CN109628544B

CN109628544B - Application of lipase in resolution of N-acetyl-DL-methionine methyl ester

Info

Publication number: CN109628544B
Application number: CN201910057292.5A
Authority: CN
Inventors: 郑建永; 吴鹏; 章银军; 孙杰; 汪钊
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-01-22
Filing date: 2019-01-22
Publication date: 2022-03-15
Anticipated expiration: 2039-01-22
Also published as: CN109628544A

Abstract

The invention provides an application of lipase in splitting N-acetyl-DL-methionine methyl ester, wherein the amino acid sequence of the lipase is shown as SEQ ID NO.1, and the coding gene of the lipase is shown as SEQ ID NO. 2. The lipase gene can be connected with an expression vector to construct an intracellular expression recombinant plasmid containing the gene, and then the intracellular expression recombinant plasmid is transformed into an escherichia coli strain to obtain a recombinant escherichia coli engineering bacterium; the recombinant Escherichia coli is subjected to cell disruption, separation and purification to obtain recombinant lipase; the recombinant lipase has the capability of catalyzing and splitting N-acetyl-DL-methionine methyl ester, can obtain N-acetyl-L-methionine methyl ester, and has an enantiomer excess value of more than 99% and a conversion rate of 51.2%.

Description

Application of lipase in resolution of N-acetyl-DL-methionine methyl ester

(I) technical field

The invention belongs to the technical field of biocatalysis, and relates to application of lipase in synthesizing an N-acetyl-L-methionine methyl ester enantiomer with a single configuration by stereoselectively catalyzing and hydrolyzing and splitting the N-acetyl-DL-methionine methyl ester enantiomer.

(II) background of the invention

N-acetyl-L-methionine (N-Ac-L-Met) is a valuable nutritional supplement, produced by chemoacetylation of L-methionine (L-Met), produced by resolution of N-acetyl-DL-methionine (N-Ac-DL-Met) catalyzed by acyltransferase. DL-Met is a material for the production of N-acetyl-DL-methionine methyl ester (N-Ac-DL-MetOMe), produced on a large scale at low cost by chemical synthesis. Enzymatic hydrolysis of N-acetyl-DL-methionine methyl ester has been proposed for N-Ac-L-Met production. In this process, N-Ac-L-Met and D-Met will be produced, which can be used as achiral compositions or starting materials for pharmaceuticals. However, since the enantioselectivity of the reaction is poor and the yield of N-Ac-L-Met is low, no effective solution has been developed so far. Therefore, an effective method for efficiently producing the N-Ac-L-Methome by hydrolyzing and splitting the N-Ac-DL-Methome under lipase catalysis is provided. The enzymatic resolution can utilize the high stereoselectivity, site and regioselectivity of enzyme to catalyze a certain enantiomer in a chemically synthesized racemate or derivative to hydrolyze so as to obtain a single enantiomer with high yield and high selectivity, and has the characteristics of high selectivity, mild reaction conditions, stable reaction and easy industrialization. Meanwhile, the enzymatic resolution can solve the problems that chemical synthesis easily causes environmental pollution, generates a large amount of invalid enantiomers even harmful to the environment, and has very important significance for protecting the natural environment and health of human beings.

Lipase (EC 3.1.1.3) is called triacylglycerol acylhydrolase (Triacyl-glycerol acylhydrolase) and is the most widely studied and industrially applied hydrolase. Lipases are capable of catalyzing ester hydrolysis, ester synthesis, alcoholysis, acidolysis, transesterification of esters and ammonolysis reactions. Lipases are widely found in various organisms in nature, particularly in microorganisms and animal and plant tissues. Animal lipase mainly exists in organ tissues such as pancreas, such as pig liver esterase and pig pancreas lipase, but the application of the animal lipase in industry is limited due to factors such as low activity of the animal lipase, high cost of enzyme extraction and purification, limited raw material sources and the like. The lipase from the microorganisms has rich sources and various varieties, is not influenced by factors such as seasons, climates and the like, has short enzyme production period during the growth of the microorganisms, and has the characteristics of organic solvent resistance, strong substrate specificity, high catalytic selectivity, high catalytic activity and the like, so the lipase from the microorganisms has higher industrial application value. At present, most commercial lipases in the market are obtained by culturing and fermenting microorganisms such as bacteria, fungi and yeast. A number of commercial enzyme preparations were developed by major enzyme manufacturers such as Novo Nordisk, Denmark, Amano, Japan, and Genencor, USA. These enzyme preparation companies utilize molecular modification technology to modify microbial lipase, and improve enzymatic properties such as enzyme activity, stability and stereoselectivity, so as to meet the application requirements of different industrial fields. Therefore, the construction of lipase gene engineering bacteria to produce recombinant lipase in large scale is of great significance.

