcccttggaacagggcgtcatagagggtgagaatcccgtccatgacacggactcccggtgctctgcgatacaccttcaaagagtcgagttgtttgggaatgcagctcaaaacgggtggtaaattccatctaaagctaaatacaggcgagagaccgatagcgaacaagtaccgtgagggaaagatgaaaagaactttggaaagagagttaaacagtacgtgaaattgttgaaagggaaacgcttgaagtcagtcgcgtctgccaggactcagccttgcttctgcttggtgcacttcttggtggatgggccagcatcgattttggtcgccggaaaagggtgggaggaatgtggcagcttttgctgtgttatagccttctgtcgtacacggtggttgggatcgaggactgcagcacgcctttggtcggggttcgcccacgccacgtgcttaggatgctggcgtaatggctttaaacgacccgtcttgaaacacggaccaaggagtctaacatgcctgcgagtgtttgggtgcaaaacccaggcgcgtaatgaaagtgaaaagttgggactctttagtgaggcaccgacgcccgaccctgaagtcttctgacgggtttgaggcagagcatgtatgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaggctcgtagcgattctgacgtgcaaatcgatcgtcaaatttgggtataggggcgaaagactaatcgaaccatctagtagctggttcctgccgaagtttccctcaggatagcagaaactcgcatcagttttatgtggtaaagcgaatgattagaggccttggggttgaaacaaccttaacctattctcaaactttaaatatgtaagatcggaccgtcacttgattggaccgtctggcgaatgagagtttctagtgggccatttttggtaagcagaactggcgatgcgggatgaaccgatcgcgaggttaaggtgccggaatacacgctcatcagacaccacaaaaggtgttagttcatctagacagcaggacggtggccatggaagtcggaatccgctaaggagtgtgtaacaactcacctgccgaatgaactagccctgaaaatggatggcgctcaagcgtgttacccatacctcgccgtcagcgttgaagtgacgcgctgacgagtaggcaggcgtggaggtcag, the sequence of which is 1335bp DNA fragment (as shown in figure 1). The LSU sequence of the auricularia polytricha 02 strain is found to have the highest similarity with the LSU sequence of the auricularia polytricha in the genus of Auricularia according to GenBank. And searching an ITS sequence of a similar species with the agaric, constructing a phylogenetic tree of a test strain by using MEGA software, and identifying the species relationship of the test strain by using the phylogenetic tree, wherein the test strain agaric 02 belongs to the agaric group (as shown in figure 2).

In summary, the present invention provides a morchella strain YD99 and a cultivation method thereof, the morchella strain YD99 belongs to Auricularia auricula (Auricularia auricula), and is deposited in the common microorganism center of the China Committee for culture Collection of microorganisms, and the address is: the microbial research institute of China academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, has a preservation number of CGMCC NO.16099 and a preservation date of 2018, 8 months and 31 days. The agaricus rhinaceus strain YD99 is obtained, market diversity requirements are met, and the agaricus rhinaceus strain is good in marketability and high in dry ear soaking rate. The sporocarp colloid has the characteristics of high quality, good nutrition, high yield, good commodity and good market prospect.

It is to be understood that the invention is not limited to the examples described above, but that modifications and variations may be effected thereto by those of ordinary skill in the art in light of the foregoing description, and that all such modifications and variations are intended to be within the scope of the invention as defined by the appended claims.

Sequence listing

<110> Lixiao of Heilongjiang Hei Zhen Biotechnology Co., Ltd

<120> Morchella strain YD99 and cultivation method thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1335

<212> DNA

<213> Artificial sequence (rengongxulie)

