CN109593694B - Ngpiwi protein-mediated bovine-derived escherichia coli gene knockout strain and construction method thereof - Google Patents

Abstract

The invention discloses a bovine-derived escherichia coli gene knockout strain based on Ngpii protein mediation and a construction method thereof; the bovine-derived escherichia coli gene knockout strain is a deletion strain which deletes ORF sequences or partial sequences of potential virulence related genes on bovine-derived escherichia coli genomes. The method comprises the steps of firstly, successfully constructing a recombinant plasmid with Ngpiwi and left and right homologous arms of a target gene sequence to be deleted; secondly, the recombinant plasmid is chemically transformed into bovine Escherichia coli, passage induction double exchange recombination is carried out at 28 ℃, a strain with a deleted target gene sequence is screened out by PCR, and then plasmid loss is induced at 37 ℃ in an antibiotic-free culture medium, so that the strain with a deleted potential virulence gene related sequence is obtained. The genetic operation system has the advantages of small plasmid, easy operation, wide application, no potential off-target effect, high knockout efficiency and no resistance gene screening marker, and provides an excellent tool for the research and development of bovine-derived escherichia coli genetic engineering vaccines.

Description

Ngpiwi protein-mediated bovine-derived escherichia coli gene knockout strain and construction method thereof

Technical Field

The invention relates to the technical field of biological products for livestock, in particular to a bovine escherichia coli gene knockout strain based on Ngpii protein mediation and a construction method thereof.

Background

The bovine colibacillosis is an epidemic disease which is caused by infecting yaks with pathogenic escherichia coli and is characterized by diarrhea and the like, the morbidity of the disease is about 10.1%, the mortality rate is 2.5%, and the mortality rate is 45%, so that the health of the yaks and the economic benefits of farmers are seriously threatened, the health and the rapid development of the Tibetan economy are restricted, and the immeasurable economic loss is often caused to farmers and farmers.

The escherichia coli is one of important diseases seriously harming the yak breeding industry, drug-resistant strains are continuously increased due to the complex serotype and the large use of antibiotics, adverse effects are caused on normal flora of intestinal tracts, great challenges and difficulties are brought to prevention and treatment, and along with the attention on the abuse hazard of antibiotics, the prevention of the disease necessarily depends on good biosafety prevention and control measures and effective vaccines as tools.

At present, farmers mostly adopt conventional inactivated vaccines, generally adopt epidemic yak escherichia coli virulent strains to prepare whole-bacterium inactivated vaccines, and the inactivated vaccines have good safety, do not have risks such as virulence reinforcer and the like, but also can not produce good cross immune protection, and only have immune protection effect on bacterial strain infection of the same serotype.

With the deep research on the virulence genes of escherichia coli, the development of genetic engineering attenuated vaccines becomes the primary choice. Compared with other vaccines, the gene deletion vaccine has multiple advantages, after target genes are knocked out in a targeted manner, the toxicity is obviously weakened, the risk of the toxicity returning is avoided, but the host can be stimulated to generate higher humoral immune response, cellular immune response and mucosal immune response, better immune protection effect is generated, the gene deletion vaccine can be used as a vector for presenting heterologous antigens, a recombinant vector vaccine is constructed, and the application is wider. Unfortunately, due to the difficulty in manipulating the genome of E.coli, resistance selection is often used in the current genome engineering technology, and even if the virulence is reduced significantly, the technology cannot be used as a genetically engineered attenuated vaccine, which limits the possibility of developing the vaccine strain. Therefore, constructing a marker-free system for knocking out bovine Escherichia coli genes is the key for developing genetic engineering vaccine strains.

The researchers reported a new gene editing technology gDNA/NgAgo system which exhibits efficient cleavage of nucleic acids, and also has the advantages of low off-target effect, low tolerance to target site mismatch, and easy design and operation. Although there is controversy about the gene editing effect of this system in eukaryotes, the effect in bovine E.coli has not been studied. Therefore, the technology system is tried to knock out potential virulence related genes such as the ase gene and the like in bovine Escherichia coli.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a bovine-derived escherichia coli gene knockout strain based on Ngpii protein mediation and a construction method thereof. The invention adopts Ngpiwi protein to construct a set of high-efficiency bovine-derived escherichia coli genetic operation system without molecular markers.

In order to achieve the purpose, the invention designs a bovine-derived escherichia coli gene knockout strain based on Ngpii protein mediation, wherein the bovine-derived escherichia coli gene knockout strain is a deletion strain which deletes a potential virulence related sequence on a bovine-derived escherichia coli genome, and the potential virulence related sequence is an ORF sequence or a partial sequence of an ORF of a potential virulence related gene (purified viral-associated genes).