Disclosure of the invention

The invention aims to provide application of stereoselective lipase in biological resolution of N-acetyl-DL-methionine methyl ester, and the lipase can be used for efficiently resolving the N-acetyl-DL-methionine methyl ester to obtain the high-purity N-acetyl-L-methionine methyl ester and improve the yield.

The technical scheme adopted by the invention is as follows:

the invention provides an application of lipase in splitting N-acetyl-DL-methionine methyl ester (as shown in figure 2), wherein the amino acid sequence of the lipase is shown as SEQ ID NO.1, the nucleotide sequence of a coding gene is shown as SEQ ID NO.2, and the specific application method comprises the following steps: taking wet thalli or wet thalli freeze-dried powder obtained by fermentation culture of engineering bacteria containing stereoselective lipase coding genes as a catalyst, taking N-acetyl-DL-methionine methyl ester as a substrate, taking a pH 7.0 buffer solution as a reaction medium, carrying out resolution reaction at the conditions of 25-45 ℃ and 600-800rpm, and after the reaction is completed, separating and purifying the reaction solution to obtain the N-acetyl-L-methionine methyl ester. The dosage of the catalyst is 10g/L calculated by the volume of the buffer solution, and the final concentration of the substrate is 5-20g/L calculated by the volume of the buffer solution.

Further, the reaction time is preferably 2 to 60min, and the reaction condition is more preferably 35 ℃ and 800rpm for 10 min.

Further, the buffer solution was Na at pH 7.0, 0.2mM₂HPO₄/NaH₂PO₄And (4) buffer solution.

Further, the catalyst is prepared by the following method: inoculating engineering bacteria (preferably Escherichia coli BL21) containing stereoselective lipase coding gene in LB culture medium, and culturing OD at 37 deg.C₆₀₀To 0.4-0.6 (preferably 0.5), adding IPTG to a final concentration of 0.02mM, and culturing at 30 deg.CCentrifuging at 4 deg.C for 10min at 8000rpm for 10-12h, collecting thallus, washing thallus with PBS buffer solution for 2 times, centrifuging at 4 deg.C for 10min at 8000rpm, collecting thallus, and lyophilizing to obtain crude lipase powder, i.e. wet thallus lyophilized powder; the LB medium composition: 10g/L of tryptone, 5g/L, NaCl 5g/L of yeast powder and deionized water as a solvent, and the pH value is natural.

Further, the method for separating and purifying the reaction liquid comprises the following steps: after the reaction is finished, acidifying the reaction solution to pH 2.0 by using 4mM HCl, extracting by using equal volume of ethyl acetate, separating an organic phase by using a separating funnel (preferably, separating the organic phase by using the separating funnel, extracting a water phase by using ethyl acetate, combining the organic phases, washing the organic phase twice by using pure water), washing twice by using the pure water, washing twice by using saturated NaCl, drying the organic phase obtained after washing by using anhydrous magnesium sulfate, removing water, and then carrying out rotary evaporation on the organic phase till the organic phase is dried to obtain the final product N-acetyl-L-methyl methionine.

The stereoselective lipase has an amino acid sequence shown in SEQ ID NO. 1.

