CN109628638B - Detection method based on prawn oriental virus genome sequence and application thereof - Google Patents

Abstract

The invention provides a detection method based on a prawn oriental virus genome sequence and application thereof. The prawn oriental virus (Orientavirus penaei) belongs to bunyavirus and has a preservation number of CCTCC No. V201864. The shape is spherical, and the diameter is 80-120 nm. Can infect Chinese prawn, and has the main symptoms of activity reduction and liver and pancreas lightening. The invention also provides a detection kit for the prawn oriental virus. Provides a new possibility for the detection, prevention and control of the shellfish aquatic product bunyavirus.

Description

Detection method based on prawn oriental virus genome sequence and application thereof

Technical Field

the invention belongs to the field of aquaculture, and particularly relates to a detection method of a prawn oriental virus genome sequence and application thereof.

background

The new named bunyaviridae in the tenth report of the international committee for virus classification are classified into 9 families, 13 genera, the families of the fraviridae (Feraviridae), the ficinaviridae (Fimoviridae), the Hantaviridae (Hantaviridae), the micacardioviridae (Jonviridae), the norovirus (Nairoviridae), the panbunyaviridae (peribuviridae), the phantom virus (phasmaviride), the fibulaviridae (Phenuiviridae) and the tomato spotted wilt virus (Tospoviridae), respectively.

The plataviridae family has only 1 genus of virus: the genus Orthofiavirus (Orthofiavirus), which primarily infects mosquitoes and is incapable of infecting vertebrate cells, belongs to the insect host-restricted virus; the family fici mosaic virus contains the genus Simarovirus (Emaravir), which infects plants and can be transmitted by plant grafting or arthropods such as mites; the hantaviridae family comprises the genus Orthohantavirus (Orthohantavirus), which is transmissible through rodents and predators, and occasionally infects humans as well; the family Micadovidae (Jonviridae) contains Orthokavirus (Orthojo jonavirus), which is a insect host-restricted virus that replicates and expands in a variety of mosquito cells but does not infect vertebrate cells; the family of the viruses comprises the genus ortholactovirus (Orthoniarorivirus), which is mostly transmitted by tick and mosquito vectors, and some viruses can also be transmitted by arthropods such as lice and midges, or by tick and insect between different hosts. The family of the Nairoviridae is distributed in Africa, Asia, Australia, Europe and America, has strong infectivity and high lethality rate, and can cause various serious infectious diseases of human and animals; the panbuyaviridae family consists of the genera Herbacavirus and Orthobunyavirus (Orthobunyavirus), wherein the Orthobunyavirus infects humans and ruminants and causes serious diseases such as fever, encephalitis and hemorrhagic fever in patients; the Phantoviridae family contains orthophantom virus (Orthophasmavir), infects only cockroaches, ulworms and mosquitoes, and belongs to insect host-restricted viruses; the family Celastroviridae consists of the genera Gekko, Pacific (Phasivirus), Phlebovirus (Phlebovirus) and Tenuivirus (Tenuivirus), which are only able to infect mosquitoes and have not been reported to infect other vertebrates and arthropods; the Pasteur virus can infect arthropods such as flies and mosquitoes, and has not been reported to infect vertebrates; the phlebovirus is an arbovirus, can be transmitted by arthropods such as phleboviruses, ticks, midges, mosquitoes and the like to infect various mammals and human beings, and seriously affects the health of the human beings; the parvovirus is a plant virus, can be amplified in plant cells and is spread by plant hoppers and leafhoppers; the family Lycopersicon esculentum (tomato) Zebra virus contains the genus Orthosporium, which is transmitted through plant branches and leaves, and between host plants through insect-vector thrips.

In 1996, an australian scholars first identified a bunyavirus, the moluyan virus (MoV), among the diseased penaeus monodon in the township of north queensland, and subsequently reported in both penaeus japonicus and penaeus monodon in south east asia and australia, and studies have demonstrated that the moly virus is pathogenic to penaeus japonicus. In 2018, an Australian scholaree Sakuna reported that a new bunyavirus was discovered from red crayfish, and phylogenetic evolutionary trees showed that the virus has a recent relationship with the genus Orthobium (Orthobiun yavirus) of the family Panbuyia virinae (Peribunyaviridae), and speculated that the virus is associated with a high mortality rate of red crayfish after long-distance transportation. Currently, bunyavirus capable of infecting crustaceans is found to be limited.

Disclosure of Invention

Aiming at the problem of lack of detection and control of shellfish bunyavirus products at present, the invention provides a prawn oriental virus (Orientavirus penaei) which belongs to a new species of the purpose of the bunyavirus and can infect shellfish.

another object of the present invention is to provide a kit for detecting the above novel bunia virus strain.

In order to achieve the purpose, the invention adopts the following technical scheme.

A strain of prawn oriental virus (Orientavirus penaei), belonging to the order of Bunyaviridae, is preserved in China Center for Type Culture Collection (CCTCC) in 2018, 12 and 06 months, with the preservation address of Wuhan university preservation center and the preservation number of CCTCC No. V201864.

The prawn oriental virus is spherical, and comprises a cyst membrane, a capsid and three segments of negative strand RNA viruses, and the diameter is 70-120 nm. Can infect Chinese prawn (Fenneropenaeus chinensis) and the like, and has the main symptoms of activity reduction and liver and pancreas shallowness.

The genome sequence of the prawn oriental virus is shown as SEQ ID NO 1, SEQ ID NO 2 and SEQ ID NO 3; wherein, the sequence of the L segment is shown as SEQ ID NO. 1, the sequence of the M segment is shown as SEQ ID NO. 2, and the sequence of the S segment is shown as SEQ ID NO. 3.

A kit for detecting a prawn-like oriental virus is a virus belonging to the same genus as the prawn-like oriental virus.

The kit is a kit for detecting by adopting a nucleic acid amplification method or a kit for detecting by adopting an immunoreaction.