Further, the potential virulence related sequences are selected from the group consisting of sequences encoding succinyl-glutamate desuccinylase (succinyl-glutamate desuccinylase) ORF in the arginine metabolic pathway or partial sequences of ORF, wherein the nucleotide sequence encoding succinyl-glutamate desuccinylase ORF in the arginine metabolic pathway is shown in SEQ ID No. 1.

Still further, the bovine-derived Escherichia coli gene knockout strain is a deletion strain in which a succinyl-glutamate desuccinylase (succinyl-glutamate desuccinylase) ORF sequence encoding an arginine metabolic pathway is deleted on the genome of bovine-derived Escherichia coli, and is named as Δ ase-Ecoli.

The construction method of the bovine-derived escherichia coli gene knockout strain based on Ngpii protein mediation is characterized by comprising the following steps: the method comprises the following steps:

1) construction of the basic plasmid pSHK5TS-NgPiwi with the NgPiwi Gene

a. Designing a primer pair by taking a gene sequence of Natronobacterium gregoryi Piwi (NgPiwi) as shown in SEQ ID No.2 and a fragment sequence of Ribosome Binding Site (RBS) as shown in SEQ ID No.3 as templates:

forward and reverse amplification primers for NgPiwi:

NgPiwi-L：ATGACAGTGATTGACCTCGATTCG，

NgPiwi-RH-R：GCAAGAAAAAATATCAATTAGAGGAATCCGACAT；

forward reverse amplification primers for RBS:

RBS-RH-L：TGTCGGATTCCTCTAATTGATATTTTTTCTTGC，

RBS-R：TATGCACTCCTATTATTTAACTAAGTTGAC；

respectively amplifying to obtain NgPiwi gene fragments and RBS (ribosome binding site) fragments;

b. then fusing the NgPiwi gene segment and the RBS segment to obtain a fusion product NgPiwi-RBS,

c. then inserting the fusion product NgPiwi-RBS between the promoter and the coding region of the resistance gene Kan of the plasmid PSHK5 Ts; constructing a basic plasmid pSHK5TS-NgPiwi with NgPiwi gene;

2) constructing a recombinant plasmid pSHK5TS-NgPiwi-RR-LR with NgPiwi and a potential virulence related sequence RR to be deleted with left and right homology arms;

a. designing a primer by taking an ORF deletion partial sequence of a gene corresponding to a potential virulence related sequence RR to be deleted and a sequence within 1000bp of each upstream and downstream of the ORF sequence as templates;

b. amplifying to obtain left and right homologous arms of a potential virulence related sequence RR to be deleted, namely RR-LR, connecting the left and right homologous arms in series to form a single sequence through fusion PCR, carrying out enzyme digestion and enzyme linkage on the single sequence and a basic plasmid pSHK5TS-NgPiwi, carrying out PCR identification to screen out a correct transformant, extracting a transformant plasmid, and carrying out enzyme digestion and sequencing identification to obtain a recombinant plasmid pSHK5TS-NgPiwi-RR-LR with a NgPiwi gene;

3) bovine-derived escherichia coli gene knockout strain

pSHK5TS-NgPiwi-RR-LR with CaCl₂The method is transformed into bovine Escherichia coli competent cells, PCR identification is carried out, and strains carrying target plasmids are obtained by screening; subculturing, and obtaining a double-exchange strain of the potential virulence related sequence RR by utilizing NgPiwi-mediated homologous recombination; finally will be at the topCulturing the obtained double-exchange strain of the potential virulence related sequence RR at 37 ℃ under the antibiotic-free condition, and inducing plasmid loss, thereby obtaining the bovine Escherichia coli RR gene sequence knockout strain, namely: RR gene sequence knockout strain delta RR-Ecoli.

Further, the potential virulence associated sequence RR to be deleted is selected from the group consisting of the sequence of the ORF encoding the succinyl-glutamate desuccinylase gene (succinyl-glutamate desuccinylase) in the arginine metabolic pathway or a partial sequence of the ORF.