MTINYHELETSHGRIAVRESEGEGAPLLMIHGNSSSGAVFAPQLEGEIGKKWRVISPDLPGHGKSSDAIDPEHSYSMEGYADAMTEVMQKLGIADAVVFGWSLGGHIGIEMIARYPEMRGLMITGTPPVAREEVGQGFKSGPDMALAGQEVFSERDVDSYARSTCGEPFEASLLDIVARTDGRARRIMFEKFGNGTGGNQRDIVAQAKLPIAVVNGRDEPFVELDFVSKVKFGNLWEGKTHVIDNAGHAPFRETPAIFDRYLMRFLSDCT IG。

Due to the specificity of the amino acid sequence, any fragment of the polypeptide containing the amino acid sequence shown in SEQ ID NO.1 or its variants, such as conservative variants, biologically active fragments or derivatives thereof, is included in the scope of the present invention, as long as the fragment or the variant of the polypeptide has more than 90% homology with the aforementioned amino acid sequence and has the same enzymatic activity. In particular, the alteration may comprise a deletion, insertion or substitution of an amino acid in the amino acid sequence; where conservative changes to a variant are made, the substituted amino acid has similar structural or chemical properties as the original amino acid, e.g., replacement of isoleucine with leucine, and the variant may also have non-conservative changes, e.g., replacement of glycine with tryptophan.

A fragment, derivative or analogue of a protein according to the invention refers to a protein that retains substantially the same biological function or activity as the protease according to the invention and may be: (ii) (i) one or more amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), and the substituted amino acid may or may not be encoded by the genetic code; (ii) one or more of the amino acid residues is substituted with another group; (III) fusion of the mature protein with another compound (such as a compound that extends the half-life of the protein, e.g., polyethylene glycol); (IV) protein sequences formed by fusing additional amino acid sequences into the mature protein (e.g., sequences used to purify the protein or proprotein sequences).

The protein may be a recombinant, natural or synthetic protein, may be a pure natural purified product, or may be a chemically synthesized product, or may be produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the protein of the invention may be glycosylated. The proteins of the invention may or may not also include an initial methionine residue.

The invention also relates to a coding gene of the stereoselective lipase, in particular to a coding gene nucleotide sequence after the codon optimization of escherichia coli, which is shown as SEQ ID NO. 2:

CCATGGGCATGACCATCAACTATCACGAACTGGAGACCTCTCATGGTCGCATTGCCGTGCGCGAAAGCGAAGGTGAAGGTGCCCCGCTGCTGATGATTCATGGCAACAGCAGCAGCGGTGCCGTGTTTGCACCGCAGCTGGAGGGCGAGATCGGCAAGAAATGGCGTGTGATTAGCCCGGATTTACCGGGTCATGGCAAAAGCAGCGATGCCATTGACCCGGAACATAGCTACAGCATGGAAGGCTATGCCGATGCCATGACCGAAGTGATGCAGAAGCTGGGCATTGCCGATGCCGTGGTGTTTGGTTGGTCTTTAGGCGGTCATATTGGCATCGAAATGATCGCCCGCTATCCGGAAATGCGCGGTTTAATGATTACCGGTACCCCGCCGGTTGCCCGTGAAGAAGTTGGCCAAGGTTTTAAAAGCGGCCCGGATATGGCACTGGCCGGTCAAGAAGTGTTCAGCGAGCGCGATGTGGATAGTTATGCCCGCAGCACTTGTGGTGAACCGTTCGAAGCCTCTTTACTGGATATTGTTGCACGCACCGATGGTCGTGCACGCCGCATCATGTTCGAAAAGTTTGGCAACGGCACCGGTGGCAATCAGCGTGACATTGTGGCCCAAGCTAAACTGCCGATCGCCGTTGTGAATGGTCGCGATGAGCCGTTTGTTGAGCTGGACTTCGTGAGCAAGGTGAAGTTCGGCAATCTGTGGGAGGGCAAGACCCACGTGATTGATAATGCCGGTCATGCCCCGTTTCGTGAAACACCGGCCATTTTCGATCGCTATTTAATGCGCTTTCTGAGCGATTGCACCATTGGTCTCG AG。

AG is included in the scope of the present invention as long as it has 70% homology with the polynucleotide and has the same function as any variant of the polynucleotide shown in SEQ ID NO.2 due to the specificity of the nucleotide sequence. A variant of the polynucleotide refers to a polynucleotide sequence having one or more nucleotide changes. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants, including substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the amino acid encoded thereby.