Furthermore, the kit is a detection kit by adopting a nucleic acid amplification technology. As the oriental virus is a single-stranded RNA virus, the synthesis of genome RNA is directly replicated by RNA-dependent RNA polymerase, and the RNA-dependent RNA polymerase lacks 3 '-5' error correction function in the RNA replication process, so that the genome is easy to mutate during natural replication, and variation of more than or equal to 70 percent may exist in the whole or partial specific sequence segments of the genome, therefore, the oriental virus also needs to have the detection capability aiming at more than or equal to 70 percent of homologous sequences during detection.

The above-mentioned kit and

(a) all or partial fragments of the RNA sequence or the corresponding DNA sequence shown in SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3; or

(b) The complement of (a); or

(c) Sequences that are 70% or more homologous to (a) or (b) are specific sequences.

The length of the specific sequence is preferably 12-3000 nt; more preferably, the length is 30nt to 1200 nt; most preferably, the length is 40nt to 600 nt.

The kit comprises 1 pair of primers or more than 1 pair of primers.

The primer of the kit can be a specific sequence of a detection sequence or a sequence containing degenerate bases, and can also be a sequence containing locked nucleic acid. In order to detect specific sequences more than or equal to 70% homologous, the simplest way is to regard the mutation site where single nucleotide diversity exists as the degenerate site of the corresponding base, so that a sequence containing degenerate bases of a plurality of mutated bases can be used as a primer sequence; hypoxanthine or other equivalent bases can also be substituted for this degenerate mode.

The length of the primer is 9nt-45 nt; preferably, the length is 15nt to 30 nt; more preferably, the length is 18nt to 25 nt.

Further, the primer is selected from any 2 or more than 2 forward and reverse complementary sequence sequences shown in SEQ ID NO. 4-SEQ ID NO. 26, or specific sequences of SEQ ID NO. 1 among 2 or reverse complementary specific sequences thereof; or any 2 or more than 2 forward and reverse complementary sequences shown as SEQ ID NO. 27-SEQ ID NO. 34, or 2 specific sequences or reverse complementary specific sequences thereof among 2 SEQ ID NO. 2; or any 2 or more than 2 forward and reverse complementary sequence sequences shown in SEQ ID NO. 35-SEQ ID NO. 40, or 2 specific sequences of SEQ ID NO. 3 or reverse complementary specific sequences thereof.

When 1 pair of primers is included, conventional PCR detection, SYBR Green I-stained real-time fluorescent quantitative PCR detection, digital PCR detection, or helicase-dependent isothermal amplification (HDA) detection may be employed.

When more than 1 pair of primers are contained, nested PCR or multiplex PCR detection can be adopted, the nested PCR adopts 2 pairs of nested primers, wherein the 1 pair of primers at the outer side are used as outer primers of the nested PCR for the first-step amplification, and the 1 pair of primers at the inner side are used as inner primers of the nested PCR for the second-step amplification; the multiplex PCR adopts 2 pairs or more pairs of mutually independent primers to detect the prawn oriental viruses or the variant thereof with a plurality of loci or different genotypes.

The method can also adopt the 1 pair of primers as F3 and B3 primers according to the design requirement of loop-mediated isothermal amplification (LAMP) primers, and selects 4 sequences on the inner side of the primers, and designs FIP and BIP primers by assembly for LAMP detection; and 1 pair of primers can be designed in the single-stranded loop region to serve as LF and LB primers for enhancing amplification and be used for rapid LAMP detection.

In the primer design, 3nt-50nt artificial sequence, anchoring sequence or other designed sequence can be connected to the 5' end of the primer, and other amplification detection reactions are carried out according to the anchoring primer multiple amplification detection or gene chip detection principle.

The kit may further comprise a nucleic acid probe. The sequence of the nucleic acid probe is selected from the forward and reverse complementary sequences shown as SEQ ID NO. 4-SEQ ID NO. 26, or the specific sequence of SEQ ID NO. 1 among 2 or the reverse complementary specific sequence thereof; or the sequence shown as SEQ ID NO. 27-SEQ ID NO. 34, or the specific sequence of SEQ ID NO. 2 among 2 strips or the reverse complementary specific sequence thereof; or the forward and reverse complementary sequences shown in SEQ ID NO. 35-SEQ ID NO. 40, or the specific sequence of SEQ ID NO. 3 between 2 or the reverse complementary specific sequence thereof.

The nucleic acid probe can be labeled by the incorporation method of all nucleotides or specific nucleotides, such as DIG-dUTP, with Digoxin (DIG), fluorescein or radioactive isotopes; the probe may also be labeled with DIG, fluorescein, a reporter group, a fluorescence quencher group, a radioisotope, or the like, for example, FAM, HEX, VIC, or the like, labeled at the 5 'end of the probe, TAMRA, or the like, labeled at the 3' end; the kit can be used for directly carrying out independent in-situ hybridization or spot hybridization detection on genomic nucleic acid of the shrimp oriental viruses or other variant homologous viruses, and can also be combined with a real-time quantitative PCR technology for carrying out fluorescence quantitative PCR detection of a TaqMan probe or a Beacon probe.

The detection method of the kit comprises, but is not limited to, conventional Polymerase Chain Reaction (PCR), constant temperature convection PCR, nested PCR, real-time fluorescence PCR, constant temperature convection real-time fluorescence PCR, digital PCR, dot hybridization, in situ hybridization, loop-mediated isothermal amplification (LAMP), rolling circle amplification technology (RCA), single-primer isothermal amplification, helicase-dependent isothermal amplification technology (HDA), cross primer amplification technology and nucleic acid express isothermal detection amplification technology; but also can include but not limited to multiplex PCR, multiplex real-time fluorescence PCR, gene chip and chip detection for 1 strain or more than 1 prawn oriental virus and homologous species or variant species thereof at the same time; but also can include but not limited to the simultaneous detection of multiple PCR, multiple real-time fluorescence PCR, gene chip and chip for the oriental viruses and the homologous species or variant species thereof.

According to the requirement of the method, the detection method can carry out capability authentication on the operation and laboratory management of the corresponding method, develop commercial detection service for the oriental prawn and the homologous species or the variant species thereof, or develop detection for the oriental prawn and the homologous species or the variant species thereof for commercial seedling culture, entry and exit quarantine, origin quarantine and the like; or corresponding reagents and tools can be assembled to be assembled into a kit form to carry out commercial sale or application service of the kit for detecting the oriental viruses of the prawns and the homologous species or the variant species thereof; or developing a matched device on the basis of the detection method, or expanding the detection range of the existing matched device to cover the oriental viruses and the homologous species or the variant species thereof, and carrying out commercial sale or application service on the detection device comprising the oriental viruses and the homologous species or the variant species thereof.