<400> 1

gattccccta gtaacggcga gtgaagcggg aagagctcaa atttgaaatc tggcggcctc 60

aggtcgtccg agttgtaatc tagagaggtg ttttccgtgc cggaccgtgt acaagtccct 120

tggaacaggg cgtcatagag ggtgagaatc ccgtccatga cacggactcc cggtgctctg 180

cgatacacct tcaaagagtc gagttgtttg ggaatgcagc tcaaaacggg tggtaaattc 240

catctaaagc taaatacagg cgagagaccg atagcgaaca agtaccgtga gggaaagatg 300

aaaagaactt tggaaagaga gttaaacagt acgtgaaatt gttgaaaggg aaacgcttga 360

agtcagtcgc gtctgccagg actcagcctt gcttctgctt ggtgcacttc ttggtggatg 420

ggccagcatc gattttggtc gccggaaaag ggtgggagga atgtggcagc ttttgctgtg 480

ttatagcctt ctgtcgtaca cggtggttgg gatcgaggac tgcagcacgc ctttggtcgg 540

ggttcgccca cgccacgtgc ttaggatgct ggcgtaatgg ctttaaacga cccgtcttga 600

aacacggacc aaggagtcta acatgcctgc gagtgtttgg gtgcaaaacc caggcgcgta 660

atgaaagtga aaagttggga ctctttagtg aggcaccgac gcccgaccct gaagtcttct 720

gacgggtttg aggcagagca tgtatgttgg gacccgaaag atggtgaact atgcctgaat 780

agggtgaagc cagaggaaac tctggtggag gctcgtagcg attctgacgt gcaaatcgat 840

cgtcaaattt gggtataggg gcgaaagact aatcgaacca tctagtagct ggttcctgcc 900

gaagtttccc tcaggatagc agaaactcgc atcagtttta tgtggtaaag cgaatgatta 960

gaggccttgg ggttgaaaca accttaacct attctcaaac tttaaatatg taagatcgga 1020

ccgtcacttg attggaccgt ctggcgaatg agagtttcta gtgggccatt tttggtaagc 1080

agaactggcg atgcgggatg aaccgatcgc gaggttaagg tgccggaata cacgctcatc 1140

agacaccaca aaaggtgtta gttcatctag acagcaggac ggtggccatg gaagtcggaa 1200

tccgctaagg agtgtgtaac aactcacctg ccgaatgaac tagccctgaa aatggatggc 1260

gctcaagcgt gttacccata cctcgccgtc agcgttgaag tgacgcgctg acgagtaggc 1320

aggcgtggag gtcag 1335

Claims (3)

1. The morchella strain is YD99, and is preserved in China general microbiological culture Collection center, with the address: the microbial research institute of China academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, has a preservation number of CGMCC NO.16099 and a preservation date of 2018, 8 and 31 days, and is named as wrinkled Auricularia by biological classification and named as Auricularia delacta by Latin.

2. The morchella strain according to claim 1, comprising a fruiting body of the morchella strain YD99, wherein the molecular marker of the fruiting body has a molecular weight of 1335bp, and the sequence of the molecular marker is as follows:

gattcccctagtaacggcgagtgaagcgggaagagctcaaatttgaaatctggcggcctcaggtcgtccgagttgtaatctagagaggtgttttccgtgccggaccgtgtacaagtcccttggaacagggcgtcatagagggtgagaatcccgtccatgacacggactcccggtgctctgcgatacaccttcaaagagtcgagttgtttgggaatgcagctcaaaacgggtggtaaattccatctaaagctaaatacaggcgagagaccgatagcgaacaagtaccgtgagggaaagatgaaaagaactttggaaagagagttaaacagtacgtgaaattgttgaaagggaaacgcttgaagtcagtcgcgtctgccaggactcagccttgcttctgcttggtgcacttcttggtggatgggccagcatcgattttggtcgccggaaaagggtgggaggaatgtggcagcttttgctgtgttatagccttctgtcgtacacggtggttgggatcgaggactgcagcacgcctttggtcggggttcgcccacgccacgtgcttaggatgctggcgtaatggctttaaacgacccgtcttgaaacacggaccaaggagtctaacatgcctgcgagtgtttgggtgcaaaacccaggcgcgtaatgaaagtgaaaagttgggactctttagtgaggcaccgacgcccgaccctgaagtcttctgacgggtttgaggcagagcatgtatgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaggctcgtagcgattctgacgtgcaaatcgatcgtcaaatttgggtataggggcgaaagactaatcgaaccatctagtagctggttcctgccgaagtttccctcaggatagcagaaactcgcatcagttttatgtggtaaagcgaatgattagaggccttggggttgaaacaaccttaacctattctcaaactttaaatatgtaagatcggaccgtcacttgattggaccgtctggcgaatgagagtttctagtgggccatttttggtaagcagaactggcgatgcgggatgaaccgatcgcgaggttaaggtgccggaatacacgctcatcagacaccacaaaaggtgttagttcatctagacagcaggacggtggccatggaagtcggaatccgctaaggagtgtgtaacaactcacctgccgaatgaactagccctgaaaatggatggcgctcaagcgtgttacccatacctcgccgtcagcgttgaagtgacgcgctgacgagtaggcaggcgtggaggtcag。

3. a cultivation method of a Turkish tripe strain according to any one of the claims 1 to 2, characterized by comprising the following steps:

(1) and preparing a mother seed of the mushroom toadstool strain YD99, wherein a mother seed culture medium of the mushroom toadstool strain YD99 is a PDA culture medium: peeling 200g of potatoes, 20g of glucose, 20g of agar and 1000mL of water, wherein the pH value is 6.5-6.7, putting the PDA culture medium into a test tube or a triangular flask, sealing a rubber plug or a cotton plug and covering aluminum foil paper, sterilizing for 30min at the temperature of 121 ℃, cooling to 25 ℃, adding a mushroom white fungus strain YD99 into a workbench, then putting the workbench into a constant-temperature incubator at the temperature of 25 ℃, and culturing in the dark for 12 days;

(2) soaking the branches in lime water, taking out the branches until the branches are soaked to be free of white cores, draining water on the surfaces of the branches, soaking wheat bran with the water content of 50 wt% on the surfaces of the branches, putting each 30 branches into a group of branches into a fungus bag with the specification of 12cm multiplied by 20cm, filling gaps in the fungus bag with the wheat bran with the water content of 55 wt%, inserting a rod in the middle of each group of branches to serve as an inoculation reserved opening, sterilizing at 121 ℃ for 60min, taking the branches out of the fungus bag when the pressure of an autoclave is reduced to 0MPa after sterilization is finished, reducing the temperature to be below 60 ℃, putting the branches which are sterilized into a workbench, cooling to 25-30 ℃, inoculating under the aseptic condition, inoculating the prepared mushroom tripe YD99 mother seeds, marking the inoculated branches, putting the branches into a constant-temperature incubator at 25 ℃, and culturing in dark light for 30-35 d;

(3) the fungus bag is prepared by the following formula of fungus bag for producing mushroom tripe YD 99: 65 wt% of coarse wood chips, 20.30 wt% of fine wood chips, 12.20 wt% of wheat bran, 1.65 wt% of gypsum, 0.85 wt% of lime and 59 wt% of water, wherein the pH value is adjusted to 7.5-8.0 before sterilization, the fungus tripe YD99 is subjected to bagging treatment by taking out of an fungus bag formula to ensure that each fungus bag weighs 1.25kg, redundant fungus bags above the fungus bags are placed in reserved holes of feed materials, inserting rods are inserted, the prepared fungus bags are placed in a sterilization pot, after the temperature in the pot is increased to 100 ℃, the pot is kept for 12 hours, after the sterilization is completed, the temperature in the pot is reduced to below 60 ℃, the fungus bags are taken out of the pot, the fungus bags are placed in an inoculation box and are subjected to medicine fumigation treatment by using chlorine dioxide medicine, and after the medicine smell is reduced, the smoke is scattered to;

(4) and culturing fungus bags: the method comprises the following steps that a culture room is disinfected three days before fungus bags enter, environment monitoring is carried out, the fungus bags are placed into the culture room for culture after the fungus bags are detected to be qualified, the fungus bags which are inoculated are placed into the culture room with qualified environment for culture, the medicine fumigation treatment is still carried out three days before the fungus bags enter the culture room, the temperature of the culture room in the first 7 days of the fungus bag culture is kept at 25 +/-1 ℃, the temperature of the culture room in the 7-15 days is reduced to 23 +/-1 ℃, the temperature of the fungus bag is reduced to 20 +/-1 ℃ after the fungus bag is cultured for 15 days, the fungus bags enter the culture room for 7 days, the fungus bags are ventilated twice in the morning and evening every day, and ear emergence work;

(5) and accelerating germination management: classifying cultured fungus bags according to serial numbers, processing each numbered fungus bag independently, adjusting a punching machine before use, installing 18 rows of rollers on the punching machine, enabling the distance between the rollers to be equal, adjusting the punching depth to be 5-8 mm, disinfecting the surface of the adjusted punching machine by using alcohol, punching the fungus bags after adjustment and disinfection, punching 234-280 fungus bags for each fungus bag, numbering the fungus bags after punching, accelerating germination, covering a plastic film and a straw curtain above the fungus bags after punching, and controlling the humidity to be 80-85%;

(6) and ear emergence management: the ear outlet management comprises an primordial differentiation lug stage and a lug expanding stage, wherein the air humidity of the primordial differentiation lug stage is kept at 85-90%, the temperature is controlled at 20-26 ℃, ventilation needs to be increased in the primordial differentiation stage, the concentration of carbon dioxide is not higher than 1000ppm, when the primordial differentiation lug is 1cm in size, watering is stopped for 48 hours, and after the lug is completely dried, watering is performed again; and (3) a lug expanding stage, stopping watering when the temperature is lower than 19 ℃, and watering for 3min every time every four hours when the temperature is between 19 and 25 ℃ by taking the total moisture of the mushroom tripe YD99 lugs as a standard.

Images