In addition, the sequences of SEQ ID NOs: 2 (at least 50% homology, preferably at least 70%) is also within the scope of the invention, in particular polynucleotides which hybridize under stringent conditions to the nucleotide sequences according to the invention. The "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2SSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum, 0.1% Ficoll, 42 deg.C; or (3) hybridization occurs only when the homology between two sequences is at least 95% or more, preferably 97% or more. And, the protein encoded by the hybridizable polynucleotide hybridizes to SEQ ID NO: 1 have the same biological functions and activities.

The invention also relates to a recombinant vector containing the coding gene, a recombinant gene engineering bacterium obtained by transforming the recombinant vector and the engineering bacterium.

The invention has the following beneficial effects: the invention provides a stereoselective lipase, which can be connected with an expression vector to construct an intracellular expression recombinant plasmid containing the lipase gene, then the intracellular expression recombinant plasmid is transformed into an escherichia coli strain to obtain recombinant escherichia coli, and then the recombinant escherichia coli or the recombinant lipase is used as a biocatalyst to catalyze and split N-acetyl-DL-methionine methyl ester to generate N-acetyl-L-methionine methyl ester, wherein the enantiomer excess value is more than 99 percent, and the conversion rate reaches 51.2 percent. At present, a commonly used L-methionine synthesis method is an aminoacylase resolution method, N-acetyl-DL-methionine stereoselective acyl hydrolysis reaction is catalyzed by using aminoacylase to obtain L-methionine, column chromatography separation is needed for downstream separation of L-methionine and N-acetyl-D-methionine, and the separation cost is high. Compared with the aminoacylase resolution method, the method has simpler separation, and the enzyme catalysis product can be obtained by solvent extraction. The biocatalytic chiral synthesis reaction has the advantages of mild conditions, high efficiency, high chemical selectivity, regioselectivity, enantioselectivity and the like, and the biocatalytic process has the characteristics of no toxicity, no pollution, low energy consumption and the like, so that the biocatalytic chiral synthesis reaction is an environment-friendly synthesis method.

(IV) description of the drawings

FIG. 1 is a reaction scheme of enantioselective hydrolysis resolution of N-acetyl-DL-methionine methyl ester by recombinant lipase;

FIG. 2 is a reaction scheme for the organic synthesis of N-acetyl-DL-methionine methyl ester;

FIG. 3 is a gas chromatogram of a standard sample of N-acetyl-DL-methionine;

FIG. 4 is a gas chromatogram of lipase-catalyzed hydrolysis reaction of N-acetyl-DL-methionine methyl ester for 10 min.

(V) detailed description of the preferred embodiments

The present invention is further described with reference to the following specific examples, but the scope of the present invention is not limited thereto, and variations in the method according to the embodiments are included in the scope of the present invention by those skilled in the art.

EXAMPLE 1 chemical Synthesis of the substrate N-acetyl-DL-methionine methyl ester

5g N-acetyl-DL-methionine and 5mL methanol (analytically pure, methanol excess) were placed in a 250mL round-bottom flask, 20mL toluene was added as a reaction solvent, and 125uL of concentrated sulfuric acid (98% by mass) was added as a catalyst. Tong (Chinese character of 'tong')The mixture is put into an oil bath to react for 6 to 8 hours under the conditions of 80 ℃ of a magnetic stirrer and 600 rpm. The reaction solution obtained after the reaction is firstly saturated Na₂CO₃Washing to remove unreacted acid, extracting with ethyl acetate with the same volume, separating an organic phase and a water phase by using a separating funnel, extracting the water phase twice by using ethyl acetate, combining the organic phases, washing twice by using pure water, washing twice by using saturated NaCl, drying the organic phase obtained after washing by using anhydrous magnesium sulfate, removing water, and performing rotary evaporation on the organic phase to dryness to obtain a relatively pure product N-acetyl-DL-methyl methionine (shown in figure 1), wherein the yield is 80%.