The kit is a kit for detecting by adopting immunoreaction.

Further, the above kit and

(a) 1, 2 or 3, or the complete or partial protein translated by the complementary sequence of the nucleic acid sequence with 70 percent homology is antigen; the antibody of (a) or (b) is a detection substance.

the antigen may be a viral strain whole, a split component, a capsid, a polypeptide, a genetically engineered protein or polypeptide. The antibody may be a polyclonal antibody, a hybridoma cell, a monoclonal antibody or a single chain antibody. The antigen or antibody may be prepared according to methods of the prior art.

The kit can adopt competitive, indirect or sandwich type immunoreaction, and also can adopt a solid support or an immunoprecipitation method. The antibody or antigenic fragment of the prawn oriental virus can be marked by the prior art, such as fluorescent mark, chemiluminescence mark, radioactive mark or enzyme mark. The signal of the amplified probe can be detected by methods of biotin and avidin, enzyme labeling and mediated immunoassay, such as ELISA test.

For example, a kit for detecting the oriental virus antigen of the prawns contains: the kit comprises a solid-phase anti-prawn oriental virus antibody coated pore plate, a confining liquid, a mouse secondary antibody, a secondary antibody enzyme conjugate, a TMB color development liquid, a color development stopping liquid, a tissue lysate, a concentrated washing liquid, a sample diluent, a positive reference substance and a negative reference substance. Wherein, the pore plate coated by the anti-prawn oriental virus antibody is coated by an anti-bunyavirus antibody in advance; the confining liquid is human serum albumin; the sample diluent is PBS; the chromogenic termination solution is concentrated sulfuric acid; the concentrated lotion is tween-20; the secondary antibody enzyme conjugate is horseradish peroxidase-goat anti-mouse IgM enzyme conjugate.

The protective scope of the invention also includes antiserum, polyclonal antibody, hybridoma cell, monoclonal antibody or single-chain antibody of the prawn oriental virus. The antiserum, the polyclonal antibody, the hybridoma cell and the monoclonal antibody are prepared by taking the virus strain of the shrimp oriental virus, the cracking component of the virus strain, and the genetic engineering protein or polypeptide of the virus strain as immunogen according to the method of the prior art.

For example, the antibody against the oriental prawn virus is a polyclonal antibody, and inactivated oriental prawn virus strains or specific antigen fragments thereof, such as: antigenic proteins of L, Gn, Gc, N with suitable adjuvants such as: mixing Freund's complete adjuvant, and administering to animals such as mouse, rabbit, fowl (egg), pig, goat, cattle, and aquatic animals for primary immunization, and optionally administering inactivated virus solution and appropriate adjuvant for secondary immunization, or even three or more times, to improve antibody titer. After a proper time interval, the serum of the immune animal, namely antiserum, is collected and further separated to obtain the polyclonal antibody of the prawn oriental virus.

For another example, the antibody against the oriental shrimp virus is a monoclonal antibody, and a concentrated oriental shrimp virus strain or a specific antigen fragment thereof, e.g., antigen proteins of L, Gn, Gc, N, may be administered to an animal, e.g., a mouse, optionally with an appropriate adjuvant, e.g.,: freund's complete adjuvant for primary immunization. After a suitable time interval, a second immunization is administered, optionally with an inactivated virus (or antigenic protein) and a suitable adjuvant. After appropriate time intervals, sera from immunized animals were collected to evaluate mice suitable for collecting spleen cells. Spleen cells and myeloma cells were collected from the suitable mice, such as: the FO cell line and the NS cell line were subjected to cell fusion with PEG. And (3) screening hybridoma cell strains with secretion capacity from the fusion cells to obtain fusion cell lines, wherein the fusion cell lines can secrete monoclonal antibodies against the shrimp oriental viruses.

The invention has the following advantages:

The prawn oriental virus is a new bunyavirus and can infect Chinese prawn; the kit based on the novel bunyavirus species can detect the bunyavirus. Provides a new possibility for the detection, prevention and control of the shellfish aquatic product bunyavirus.

Biological preservation information

The prawn oriental virus (Orientavirus penaei) has a preservation number of CCTCC No. V201864, and the preservation unit is as follows: china Center for Type Culture Collection (CCTCC), preservation address: the preservation center of Wuhan university in Wuhan, China has the following preservation date: 12 months and 06 days 2018.

Drawings

FIG. 1 is an electron microscope picture of a prawn oriental virus;

FIG. 2 is a phylogenetic evolutionary tree of a prawn oriental virus;

FIG. 3 is an electron microscope picture of pathological analysis of the lymphoid organs of Penaeus chinensis in which virus inclusion bodies are visible;

FIG. 4 is an electron microscope picture of pathological analysis of gill filament of Chinese prawn in which virus inclusion bodies are visible;

FIG. 5 is a 1% agarose gel electrophoresis image of the detection of the shrimp oriental virus.

Detailed Description

The present invention will be further described with reference to the following examples and drawings, but the present invention is not limited to the following examples.