Further, in the step 2), when the potential virulence related sequence RR to be deleted is an ORF sequence or a partial sequence of the ORF of the succinylglutamic acid dessuccinyl gene in the coding arginine metabolic pathway, the sequence of the ORF of the succinylglutamic acid dessuccinyl gene in the coding arginine metabolic pathway and the upstream and downstream 1000bp sequences are represented by SEQ ID No.4 as templates, and a primer pair is designed:

left homology arm forward and reverse primers:

astE-L-SacI-1：TTGAGCTCTTGTTCTGGGTTTCCATGTGC，

astE-L-2：GGAGGGGGCAATGGATTAATACTTACCCGCAGAAATC；

right homology arm forward and reverse primers:

astE-R-3：TCTGCGGGTAAGTATTAATCCATTGCCCCCTCCCTCGC，

astE-R-BamHI-4：TTGGATCCCTTTTTGTCTACGGGCGAGAAG；

the construction method of the succinylglutamic acid desuccinyl gene knockout strain delta ase-Ecoli in the bovine-derived escherichia coli coding arginine metabolic pathway is characterized by comprising the following steps: the method comprises the following steps:

1) the specific method for constructing the basic plasmid pSHK5Ts-NgPiwi for knocking out the target gene of the bovine-derived Escherichia coli comprises the following steps:

a. respectively designing NgPiwi fragment and RBS fragment amplification fusion primers and NgPiwi fragment identification primers by taking SEQ ID No.2 and SEQ ID No.3 as templates; respectively as follows:

forward and reverse amplification primers for NgPiwi:

NgPiwi-L：ATGACAGTGATTGACCTCGATTCG，

NgPiwi-RH-R：GCAAGAAAAAATATCAATTAGAGGAATCCGACAT；

forward reverse amplification primers for RBS:

RBS-RH-L：TGTCGGATTCCTCTAATTGATATTTTTTCTTGC，

RBS-R：TATGCACTCCTATTATTTAACTAAGTTGAC；

identifying the primer fusing NgPiwi to the plasmid:

NgPiwi-JD-F：CAACCCGGTAAGACACGACTTATC，

NgPiwi-JD-R：ATCTGTAACATCATTGGCAACGC；

b. the plasmids pSHK5Ts and NgPiwi-RBS fragments were used as templates to design fusion primers

Primers for amplification of the pSHK5Ts plasmid fusion fragment:

pSHK5TS-RBS-RH-F：AATAATAGGAGTGCATAATGAGCCATATTCAACGGG，

pSHK5TS-NgPiwi-RH-R：AGGTCAATCACTGTCATAACACCCCTTGTATTACTG；

primers for amplification of NgPiwi-RBS fusion fragment:

NgPiwi-Kan-RH-F：AGTAATACAAGGGGTGTTATGACAGTGATTGACCTC，NgPiwi-kan-RH-R：CCGTTGAATATGGCTCATTATGCACTCCTATTATTTA；

c. carrying out PCR amplification on NgPiwi gene by using the forward and reverse amplification primers (NgPiwi-L/NgPiwi-R) of the NgPiwi, and purifying and recovering to obtain a NgPiwi fragment; taking the genome of the Pasteurella strain as a template, carrying out PCR amplification by using RBS amplification primers (RBS-L/RBS-R), and purifying and recovering to obtain an RBS fragment; carrying out tandem PCR on the recovered NgPiwi fragment and the RBS fragment to obtain a fusion product NgPiwi-RBS;

d. PCR was performed using the fusion primers (NgPiwi-Kan-RH-F/NgPiwi-Kan-RH-R) and NgPiwi-RBS as a template, and PCR was performed using the fusion primers (pSHK5TS-RBS-RH-F/pSHK5TS-NgPiwi-RH-R) and the temperature sensitive plasmid vector PSHK5Ts as a template. Purifying and recovering the two PCR products, then carrying out infusion PCR, transforming 5 mu l of the infusion PCR product to escherichia coli DH5 alpha, coating a kanamycin-resistant LA agar plate, selecting a single colony for screening and identifying, carrying out PCR identification by using a primer NgPiwi-JD-F/R, screening a correct transformant for culturing, extracting a plasmid, and after sequencing is correct, naming the basic plasmid as pSHK5 Ts-NgPiwi;