EXAMPLE 2 Lipase Screen for enzymatic resolution of N-acetyl-DL-methionine methyl ester

0.01g of lyophilized wet powder of the bacteria having lipase-hydrolyzing active proteins from different sources, which was obtained by screening in Table 1, was weighed into a 2mL EP tube, 1mL PB (pH 7.0, 0.2mM) was added as a reaction solvent, and then 0.01g of N-acetyl-DL-methionine methyl ester as a substrate was added, and the mixture was placed at 35 ℃ and reacted in a homomixer at 800rpm for 10min with no bacteria added as a blank. After the reaction, the reaction solution was acidified with 2mM HCl, 1mL of ethyl acetate was added, followed by shaking with a vortex shaker for 2min, followed by sufficient extraction and centrifugation (1200rpm, 3min) to obtain an organic phase. 700 mu L of ethyl acetate layer is taken to detect the stereoselectivity and the enzymatic hydrolysis activity of the thallus by gas chromatography, the result is shown in table 1, and the microbial strains with the substrate enantiomer excess value of more than 99 percent and the conversion rate of 51.2 percent are obtained by screening. Finally, a protein sequence derived from Ochrobactrum thiophenivorans (GenBank: WP-094505884.1) is selected, a nucleotide sequence shown as a gene sequence SEQ ID NO.2 is obtained after codon optimization of an escherichia coli expression system, and an amino acid sequence of a coding protein is shown as SEQ ID NO. 1. The fragment was ligated to pET28b vector to obtain the cloning vector pET28b-lip and transformed into E.coli Escherichia coli BL21 to obtain recombinant E.coli, denoted E.coli BL21 (F1). The recombinant plasmid was sequenced and the sequencing result was analyzed by software, and the sequence contained an open reading frame (SEQ ID NO.2) 819bp in length.

TABLE 1 screening of lipases with hydrolytic Activity

Lipase enzyme	Conversion (%)	ee value (%)	Protein series source
				L1	56.6	0	Aspergillus oryzae IF04202
L2	62.7	0	Aspergillus oryzae IF04202
				F1	51.2	>99	Ochrobactrum thiophenivorans
F2	100	0	Rhodococcus erythropolis
				F3	100	0	Ochrobactrum anthropi
A2	0	0	Aspergillus luchuensis
				A3	0	0	Penicillium subrubescens
M1	0	0	Aspergillus flavus NRRL3357
				M2	63.5	0	Aspergillus oryzae 3.042
M4	0	0	Aspergillus oryzae RIB40

Specific gas phase analysis conditions: using Agilent6890 gas chromatograph, BGB-174 chiral capillary chromatographic column (30.0m × 0.25mm × 0.25um), FID detector; the detection conditions are that the temperature of the column is increased from an initial temperature of 100 ℃ (keeping the constant temperature for 3min) to 200 ℃ (keeping the constant temperature for 2min), the heating rate is 5 ℃/min, the sample injection temperature is 250 ℃, the temperature of the detector is 250 ℃, and the air flow and the hydrogen flow are 300mL/min and 40mL/min respectively. The carrier gas is high-purity N₂Column head pressure 93.5 Kpa; tail gas blowing flow 25.0 mL/min^-1(ii) a The split ratio is 50:1, and the sample injection volume is 1uAnd L. As shown by the results of GC, the retention times of N-acetyl-L-methionine methyl ester and N-acetyl-D-methionine methyl ester were 23.9min and 24.0min, respectively (as shown in FIG. 3).