Example 1 isolation, purification and characterization of shrimp Oriental Virus

1.1 isolation and purification

(1) Adding 2-3g of prawn cephalospora into a centrifuge tube, pre-cooling TNEP buffer solution and 200 mu L PMSF isopropanol solution, and homogenizing for 10s at 10,000rpm of a homogenizer under ice bath;

(2) Centrifuging the homogenate at 10,000g for 30min at 4 deg.C in a high speed centrifuge, and retaining the supernatant;

(3) Sequentially filtering out tissue debris, bacteria and other impurities by using filters with pore diameters of 0.45 mu m and 0.22 mu m; centrifuging the supernatant at 100,000g for 180min at 4 deg.C in an ultracentrifuge, soaking in TN buffer solution and slowly shaking to suspend the precipitate, and sucking 10 μ L for electron microscope observation;

(4) According to the TEM scanning result, a sucrose concentration (W/V) gradient of 20%, 31.5%, 43%, 54.5% and 66% is paved in an ultracentrifuge tube from top to bottom, after the ultracentrifuge tube is placed overnight at 4 ℃, supernatant is added to carry out centrifugation for 170min at 130,000g at 4 ℃, samples with glycerol and 54.5% sucrose density are collected, and after desugaring, a virus is obtained and is temporarily named as a prawn oriental virus (Orientavirus pentaei);

(5) Whole genome amplification of viral sequences: on the basis of obtaining a part of novel bunyavirus sequences through high-throughput sequencing, primers are designed on the basis to amplify and verify a whole genome with a long fragment, and then SMARTERRACE cDNA Amplification Kit is adopted to amplify the 3 'end and the 5' end of an S fragment so as to obtain a whole genome sequence, which is shown as SEQ ID NO:1-SEQ ID NO: 3.

TABLE 1 sequencing primer for prawn Oriental virus genome

Primer name	Sequence 5'3'
		L-1F	ccgggtgtgttctaatgaatctac
L-1R	catggatgaaggaaatgggtg
		L-2F	atattgggacgccccctc
L-2R	cgactctgatggagactacctgtt
		L-3F	ctgtttcctccggggtatctc
L-3R	cgatcagtattgtagcagtgcctt
		L-4F	cctagtgtgttattcacacaagcatt
L-4R	gttcaagctgcctgaggaacat
		L-5F	ctatgaaaccatgcatgtaaccag
L-5R	tttgaggtacatgaaatacgtgtgtt
		L-6F	acataagtaccctacatagtttaggttcac
L-6R	tcacagagtggacatagccttagaa
		L-7F	gacattcagcttattactatcgagga
L-7R	cttatgactatgagctgagggagag
		L-8F	tcatcctcctcatggaaagatactc
L-8R	ggtgttgtagtgttgcattggaa
		L-9F	agatgcccttgttaccccga
L-9R	agccatgcttcagtcaattcagt
		M-1F	gtaatcaatgatcgtttagttggtctt
M-1R	atctttacagtgggattggaggtt
		M-2F	tccaagtccttaacatagaagcagtc
M-2R	tatggattaggggcaacattgac
		M-3F	ccaggagaaacagtgtggattg
M-3R	gcttgctgccaacaatgct
		M-4F	ttggggtgatggaataggttg
M-4R	cgggagctacaagtctgccat
		S-1F	acagtggtaagaaggcagacaac
S-1R	gagagcccagggtgataaaca
		S-2F	gacacacagatacacgcacacatac
S-2R	atgccatgggccttggata
		S-3F	tgaaggaagtggcagcagagt
S-3R	taacaatcagaatgcttatggtttg

1.2 species identification

The electron microscope picture of the prawn oriental virus is shown in figure 1, and the virus is spherical and has the diameter of 80-120 nm. Based on the amino acid sequence of RNA-dependent RNA polymerase (RdRp) of viruses of various families (genera) of the order Bunyaviridae, Muscle software was used for alignment, and Mega software was used to construct a maximum similarity phylogenetic tree (FIG. 2) showing that the virus has the closest relationship to the family of the order Bunyaviridae, Fibrivirus family (Phenguiviridae). The RdRp sequences of known strains in the family Cellvirridae are selected to construct a maximum similarity evolutionary tree again, which shows that the virus belongs to a new species in the family Cellvirridae (Pheneuviridae) of the Bunyavirus order, which is classified and located between the genus Pascivirus and the genus phlebovirus. The preservation number is CCTCC No. V201864.

Example 2 infection of Penaeus chinensis by Penaeus orientalis Virus

Taking a diseased Chinese prawn sample to prepare homogenate, carrying out aseptic filtration and ultracentrifugation, and carrying out artificial infection experiments on the diseased Chinese prawn through reverse enema or intramuscular injection, wherein the death rate of the infected Chinese prawn can reach 100 percent within 10 days, and the main symptoms are that the activity is reduced and the hepatopancreas become shallow. The electron microscope pictures of lymphoid organs of Chinese prawn infected with prawn oriental virus are shown in FIG. 4, and the electron microscope pictures of gill silk pathology are shown in FIG. 5. As can be seen from the pictures, virus particles of the shrimp oriental virus are found in both the lymphoid organs and the branchia filaments of Chinese shrimps.

Example 3 PCR kit for detecting prawn Oriental Virus

the PCR kit for detecting the oriental prawn viruses comprises the following components:

Composition (I)	Concentration of
		Ex Taq Buffer (MgCl free)2)	10×
MgCl2	25mM
		dNTP	2.5mM each
L-2613F	10μM
		L-3509R	10μM
L-2688F	10μM
		L-3030R	10μM
Ex Taq enzyme	5U/μL
		Sterile double distilled water	-

Table 2 primer sequences and amplified fragments for detection of shrimp oriental viruses:

Detection was performed with reference to the following methods:

After extracting the suspected infected tissue homogenate of the Chinese prawn, extracting RNA, regulating the RNA concentration to 500 ng/mu L, then carrying out reverse transcription to cDNA, and then carrying out nested PCR amplification by using primers shown in Table 2. The specific reaction system and conditions are as follows:

A large volume premix was prepared except for Taq DNA polymerase, and stored at-20 ℃ in aliquots. Before detection, sucking the enzyme-free premixed solution, adding Taq DNA polymerase with a corresponding volume in proportion, uniformly mixing, and subpackaging 24 mu L/tube. First round amplification procedure: denaturation at 94 deg.C for 2 min; 30 cycles of 94 ℃ for 20s, 53 ℃ for 30s and 72 ℃ for 60 s; extension at 72 ℃ for 7 min. The second round of amplification procedure was: denaturation at 94 deg.C for 2 min; 30 cycles of 94 ℃ for 20s, 55 ℃ for 30s and 72 ℃ for 30 s; extension at 72 ℃ for 7 min.