2) the method comprises the following steps of designing primers for knocking out the sequence of the succinylglutamic acid desuccinylase gene ORF in the encoding arginine metabolic pathway, wherein the sequence of the succinylglutamic acid desuccinylase gene ORF in the encoding arginine metabolic pathway and the sequence of each 1000bp at the upstream and downstream are shown as SEQ ID No.4 as templates, and the primers are respectively as follows:

left homology arm forward and reverse primers:

astE-L-SacI-1：TTGAGCTCTTGTTCTGGGTTTCCATGTGC，

astE-L-2：GGAGGGGGCAATGGATTAATACTTACCCGCAGAAATC；

right homology arm forward and reverse primers:

astE-R-3：TCTGCGGGTAAGTATTAATCCATTGCCCCCTCCCTCGC，

astE-R-BamHI-4：TTGGATCCCTTTTTGTCTACGGGCGAGAAG；

primers on the left and right homologous arms of the ORF sequence of the succinylglutamic acid dessuccinyl gene in the metabolic pathway of coding arginine to be deleted on the genome:

astE-ID-F：CTGTCCACCGCATTACTGCAAG，

astE-ID-R：CTGGATGGCAAAGTGCATCTCAC；

3) taking bovine Escherichia coli genome as a template, respectively carrying out PCR amplification on astE-L-SacI-1/astE-L-2 and astE-R-3/astE-R-BamHI-4 by using an astE left homologous arm forward and reverse primer pair and an astE-R-BamHI-4 by using an astE right homologous arm forward and reverse primer pair, purifying and recovering to obtain a left homologous arm PCR product and a right homologous arm PCR product, and carrying out fusion PCR on the left homologous arm PCR product and the right homologous arm PCR product to obtain a fusion product astE-LR;

4) carrying out double enzyme digestion on the fusion product astE-LR and the basic plasmid vector PSHK5Ts-NgPiwi by using SacI and BamHI respectively, connecting the enzyme digestion product astE-LR with the linearized vector fragment PSHK5Ts-NgPiwi, then transforming the connection product into Escherichia coli DH5 alpha, coating kanamycin-resistant LA agar plates, selecting a single colony to be dissolved in 20 mu l of sterilized water, taking out 3 mu l as a template, screening and identifying by using a primer PSHK5Ts-MCS-ID-F/PSHK5Ts-MCS-ID-R, screening and culturing a correct transformant, and extracting a plasmid;

5) identifying the PSHK5Ts-NgPiwi-astELR recombinant plasmid by adopting an enzyme digestion identification method; selecting an NcoI single enzyme digestion method, a BamHI + SacI method and a KpnI + NcoI double enzyme digestion method for identification, adding 1 mu g of plasmid into 20 mu l of system of each tube, carrying out enzyme digestion for three hours at 37 ℃, carrying out electrophoresis observation on the result, and carrying out sequencing after the enzyme digestion identification is correct, thereby obtaining the correct recombinant plasmid PSHK5 Ts-NgPiwi-asteLR;

6) preparing competent cells from the bovine-derived escherichia coli isolate, adding the recombinant plasmid pSHK5Ts-NgPiwi-astELR into the competent cells of the bovine-derived escherichia coli isolate for chemical transformation, recovering for 1h, coating a LA (lactic acid) plate containing kanamycin for culture, and culturing at 28 ℃ to obtain single colonies; performing PCR amplification identification by using primers astE-ID-F/astE-ID-R on both sides of the left and right homologous arms of the ORF partial sequence of the astE gene to be deleted on the genome, wherein if the size of a strip is 2691bp, the strip is a WT strain; if the size of the band is 1731bp, the band is a deletion mutant strain; if the two bands are contained at the same time, the strain is a mixed strain of a deletion strain and a wild strain;

7) and (3) carrying out passage on the bacteria amplified into two bands, carrying out streak culture for purification, carrying out PCR amplification identification by using an astE-ID-F/astE-ID-R primer again, screening to obtain the bacteria amplified to 1731bp, carrying out passage on the bacteria on an LB (lysogeny broth) culture medium without antibiotic addition at 37 ℃, and identifying to obtain a deletion strain of an ORF (ORF) sequence of the succinylglutamic acid desuccinylated gene in the arginine metabolic pathway, wherein the deletion strain is named as delta astE-Ecoli.

The invention has the beneficial effects that:

1. the Ngpii-based method for constructing the engineering strain through knockout of the bacterial gene without the screening marker provides an efficient excellent tool for bovine-derived escherichia coli genetic operation without a molecular marker and for fixed-point knockout of a target gene. Compared with a Cas9 system, the system has smaller plasmid, easier transformation and no need of gRNA or gDNA traction, so that no potential off-target effect exists; and the system has wide application and can also be applied to genetic operation of bovine Escherichia coli.

2. The invention successfully constructs the strain delta ase-Ecoli with the deletion of the succinyl glutamic acid dessuccinyl gene ORF sequence in the bovine-derived escherichia coli coding arginine metabolic pathway through the system. Compared with a resistance gene mediated negative screening system, the system knocks out a target gene at a fixed point, has no resistance molecular marker, and is more suitable for being applied to the development of genetic engineering vaccines; and the screening efficiency is higher and can reach more than 80%.