Example 3 Lipase protein Induction conditions

Escherichia coli BL21(F1) obtained in example 2 was inoculated into LB medium and OD was cultured at 37 ℃₆₀₀To 0.5 (approximately 2h of culture), IPTG was added to a final concentration of 0.02mM, and the culture was carried out at 30 ℃ for 10-12 h. Centrifuging 300mL of bacterial liquid at 8000rpm at 4 ℃ for 10min, collecting thalli, washing the thalli with PBS buffer solution for 2 times at 8000rpm for 10min, and collecting wet thalli. Freeze-drying the collected wet bacteria by a freeze dryer to obtain lipase F1 crude enzyme powder, and storing in a refrigerator at 4 ℃. Composition of LB medium: 10g/L of tryptone, 5g/L, NaCl 5g/L of yeast powder and water as a solvent, wherein the pH is natural.

Example 4 comparison of the Effect of different lipases on the hydrolytic resolution of N-acetyl-DL-methionine methyl ester

At pH 7.0, 0.2mM Na₂HPO₄/NaH₂PO₄To 1mL of the buffer solution, various lipases (Lipase F1 crude enzyme powder, Novozym 435, Lipozyme TL IM, Lipozyme RM IM, and Lipase PS IM prepared in example 2) at a final concentration of 10g/L and 0.01g N-acetyl-DL-methionine methyl ester were added, and the mixture was reacted at 35 ℃ and 800rpm in a homomixer for 10 minutes, and the reaction solution was used to examine the enantiomeric excess and conversion of N-acetyl-L-methionine methyl ester by the method of example 1, and the results are shown in Table 2. The results showed that after 10min at 35 ℃ none of lipase 435, TL IM, RM IM and PS IM had significant hydrolytic resolution activity on the substrate, whereas when lipase F1 catalyzed the ee value of the product N-acetyl-L-methionine methyl ester>99% conversion was 51.2% (as shown in figure 4).

TABLE 2 comparison of the hydrolytic resolution of N-acetyl-DL-methionine methyl ester catalyzed by different lipases

Example 5 Effect of reaction time on the enzymatic kinetic hydrolytic resolution of N-acetyl-DL-methionine methyl ester

At pH 7.0, 0.2mM Na₂HPO₄/NaH₂PO₄1mL of the buffer solution was added with 10g/L of the crude lipase F1 powder prepared in example 3 and 0.02g N-acetyl-DL-methionine methyl ester to react at 35 ℃ in a homomixer at 800rpm for various times (2min to 60min), and the reaction solution was measured for enantiomeric excess and conversion of N-acetyl-L-methionine methyl ester by the method of example 2, and the results are shown in Table 3.

The results show that after 10min of reaction, the enantiomeric excess of the product N-acetyl-L-methionine methyl ester has reached the highest value, the enantiomeric excess is > 99%, the conversion rate is 51.2%, and when the reaction time is more than 10min, the enantiomeric excess of the product N-acetyl-L-methionine methyl ester is basically unchanged, but the conversion rate is increased.

TABLE 3 Effect of reaction time on enzyme-catalyzed reactions

Example 6 Effect of reaction temperature on enzymatic kinetic hydrolytic resolution of N-acetyl-DL-methionine methyl ester

At pH 7.0, 0.2mM Na₂HPO₄/NaH₂PO₄1mL of the buffer solution was added with 10g/L of the crude lipase F1 powder prepared in example 3 and 0.02g of N-acetyl-DL-methionine methyl ester, and the mixture was reacted at 800rpm for 10min at different temperatures (25-45 ℃) in a homomixer, and the enantiomeric excess and the conversion of N-acetyl-L-methionine methyl ester were measured by the method of example 2, and the results are shown in Table 4.

The results show that the enantiomeric excess of N-acetyl-L-methionine methyl ester is the highest at a reaction temperature of 35 ℃ with an ee value of > 99%. When the reaction temperature is higher than 35 ℃ or lower than 35 ℃, the enantiomeric excess of N-acetyl-L-methionine methyl ester is reduced, which indicates that the temperature has a great influence on the optical selectivity of lipase F1.