TABLE 3 first round PCR amplification System

composition (I)	Volume (μ L)
		10 XEx Taq Buffer (MgCl free)2)	2.5
MgCl2(25mM)	2
		dNTP(2.5mM each)	2
L-2613F(10μM)	1
		L-3509R(10μM)	1
Ex Taq enzyme (5U/. mu.L)	0.1
		Sterile double distilled water	15.4
Template: cDNA	1

TABLE 4 second round PCR amplification System

Composition (I)	volume (μ L)
		10 XEx Taq Buffer (MgCl free)2)	2.5
MgCl2(25mM)	2
		dNTP(2.5mM each)	2
L-2688F(10μM)	1
		L-3030R(10μM)	1
Ex Taq enzyme (5U/. mu.L)	0.1
		Sterile double distilled water	15.4
Template: first round PCR product	1

The PCR product was electrophoresed on a 1% agarose gel, and the results are shown in FIG. 5. In lanes 3 and 4 of the upper panel of FIG. 5, a primary amplified band of 897nt was observed. In the lower panel of FIG. 5, a 343nt primary and secondary amplified band was observed. In the lower panel of FIG. 5, lanes 3 to 10 are the amplified bands of the shrimp infected with the virus.

Sequence listing

<110> research institute for aquatic products in yellow sea of China institute for aquatic science

<120> detection method based on prawn oriental virus genome sequence and application thereof