Drawings

FIG. 1 is a recombinant plasmid employed or constructed in the present invention;

in FIG. 1, panel A is the plasmid map of the basic plasmid PSHK5Ts, and panel B is the plasmid map of the recombinant plasmid PSHK5 Ts-NgPiwi;

FIG. 2 is a schematic diagram of the principle of construction of a knock-out strain of Escherichia coli from bovine origin (taking the deletion of the ORF sequence of the ase gene as an example);

FIG. 3 is a graph showing the result of NgPiwi-RBS amplification;

in the figure, lane 1 is the PCR amplification product of RBS (140 bp); lane 2 is the PCR amplification product of NgPiwi (2664 bp); lane 3 is the NgPiwi-RBS fusion fragment (2804 bp); m is DL5000 DNA Marker;

FIG. 4 is a diagram showing the results of PCR identification of transformants of the recombinant plasmid PSHK5 Ts-NgPiwi; in the figure, lanes 1-7 are PCR amplification products for identifying PSHK5Ts-NgPiwi transformants, and lane 8 is PCR amplification product of negative control water; m is DL5000 DNA Marker;

FIG. 5 is a PCR amplification identification of the recombinant plasmid PSHK5Ts-NgPiwi-asteLR transformant map, lanes 1-5 are the PCR amplification products for identification of plasmid transformants, and lane 6 is the PCR product of the PSHK5Ts-NgPiwi plasmid control; lane 7 is a negative control H₂A PCR amplification product of O; m is DL2000 DNA Marker;

FIG. 6 is a diagram showing the identification of the digested recombinant plasmid PSHK5 Ts-NgPiwi-asteLR; in the figure, a 1: NcoI single enzyme digestion product (6871 bp); a 2: BamHI and SacI double enzyme digestion products (1482bp +5389 bp); a 3: the double cleavage product of KpnI and NcoI (2251bp +4620bp) M1: trans2K plus DNA Marker; m2: trans 15K DNA Marker;

FIG. 7 shows the amplification results of the ASTE double-crossover strains identified and selected by PCR;

in the figure, lanes 1-20: PCR amplification products using the strains to be identified as templates; if the size of the band is 2691bp, the strain is a WT strain; if the size of the band is 1731bp, it is a deletion mutationPerforming strain transformation; lane 21: PCR amplification product with Ecoli genome as template; lane 22: negative control H₂A PCR amplification product of O; m: DL5000 DNA Marker;

FIG. 8 shows the plasmid loss of the ase gene deletion strain after PCR identification and purification; wherein lane 1/2/3/4/5: PCR products with the genome of the screened plasmid-free aste mutant strain as a template; lane 6: PCR amplification products with NP-astelR as a template; lane 7: negative control H₂A PCR amplification product of O; m: DL5000 DNA Marker

FIG. 9 shows the ase gene-deleted strain after PCR identification and purification; primers at the two ends of the left and right arms of the ORF sequence of the aste gene to be deleted on the genome identify the deletion of the ORF sequence of the aste gene; wherein lane 1/2/3/4/5: PCR products with the genome of the screened plasmid-free aste mutant strain as a template; lane 6: PCR amplification product with Ecoli genome as template; lane 7: negative control H₂A PCR amplification product of O; m: DL5000 DNA Marker;

Detailed Description

The invention is described in further detail below with reference to the figures and specific embodiments for the understanding of those skilled in the art.

Example 1

The specific method for constructing the basic plasmid pSHK5Ts-NgPiwi for knocking out the target gene of the bovine-derived Escherichia coli comprises the following steps:

1) respectively designing NgPiwi fragment and RBS fragment amplification fusion primers and NgPiwi fragment identification primers by taking SEQ ID No.2 and SEQ ID No.3 as templates; respectively as follows:

forward and reverse amplification primers for NgPiwi:

NgPiwi-L：ATGACAGTGATTGACCTCGATTCG，

NgPiwi-RH-R：GCAAGAAAAAATATCAATTAGAGGAATCCGACAT；

forward reverse amplification primers for RBS:

RBS-RH-L：TGTCGGATTCCTCTAATTGATATTTTTTCTTGC，

RBS-R：TATGCACTCCTATTATTTAACTAAGTTGAC；

identifying the primer fusing NgPiwi to the plasmid:

NgPiwi-JD-F：CAACCCGGTAAGACACGACTTATC，

NgPiwi-JD-R：ATCTGTAACATCATTGGCAACGC；

2) the plasmids pSHK5Ts and NgPiwi-RBS fragments were used as templates to design fusion primers

Primers for amplification of the pSHK5Ts plasmid fusion fragment:

pSHK5TS-RBS-RH-F：AATAATAGGAGTGCATAATGAGCCATATTCAACGGG，

pSHK5TS-NgPiwi-RH-R：

AGGTCAATCACTGTCATAACACCCCTTGTATTACTG；

primers for amplification of NgPiwi-RBS fusion fragment:

NgPiwi-Kan-RH-F：AGTAATACAAGGGGTGTTATGACAGTGATTGACCTC，NgPiwi-kan-RH-R：CCGTTGAATATGGCTCATTATGCACTCCTATTATTTA；

3) carrying out PCR amplification on NgPiwi gene by using the forward and reverse amplification primers (NgPiwi-L/NgPiwi-R) of the NgPiwi, and purifying and recovering to obtain a NgPiwi fragment; performing PCR amplification by using a Pasteurella genome as a template and RBS amplification primers (RBS-L/RBS-R), and purifying and recovering to obtain RBS fragments; carrying out tandem PCR on the recovered NgPiwi fragment and the RBS fragment to obtain a fusion product NgPiwi-RBS, wherein the result is shown in FIG. 3;

PCR amplification NgPiwi fragment reaction system:

and (3) PCR reaction conditions:

PCR amplification RBS fragment reaction system:

and (3) PCR reaction conditions:

tandem PCR system for NgPiwi and RBS 1:

tandem PCR reaction conditions for NgPiwi and RBS 1:

tandem PCR system 2 for NgPiwi and RBS:

tandem PCR reaction conditions for NgPiwi and RBS 2:

4) PCR was performed using the fusion primers (NgPiwi-Kan-RH-F/NgPiwi-Kan-RH-R) and NgPiwi-RBS as a template, and PCR was performed using the fusion primers (pSHK5TS-RBS-RH-F/pSHK5TS-NgPiwi-RH-R) and the temperature sensitive plasmid vector PSHK5Ts as a template. Purifying and recovering the two PCR products, then performing infusion PCR, transforming 5 mu l of the infusion PCR product into escherichia coli DH5 alpha, coating a kanamycin-resistant LB agar plate, selecting a single colony for screening and identifying, performing PCR identification by using a primer NgPiwi-JD-F/R, screening a correct transformant for culturing as shown in a result shown in figure 4, extracting a plasmid, and after sequencing is correct, naming the basic plasmid as pSHK5 Ts-NgPiwi;

PCR amplification vector pSHK5Ts reaction System:

reaction conditions of the PCR amplification vector pSHK5 Ts:

PCR amplification of NgPiwi-RBS reaction:

PCR amplification NgPiwi-RBS reaction conditions:

infusion PCR reaction System:

infusion PCR reaction conditions:

PCR amplification to identify the reaction system of pSHK5Ts-NgPiwi plasmid transformant:

PCR amplification reaction conditions to identify pSHK5Ts-NgPiwi plasmid transformants:

example 2

The method for obtaining the bovine escherichia coli ase gene ORF sequence deletion strain delta ase-Ecoli comprises the following steps:

1) taking the ORF sequence of the succinylglutamic acid desuccinyl gene in the coding arginine metabolic pathway and the upstream and downstream 1000bp sequences (called as the ase gene ORF sequence for short and the upstream and downstream 300bp sequences) as shown in SEQ ID No.4 as a template, and designing primers for knocking out the ase gene ORF sequence, wherein the primers are respectively as follows:

left homology arm forward and reverse primers:

astE-L-SacI-1：TTGAGCTCTTGTTCTGGGTTTCCATGTGC，

astE-L-2：GGAGGGGGCAATGGATTAATACTTACCCGCAGAAATC；

right homology arm forward and reverse primers:

astE-R-3：TCTGCGGGTAAGTATTAATCCATTGCCCCCTCCCTCGC，

astE-R-BamHI-4：TTGGATCCCTTTTTGTCTACGGGCGAGAAG；

primers on the left and right homologous arms of the ORF sequence of the succinylglutamic acid dessuccinyl gene in the metabolic pathway of coding arginine to be deleted on the genome:

astE-ID-F：CTGTCCACCGCATTACTGCAAG，

astE-ID-R：CTGGATGGCAAAGTGCATCTCAC；

2) taking bovine Escherichia coli genome as a template, respectively carrying out PCR amplification on astE-L-SacI-1/astE-L-2 and astE-R-3/astE-R-BamHI-4 by using an astE left homologous arm forward and reverse primer pair and an astE-R-BamHI-4 by using an astE right homologous arm forward and reverse primer pair, purifying and recovering to obtain a left homologous arm PCR product and a right homologous arm PCR product, and carrying out fusion PCR on the left homologous arm PCR product and the right homologous arm PCR product to obtain a fusion product astE-LR;

upstream homology arm PCR reaction System:

and (3) PCR reaction conditions:

downstream homology arm PCR reaction System:

and (3) PCR reaction conditions:

tandem PCR System for ate-L and ate-R1:

tandem PCR reaction conditions of ase-L and ase-R1:

tandem PCR System of ate-L and ate-R2:

tandem PCR reaction conditions for astE-L and astE-R2:

3) the fusion product aste-LR and the basic plasmid vector PSHK5Ts-NgPiwi (constructed in example 1) were double digested with BamHI and SacI, and the digested product aste-LR and the linearized vector fragment PSHK5Ts-NgPiwi were ligated, then the ligated product was transformed into E.coli DH 5. alpha. and spread on kanamycin-resistant LB agar plates, and single colonies were picked up and dissolved in 20. mu.l of sterile water, 3. mu.l was taken as a template, screened and identified with primers PSHK5Ts-MCS-ID-F/PSHK5Ts-MCS-ID-R, PCR results are shown in FIG. 5, and correct transformants were selected and cultured, and plasmids were extracted.

Enzyme digestion system:

the digestion conditions were 37 ℃ in water bath for 3 h.

Enzyme linked systems:

the conditions of the enzyme linkage are 16 ℃, and the water bath lasts for 8h or overnight.

Adopting MCS two-end primers to identify a PCR reaction system of the NP-astELR plasmid transformant:

PCR reaction conditions for identifying NP-astELR plasmid transformants by using MCS two-end primers:

4) identifying the PSHK5Ts-NgPiwi-asteLR recombinant plasmid by adopting an enzyme digestion identification method; the method of single enzyme digestion of NcoI, BamHI + SacI and KpnI + NcoI is selected for identification, 1 mu g of plasmid is added into 20 mu l of system of each tube, 10U of enzyme is used for enzyme digestion for three hours at 37 ℃, and then the result of electrophoresis observation is shown in figure 6, the enzyme digestion identification is correct, and the correct recombinant plasmid PSHK5Ts-NgPiwi-asteLR is obtained after the sequencing is correct.

5) Preparing competent cells from the bovine-derived escherichia coli isolate, adding the recombinant plasmid pSHK5Ts-NgPiwi-astELR into the competent cells of the bovine-derived escherichia coli isolate for chemical transformation, recovering for 1h, coating a LA (lactic acid) plate containing kanamycin for culture, and culturing at 28 ℃ to obtain single colonies; performing PCR amplification identification by using primers astE-ID-F/astE-ID-R on both sides of the left and right homologous arms of the ORF partial sequence of the astE gene to be deleted on the genome, wherein if the size of a strip is 2691bp, the strip is a WT strain; if the size of the band is 1731bp, the band is a deletion mutant strain; if the two bands are contained, the strain is a mixed strain of a deletion strain and a wild strain. As shown in FIG. 7, the 2691bp large band and 1731bp small band were simultaneously present in the PCR assay.

6) Carrying out passage on the bacteria amplified into two bands, carrying out streak culture for purification, carrying out PCR amplification identification by using an astE-ID-F/astE-ID-R primer again, screening out bacteria only capable of amplifying 1731bp, carrying out passage on the bacteria on an LB culture medium without antibiotic addition at 37 ℃, inducing plasmid loss, extracting the genome of the bacteria with the plasmid loss as a template, and respectively using the primers astE-ID-F/astE-ID-R at the two ends of the left and right upstream homologous arms on the genome; the NgPiwi-L/NgPiwi-R primers are subjected to PCR identification at the same time, the result shows that the NgPiwi-L/NgPiwi-R primers are amplified to have no band as shown in figure 8, and the astE-ID-F/astE-ID-R primers are amplified to have a band with the size of 1731bp as shown in figure 9, which indicates that an astE gene ORF sequence deletion strain is successfully constructed and named as delta astE-Ecoli.