TABLE 4 influence of reaction temperature on the reaction

EXAMPLE 7 isolation and extraction of the product N-acetyl-L-methionine methyl ester

A50 mL round-bottomed flask was charged with 20mL of a buffer solution of 0.2mM PB at pH 7.0, and 0.2g of crude lipase F1 prepared in example 3 was weighed, followed by addition of N-acetyl-DL-methionine methyl ester at a final concentration of 10g/L, and fed-batch titration with 50mM NaOH, while controlling the reaction pH at 7.0, and reaction was carried out for 2 hours at 600rpm with a magnetic stirrer at 35 ℃. Acidifying the reaction solution obtained after the reaction by using 4mM HCl until the pH value is 2.0, then extracting by using ethyl acetate with the same volume, separating an organic phase by using a separating funnel, extracting a water phase by using ethyl acetate, combining the organic phases, washing the organic phase twice by using pure water, washing the organic phase twice by using saturated NaCl, drying the organic phase obtained after washing by using anhydrous magnesium sulfate, removing water, and then carrying out rotary evaporation on the organic phase till the organic phase is dried to obtain a final product, weighing the final product, wherein the yield of the product N-acetyl-L-methyl methionine is 92.3%, and the purity is 100%.

Sequence listing

<110> Zhejiang industrial university

<120> application of lipase in resolution of N-acetyl-DL-methionine methyl ester

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 272

<212> PRT

<213> Unknown (Unknown)

<400> 1

Met Thr Ile Asn Tyr His Glu Leu Glu Thr Ser His Gly Arg Ile Ala

1 5 10 15

Val Arg Glu Ser Glu Gly Glu Gly Ala Pro Leu Leu Met Ile His Gly

20 25 30

Asn Ser Ser Ser Gly Ala Val Phe Ala Pro Gln Leu Glu Gly Glu Ile

35 40 45

Gly Lys Lys Trp Arg Val Ile Ser Pro Asp Leu Pro Gly His Gly Lys

50 55 60

Ser Ser Asp Ala Ile Asp Pro Glu His Ser Tyr Ser Met Glu Gly Tyr

65 70 75 80

Ala Asp Ala Met Thr Glu Val Met Gln Lys Leu Gly Ile Ala Asp Ala

85 90 95

Val Val Phe Gly Trp Ser Leu Gly Gly His Ile Gly Ile Glu Met Ile

100 105 110

Ala Arg Tyr Pro Glu Met Arg Gly Leu Met Ile Thr Gly Thr Pro Pro

115 120 125

Val Ala Arg Glu Glu Val Gly Gln Gly Phe Lys Ser Gly Pro Asp Met

130 135 140

Ala Leu Ala Gly Gln Glu Val Phe Ser Glu Arg Asp Val Asp Ser Tyr

145 150 155 160

Ala Arg Ser Thr Cys Gly Glu Pro Phe Glu Ala Ser Leu Leu Asp Ile

165 170 175

Val Ala Arg Thr Asp Gly Arg Ala Arg Arg Ile Met Phe Glu Lys Phe

180 185 190

Gly Asn Gly Thr Gly Gly Asn Gln Arg Asp Ile Val Ala Gln Ala Lys

195 200 205

Leu Pro Ile Ala Val Val Asn Gly Arg Asp Glu Pro Phe Val Glu Leu

210 215 220

Asp Phe Val Ser Lys Val Lys Phe Gly Asn Leu Trp Glu Gly Lys Thr

225 230 235 240

His Val Ile Asp Asn Ala Gly His Ala Pro Phe Arg Glu Thr Pro Ala

245 250 255

Ile Phe Asp Arg Tyr Leu Met Arg Phe Leu Ser Asp Cys Thr Ile Gly

260 265 270

<210> 2

<211> 830

<212> DNA

<213> Unknown (Unknown)