<130> 20181115

<160> 40

<170> PatentIn version 3.5

<210> 1

<211> 6317

<212> RNA

<213> Orientavirus penaei

<400> 1

acacaaagac ggguguugua guguugcauu ggaaaaauca agguuuuaau cucucaauua 60

uggaagagug gcuaagugug uuggagucua acaacacagg ugcuuaugua cacaacccuu 120

cugucaucuu ugagcccaca gacagcccug agcuauugac uuacgaaauc aagaacccag 180

acuccauugg ccuugugacu caaguggaga uugaguuuga ugauaggcca gaugagggca 240

cggggaguac auuagccacu caaguccucu cagugcagag gguuaggaca uuucuucaug 300

auuucaccua uucucacaua ucccacagua cagaugugcg cuuggacaca guuuucacuc 360

caauggggaa uagaggugau caucucaccc cugacguuau ucugagagau gguaacaaga 420

uucuuguugu ugaguuugcc acaacacgag guggggacgc agcacuagaa agguccuuca 480

ggacuaaaac agccgcuuau gacuaugagc ugagggagag ggcugagaaa aggcauucga 540

aucacuucga cucucaggug uucuauggca ucauugugac aaaugagcug aaggugugca 600

guaaccugcc ucugacagaa gggcagguga augagcuggu cuacagauau aggauggcaa 660

uagacauuca gacugaguug ucuggagcau ggggaguauc uuuccaugag gaggaugaug 720

aaaugucaaa gacaacugca gaagucaaga ccauucuuaa gaacauuccc uuaagcuucu 780

cauuugaugg uaaguacaua aacaaggaag uauaugacaa cucauucgga gcgccugaca 840

cagauuaccu gcagaaggug auuggacgac ugaugacaga ggguagagcu gaagccauga 900

agagcggggc agagaugauc uucugugaug agagcaaaac augggguggu gagacaguga 960

gccguaauuc cucugagugc uuugaggcaa ucaagcaaua ugaaggagag cugaugaaag 1020

gggauaggca gcacagcagu acaaaggcaa uuguccagcu gccagcuugg acugcaauaa 1080

gagaagaguu cccgggcucc acaucugucc uaaguuuuga cauuggggag cacgcgucag 1140

caacacaugc uguguggaag ucugccaugu ccgcugugga ggcuuggggg ggguucaaag 1200

acgaugacga gucagagaua augaugacug aagaagaaga ucaggaucau cacaagccgc 1260

acagguccaa guaucacaga guggacauag ccuuagaaga ccacguaagg gccagcuuag 1320

cugugaaugg ugucuucggc aaggaauuca gacggaauga guuuguggca gcucggagaa 1380

gugaaaagcg gaagccuuuc ucucuaacug uugacugcuc uuguguggac cuuuuccucg 1440

auaguaauaa gcugaauguc gagcuagaca cuccgauuca ugguaacuua guucaauuga 1500

uuuccucauc uacugagaug cauucccaag augagcauca gaggaagugu aucagcaagu 1560

ucaugaaguc ucaguugggg guguauacau caaucaugac ugauguggcg acagagcugu 1620

gugucagccu gaagcagcac gugaagagaa accaaaugau aauuaagaag cuuagauacu 1680

auccuguuua caugcuaauu uacccuacug acucauccaa gcacauauuc gucucacucc 1740

uggcugaaag agggaaagug ucaguguggg acacgacagg guguuucaaa accagcaugu 1800

cgaaugacaa ggucguguuc acugacuuug uuucuuuuaa caccucgaaa uuggcuaacc 1860

ugugcaagcu agagucaguc auguauaaua caucaauguu cugggcagag gagaacggug 1920

aggcaagcuu cauuggggau gaaaucaugc caugguaugg caagaccucu agaacucagg 1980

aggaggucug gaagaugauc ucucucuguu ugcucguggc caugucugac aaaaggcaug 2040

uugaagagca gcuauccuug uacagguaca ugaacaugga ggccaugacg ucuuucccaa 2100

gggugccgaa gccauacaag cugcugaaga aaaugaccuu gguuccgaga uccaagcuug 2160

agcucuggau aaucaagaaa cauuugaggu acaugaaaua cguguguucc ggccaucaug 2220

ccauuaagau gaagggagac acaggagaca ccacuuggca uaaccuuauc aaucccuaca 2280

cguuguuucc acucaccucc aucuccucaa acgugaaccu aaacuaugua ggguacuuau 2340

guaauaagga ggagucagcu gagggaaaca cagcggccaa caucuaugag aagauucuag 2400

cucuggagga ugaacuacca gaugucaaca cguuccucgg ccuggaagac ccugaugauc 2460

cuggguacca ugaauucucu ccaagucuuc uaaaggcagc aguugacaau auaaaggaca 2520

gauuuagaag gaccuuugga agcucauggg aggccaacau agacaauaag auucugagag 2580

cucuuggcag cauaacuuua gaggaaaugg ccacgcugaa agcuuccucg aacuucucuc 2640

cugaauacua ugcuuugaag ccaggagaug cguauaaaag aaaaaaagcc auccaaggag 2700

ugagagacuu gauggauggg gagucuacaa ugauguauga gguccugagu aagugccucu 2760

caaaagugga gcaagauggc ugcaugcaca uagauauuuu caagaagccu caacacggag 2820

gagauaggga gauuuauguu auggacaugu caucaagggu uguccagcua ggguuagaga 2880

ccauugcuag aaccuacugu ucuuucauag acucagaggc aaugacucac ccgaagagca 2940

aguucaagcu gccugaggaa caugaaagga augcagagaa acgcuugggu acucauguga 3000

cguucuguca gagcgcagau gcuaggaagu ggagucaagg gcaccauguu gcuaaguuca 3060

ugcagaugcu augcaggcua acuccuaguu acauacaugg uuucauagug agagcgugug 3120

cgcucuggac gaaaaggcga auaaugaucu caccagcucu gauaaaggug uuuugcgaaa 3180

gcacuagcuu uacuucaggc aacgauaucg ugcagaggau guaugauggg uauuuaggua 3240

aaggaacaga gaaguggaua acccagggca uguccuacau acagguuggc aguggcauga 3300

ugcaaggcau ccuucacuac acuucguccc ugcugcacuc aaucuuucaa gaguuucuaa 3360

ggagcuugcu gagaucucau uauagggcac gaagccugcu gauaggggaa cccaugauca 3420

cugugggcca gagcucugau gacuccuauc ucaugguuac uuuuagaacg agggauucug 3480

aaacaugggc ugaggcagca cuugagucau caauggucca ccaccucaag uccacauuga 3540

guagauuccu ggggaucuau gacucugaga agacugcuag cauguugaug ucugucaugg 3600

aguuccuuag cgaguacaug gaaggcgcca gccuacauag ggcaacugug aagucagugu 3660

uugcuugcuu aucagugagu gagcaugaga gccugucuuc ucgccaggaa gaaaugagca 3720

cccuccugac uaaggugguu gaggauggag gaagcauuaa ucuggccucu cauugucaau 3780

ugggccaggc ucucuuacac uauaggcuau uggggucauc aguguccccu gcuuucgauc 3840

aguauuguag cagugccuuc acauccagag acccugccuu agguuacuuc cugauggaca 3900

acccauacgc ugcugggcug cuugguuuua aauacaaccu guggaaugcu ugugugaaua 3960

acacacuagg gaagaaguau aagcagaugu uaaucaaccc ccugagacau aggccucugg 4020

agucaacaac aucaggaacu uuacuucaca gucaucauau ugcuuggggg aaucggaaaa 4080

aaugggaaag gcugguuaga gcuuuggagu uacccgagaa uuggagggau cugauagagg 4140

aggauccagu aauccuauau agaaaggccc aaacagagag agacuuggag cuuagguugg 4200

ccgagaaaau gcacucaccu ggaguuugcu caucucugag uaagggaaau gcugucacua 4260

gaauaauagc uggcucaguc uacauacuga ccaggaaugu cuuaaccauc guuggaggga 4320

gaacaaaggu gaguuugcuc aaagcuauac ucgaagagag ggacgggguu gacccgcucu 4380

ccugggagga agagucccuu cuguuuccga gugcacuaga auaccacuca guugcugcag 4440

cccugagaag acuggacucg agagcagggg uguucaagaa acauaaggaa cgaaggagga 4500

gguccaacau acagauaacc gacucugaug gagacuaccu guuucaacca gaugucauuu 4560

uagccuggag augguuuaac auugacagga ugcacgcugc uguucgggug aaggagagga 4620

uguaucagaa auuaaggcag gcgcugccgu gggugagaga uaccccggag gaaacagugg 4680

cgaacagccc guuugagaau caaauccagc ugcacacguu cuugacuaag acaaccauga 4740

agaggaggga ggugcaucug cucggaacag aagucacuca aagaggcgga aucucaagcc 4800

uaaugacugc cauuuaccag aaccauuucc cuggguucca cuugcaguuc uugaaggaug 4860

aggaggcugc aucacaaucu ucugacuacu caaaacuauc ucacuucauu cacaugacuc 4920

accugucccc auacucugau gacuacaagc agcaguugau ucucaauaga cucgccucua 4980

gcccccagau ugaguucaag gagaaguuug ggaggaguag gaggaacugc cuagccauca 5040

uccagaaguc guugucauug aaugucguag aucuguuaga ccacauaacc uucaguuaua 5100

agaugggagu ugucgggggu uuuguuaaga gacagacaag cacuguuguu aaugggaaag 5160

ugaaguacac uggcguggga acguggguug gauccaugga cggugucaac augcgaauug 5220

ucaucaaugg gacaguggaa uccaauagag ugacuuccau agucguguca aacccucgag 5280

caauguacac gcagaccuuu gggaggcuac ugcagacaug gaugaaggaa auggguguua 5340

cugaagggga cccacacguu aacccaaaug ugauagcuua cuacagaaau gggcacauau 5400

aucagggcgg caggggagga ggagggggcg ucccaauaua ucacucgggg cuaggccuug 5460

agggauuuga uccugccuug gucaaauugg uggauaucca ggugaggaac aacacgguga 5520

gacuuguugc agacuauggc cugaagcacc ucagcaaggu aacuauacug agcuacacca 5580

ccagagacaa ggaugcguca uugaugguga cuaggucuga uuucucagag auaaagccag 5640

cuaugcagua cugguucucu aacacaucau ggccccacga gguagcacag ggagugguga 5700

ccagggcuuc uaagggggaa cucaugccaa auguugauca cagggaguug caauuuugga 5760

ugcaagcacu auuuaagaau gcagcagaga ggaaagggcu ccuugaggag acaauggagc 5820

ucccaauggg gucuaugacu ucgacagugg uuccugaugu guaugaugau uucugggauc 5880

uggucaccuu ugaugagcca caagagcuag aauguuuugg agaggcugug ccuucguggg 5940

aggacuucga cuuugaggug gcuuuuggag gggccaacgu caccaacuau guuccuagug 6000

uccuccgcac ucacccacuu cuagaucaaa ugcucagcag gcugaucagg gacuucuccu 6060

ucggagccau gagcaaguug guuagggaga agguuggaac cccagccaug cuucagucaa 6120

uucaguuguu guccuacuug cugggagugg auucaaauga gauagccauc ccagacuggg 6180

auuuagcguc aaguggcgca gagcaguggg accuuuaaga uguagcaugu ugguucauuu 6240

gauagguuaa uucaaugguu gguggguacu aaaaaaauag uuauguagau ucauuagaac 6300

acacccgguc uuugugu 6317

<210> 2

<211> 2978

<212> RNA

<213> Orientavirus penaei

<400> 2

acacaaagac ggcgcaucaa gugagaauuc aguagugaag uucauuuggu uuagucuuug 60

cgauauguuu guuuuuuuga ucacugcggg cuugcugcca acaaugcugg uuggcaacca 120

acuaucuccc gggaguaugc ucacagcugg ggugggcgaa ugugcccaga guccaccgag 180

auucccauuu gcagacccuu cuaucaaggg ugcaaagaag auacagugga ucaaccuauu 240

ccaucacccc aaacccugcu auuaugaggu uacuuccagc caaagauguu uugaugagcu 300

cggcggaacu ggagcaaggu guaacaacag cagaggaacu gugaugguug augacauaaa 360

cugccaagug gaggcugaag uugggucacu uagugacuca aaggacaucu gugcagugaa 420

uggacauauu cugcacacuu gugcugagac caggacugga cuugaguggg ugaggugggc 480

uuucauguac cgugaaggaa ggaagguccg auuccuagac acguugcaca agagagugaa 540

gcacaaugua gcaggcucag acaguuacac uugcacagga aaucagacag aggggugcaa 600

uggagacuua gccuacugcu cgaacaauga cugugaaguu gccucaaccu gcuucugcac 660

aaccaacaug agagagguga ccucccugau ugucgaugga caagagauag ugccaacaug 720

cuggggagaa ucucugguga ggaucaaucg agagaucaua ggcaauguag gggcauucca 780

gccaugcaca gacugcaagu uccagugcac cgaugagggu gucaagguuu ccacauucau 840

gcaggaagcu gugccuggaa ccauaugcaa gaaccccuau ugcguccaca ucaugguuca 900

guaugaagcu ucaauagucc ugccccugga caugagaguc ucaacugaag agaugacuau 960

cacccuaugg auuaggggca acauugaccc guucgucaac aaaaugacuu gcguguauga 1020

gcaauccugc gcucucauuu ccugccaucu uugccuggag agagcucuca auccacacug 1080

uuucuccugg gcccacuggc uguuagucau gguuuuaauc cuggucagug cagcugccau 1140

ccgcaggauc aucaugcucc ugcucugccu caagugggcg gugauuacau gcuggcacug 1200

ucugaagugg auccaccaaa gggcuucuuc cuugaggagg ggcaaggcua ugcaggacga 1260

ugaccgggcc agauuaacuc aaggacgggc aggagcugcu aacagguuca gggccuaccu 1320

ggccauggcc cugcuguccc ucggucacug cugcuccaca ucagucaccu cuauagcuga 1380

cauccaggac uguucgcaag guacagacgg aguugagacu ugugccuuug accacggagu 1440

ggaucugcau gugaguccaa uuggccagga gaguuguuac uuccucaagg accccaaagg 1500

ggagcacaug gaucaccuuc guauuaagac cgugagcguu cagcugggcu gugaaaagca 1560

gucccuguac uucgucccua gggcaguugg uaagugcgcc aguaucaguc acuguucaac 1620

uguugauggc ugcucaucaa aagcgugccu cgaguucggc aucaaugaca caaaggcuga 1680

cuggacagua gaggcagagc acuacgguug gucuagaugc cguggaaucc caggcugcgc 1740

ugcaaauggg uguuucuacu gugaugaugg gugccucugg uggagagagu acuucaccaa 1800

ccccaagaug gagguguucg agguggucag gugcccgacc uggaucuuua cagugggauu 1860

ggagguugua guguccaacg uuacuacgcc cauaacccua ucuccaggag cuacaaaagc 1920

uguuggcuca gugaggcuga gcuuggaggc ucucagcgug ccaccugagc cauuauuggg 1980

agacugcuuc uauguuaagg acuuggagac aaagauuggg ccuugcaacg agagaggguc 2040

gcugagcccu ggaagaguug gggagcugca augcccaucu aaggagucag caagaagagu 2100

ugacaaaacu uguuuugcga augacgcuau ugucaggucc acugugagcu cggcaggggu 2160

gucaugucac uuuuccuuag uggacccaga gaagguugga accgaccucc cguacaaagg 2220

caauggcuuc acaauccugu cagggaaaga aggaauagug gcucauagua ccuccaccgc 2280

uuugaugucc cucaauauac agcuggggcg cuugcugauc caaaaaagag cugccaggua 2340

caaaugucau gcucaguuug ucaaacugac cggguguuac ucuugcaugg cuggugccac 2400

ccugacuuua uuagugggcu ccaccucuga ugcuucagag gcugugcuca acugcccuga 2460

cgccaacuac accacaauug uuguugcaga caagcuggag aagagcguga ccagcacaau 2520

gcaccugacu gaaucacaga uagacaugaa gugcgagauu guguguccga guagcaggac 2580

auuugucgaa gucuccggua aucucuugua caucccggcc ucggacccug aaacuaggac 2640

caugucggug gacguucaca acaauggagc aucauucaca uggaaccccc ucgggagcua 2700

caagucugcc aucuuguaug gggcaauugc uauagcugca cucauccucc uuucuauucu 2760

ccuuccucuc cuacagaccu cugugaaauc uaagaccaac uaaacgauca uugauuacga 2820

cgggccgaaa ggcucgcauc cgcuaacuaa cuguuuggca gagcuauccg gcucaacaag 2880

ugaggccacu gacauguuga guuucaacgu guggaagauu cuugcuuugc aaucuuaaca 2940

cacuucacua uauuugucau augcgccggu cuuugugu 2978

<210> 3

<211> 1164

<212> RNA

<213> Orientavirus penaei

<400> 3

acacaaagac gagggaucua uagucaauaa cagaguauuc uuaccuuguu caacugacaa 60

cuuuucaaca uggccucuag ugcugagcuu agugaggcug cgaaguucau ucagaacauc 120

gccgucggug aguuuacgau cuucguagcc gacauggaug cguucaucgc agacauccag 180