<400> 2

ccatgggcat gaccatcaac tatcacgaac tggagacctc tcatggtcgc attgccgtgc 60

gcgaaagcga aggtgaaggt gccccgctgc tgatgattca tggcaacagc agcagcggtg 120

ccgtgtttgc accgcagctg gagggcgaga tcggcaagaa atggcgtgtg attagcccgg 180

atttaccggg tcatggcaaa agcagcgatg ccattgaccc ggaacatagc tacagcatgg 240

aaggctatgc cgatgccatg accgaagtga tgcagaagct gggcattgcc gatgccgtgg 300

tgtttggttg gtctttaggc ggtcatattg gcatcgaaat gatcgcccgc tatccggaaa 360

tgcgcggttt aatgattacc ggtaccccgc cggttgcccg tgaagaagtt ggccaaggtt 420

ttaaaagcgg cccggatatg gcactggccg gtcaagaagt gttcagcgag cgcgatgtgg 480

atagttatgc ccgcagcact tgtggtgaac cgttcgaagc ctctttactg gatattgttg 540

cacgcaccga tggtcgtgca cgccgcatca tgttcgaaaa gtttggcaac ggcaccggtg 600

gcaatcagcg tgacattgtg gcccaagcta aactgccgat cgccgttgtg aatggtcgcg 660

atgagccgtt tgttgagctg gacttcgtga gcaaggtgaa gttcggcaat ctgtgggagg 720

gcaagaccca cgtgattgat aatgccggtc atgccccgtt tcgtgaaaca ccggccattt 780

tcgatcgcta tttaatgcgc tttctgagcg attgcaccat tggtctcgag 830

Claims

1. An application of lipase in resolving N-acetyl-DL-methionine methyl ester is characterized in that the amino acid sequence of the lipase is shown as SEQ ID NO. 1.

2. The use according to claim 1, wherein the nucleotide sequence of the lipase-encoding gene is as shown in SEQ ID No. 2.

3. The use according to claim 1, characterized in that the method of application is: taking wet thalli or wet thalli freeze-dried powder obtained by fermentation culture of engineering bacteria containing lipase coding genes as a catalyst, taking N-acetyl-DL-methionine methyl ester as a substrate, taking a pH 7.0 buffer solution as a reaction medium, carrying out resolution reaction at the temperature of 25-45 ℃ and the speed of 600 plus 800rpm, and after the reaction is completed, separating and purifying reaction liquid to obtain the N-acetyl-L-methionine methyl ester.

4. Use according to claim 3, wherein the catalyst is used in an amount of 10g/L by volume of buffer and the substrate is used in a final concentration of 5 to 20g/L by volume of buffer.

5. Use according to claim 3, characterized in that the reaction time is 2-60 min.

6. The use according to claim 3, wherein the reaction conditions are 35 ℃ and 800rpm for 10 min.

7. Use according to claim 3, characterized in that the buffer is Na at pH 7.0, 0.2mM₂HPO₄/NaH₂PO₄And (4) buffer solution.

8. The use according to claim 3, wherein the catalyst is prepared by the following process: inoculating engineering bacteria containing lipase coding gene in LB culture medium, culturing OD at 37 deg.C₆₀₀Adding IPTG to a final concentration of 0.02mM when the concentration is 0.4-0.6, culturing at 30 ℃ for 10-12h, centrifuging at 8000rpm of bacterial liquid for 10min at 4 ℃, collecting thalli, washing the thalli for 2 times by using PBS buffer solution, centrifuging at 8000rpm and 4 ℃ for 10min, collecting wet thalli, and freeze-drying to obtain the wet thalli freeze-dried powder.

9. The use of claim 3, wherein the reaction solution is separated and purified by the following steps: after the reaction is finished, acidifying the reaction solution to pH 2.0 by using 4mM HCl, then extracting by using equal volume of ethyl acetate, separating out an organic phase by using a separating funnel, washing twice by using pure water and twice by using saturated NaCl, drying the organic phase obtained after washing by using anhydrous magnesium sulfate, removing water, and then carrying out rotary evaporation on the organic phase till the organic phase is dry to obtain the product N-acetyl-L-methyl methionine.