uuccagggcu uugacccuaa ggucauuguu gcagccuuga ugaagaagga gagcgaugca 240

aacacgcuca aggaggacau cugcaagaug guggccauuc ugugugagag gggaaccaag 300

cucaacaaga ucauggguag gucuucuccg gagggaguuu cucggaucag ggcccucaag 360

gauaaauaug gccuugugga cagugguaag aaggcagaca acaucacccu ugcucggguu 420

gccuucugcc uuccccaguu cacaugcucg uacauggcgg ucugucugaa ccccgcgguu 480

ccauggacca gccuagacga ggggaccuau gccuauccaa ggcccauggc augcagugcc 540

uucgcaaacc ugcuagaggc gaccgauacg gagaugauca acugucaccu guacugggca 600

guccauuuua acaagcugau caacccauca gccaacaagu ccaugaagga aguggcagca 660

gagugccuua aguuugccau gauaggggca aacucgaccc acaucccagc cgcuaagaag 720

aagucaauca gggaagcccu gguccuaucu gcgccaacaa ucaaguucua cucugauaag 780

uucuugagcu ugaccgccua gaaaggcucu cacauuagug gggccagacg gugacacaca 840

aacacacuaa auagacaagc acgacaugag aacaacacag acgagacaca aacaacucac 900

aagacacaca gauacacgca cacauacaca cacacacaca caauccgagg uccugugugu 960

gacuuugaaa ugauggagcu gcacacucac ucgcucuccu ccugcuugug cucaugcuga 1020

ccccccaaug uguggcacau ucaagcauuc ugauugcuug uuccucgguc uuuuauagac 1080

ucaaggagcu cauggucugu ucgucaagaa uauuaugagg caaaccauaa gcauucugau 1140

uguuauaucc cucggucuuu gugu 1164

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> L-12F

<400> 4

ggtgttgtag tgttgcattg gaa 23

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> L-718R

<400> 5

tcatcctcct catggaaaga tactc 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> L-496F

<400> 6

cttatgacta tgagctgagg gagag 25

<210> 7

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> L-1460R

<400> 7

gacattcagc ttattactat cgagga 26

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> L-1274F

<400> 8

tcacagagtg gacatagcct tagaa 25

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> L-2342R

<400> 9

acataagtac cctacatagt ttaggttcac 30

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> L-2613F

<400> 10

acgctgaaag cttcctcgaa 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3509R

<400> 11

tgactcaagt gctgcctcag 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> L-2688F

<400> 12

gccatccaag gagtgagaga c 21

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3011R

<400> 13

acttcctagc atctgcgctc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3030R

<400> 14

acttcctagc atctgcgctc 20

<210> 15

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3085F

<400> 15

tttgaggtac atgaaatacg tgtgtt 26

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3108R

<400> 16

ctatgaaacc atgtatgtaa ctag 24

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> L-2942F

<400> 17

gttcaagctg cctgaggaac at 22

<210> 18

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3970R

<400> 18

cctagtgtgt tattcacaca agcatt 26

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> L-3836F

<400> 19

cgatcagtat tgtagcagtg cctt 24

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> L-4677R

<400> 20

ctgtttcctc cggggtatct c 21

<210> 21

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> L-4520F

<400> 21

cgactctgat ggagactacc tgtt 24

<210> 22

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> L-5439R

<400> 22

atattgggac gccccctc 18

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> L-5317F

<400> 23

catggatgaa ggaaatgggt g 21

<210> 24

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> L-6308R

<400> 24

ccgggtgtgt tctaatgaat ctac 24

<210> 25

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> L-6104F

<400> 25

agccatgctt cagtcaattc agt 23

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> L-9R

<400> 26

agatgccctt gttaccccga 20

<210> 27

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> M-90F

<400> 27

gcttgctgcc aacaatgct 19

<210> 28

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> M-1090R

<400> 28

ccaggagaaa cagtgtggat tg 22

<210> 29

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> M-966F

<400> 29

tatggattag gggcaacatt gac 23

<210> 30

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> M-2007R

<400> 30

tccaagtcct taacatagaa gcagtc 26

<210> 31

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> M-1844F

<400> 31

atctttacag tgggattgga ggtt 24

<210> 32

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> M-2818R

<400> 32

gtaatcaatg atcgtttagt tggtctt 27

<210> 33

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> M-2692F

<400> 33

cgggagctac aagtctgcca t 21

<210> 34

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> M-252R

<400> 34

ttggggtgat ggaataggtt g 21

<210> 35

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> S-380F

<400> 35

acagtggtaa gaaggcagac aac 23

<210> 36

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> S-1120R

<400> 36

cctcataata ttcttgacga a 21

<210> 37

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> S-644F

<400> 37

tgaaggaagt ggcagcagag t 21

<210> 38

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> S-1145R

<400> 38

taacaatcag aatgcttatg gtttg 25

<210> 39

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> S-903F

<400> 39

gacacacaga tacacgcaca catac 25

<210> 40

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> S-532R

<400> 40

atgccatggg ccttggata 19

Claims (3)

1. A prawn oriental virus (Orientavirus penaei) with preservation number of CCTCC number V201864.

2. The oriental prawn virus of claim 1, wherein the genomic sequence is shown as SEQ ID No 1, SEQ ID No 2 and SEQ ID No 3.

3. A kit for detecting the virus of claim 1, wherein the specific sequence detected by the kit is

(a) The method comprises the following steps Part or all of the RNA sequence of SEQ ID No 1 or SEQ ID No 2 or SEQ ID No 3; or

(b) The method comprises the following steps (a) A converted DNA sequence; or

(c) the method comprises the following steps RNA and DNA sequences complementary to (a) or (b).