And (2) carrying out PCR identification on a reaction system of the deletion strain by using primers on both sides of the left and right homologous arms of the ORF partial sequence of the aste gene to be deleted on the genome:

primers on both sides of the left and right homologous arms of the ORF partial sequence of the astee gene to be deleted on the genome are used for carrying out PCR identification on the reaction parts of the deleted strain:

if the size of the target fragment amplified by the PCR is a 1731bp band, the deletion of the ORF sequence of the astE gene is successful.

NgPiwi identification primer NgPiwi-L/NgPiwi-R verifies whether the plasmid is lost in the PCR reaction system:

NgPiwi identification primer NgPiwi-L/NgPiwi-R verifies the PCR reaction condition whether the plasmid is lost:

if the PCR amplified band is negative, the plasmid is lost.

Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> bovine-derived escherichia coli gene knockout strain based on Ngpiwi protein mediation and construction method thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 969

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 1

ttagcttatt ttttcgagca ttaatcccgc gcgtaatccc aacgctacca acggattagg 60

gaataacaca tactctacat catgggttac ggtaaaacgt tcctctccgt cctgcgccag 120

caatgttcct ttctcaaacg gcataaaatt cagcgtgtca cttgccatat gcatttcgaa 180

ggacggcgag tggcgagtaa tttgcgaaac cacccgataa cggagcggcg gtgttctcac 240

gataccgaca ctctcaccag atagcagcgc agcaattgcg ctggcagtta ctgcaaactg 300

gcgaagatcg ttttgcccaa agggcaacgc tttgccaagt tccagcgtac aggccagcgc 360

gccaaaatgt ctggcgctga aatgggtaaa cgtaccacca ggttcctgat ggaacaccag 420

cgcctccagc cccgccgcac ccagccacgt cagaaatttc tcgtcccagg gaatgtcgcg 480

ttgcggtaat acaccgaact gcggatgcaa ggagccacga attgcggtat gtagatcaag 540

gtgccagcgc acagattctt tgccctggtc ataaaaatct tccaggcact gttccagttc 600

gcgcgcccga caggtttctc cgctttcagc aaatagctgc caacgaccgc caaacattcg 660

attcatatcg ctatggcaat aacgtttccc ttgcttcagc gcaggaggat tcccgaggat 720

caccagcaac cgccaacgta acgggatctc gccgtgagat atcgcgccaa gcaacgcgtc 780

cagcatctcc acaggtgccg tctcattacc gtgtattccc gctgaaatca ccagtgcgcc 840

ttgcggtggc gttaatggcg tcagttccag cacaccatcg cccagccagc gccagcgaac 900

gccgttgatt tctcgctcgg tgataaccgg ttttttaccc gttaaggtca gagcaagaaa 960

attatccat 969

<210> 2

<211> 2664

<212> DNA

<213> Grignard (halophilic and alkalophilic bacillus Natronobacterium gregoryi)

<400> 2

atgacagtga ttgacctcga ttcgaccacc accgcagacg aactgacatc gggacacacg 60

tacgacatct cagtcacgct caccggtgtc tacgataaca ccgacgagca gcatcctcgc 120

atgtctctcg cattcgagca ggacaacggc gagcggcgtt acattaccct gtggaagaac 180

acgacaccca aggatgtctt tacatacgac tacgccacgg gctcgacgta catcttcact 240

aacatcgact acgaagtgaa ggacggctac gagaatctga ctgcaacata ccagacgacc 300

gtcgagaacg ctaccgctca ggaagtcggg acgactgacg aggacgaaac gttcgcgggc 360

ggcgagccgc tcgaccatca cttggacgac gcgctcaatg agacgccaga cgacgcggag 420

acagagagcg actcaggcca tgtgatgacc tcgttcgcct cccgcgacca actccctgag 480

tggacgctgc atacgtatac gctaacagcc acagacggcg caaagacgga cacggagtac 540

gcgcgacgaa ccctcgcata cacggtacgg caggaactct ataccgacca tgatgcggct 600

ccggttgcaa ctgacgggct aatgcttctc acgccagagc cgctcggcga gaccccgctt 660

gacctcgatt gcggtgtccg ggtcgaggcg gacgagactc ggacactcga ttacaccacg 720

gccaaagacc ggttactcgc ccgcgaactc gtcgaagagg ggctcaaacg ctccctctgg 780

gatgactacc tcgttcgcgg catcgatgaa gtcctctcaa aggagcctgt gctgacttgc 840

gatgagttcg acctacatga gcggtatgac ctctctgtcg aagtcggtca cagtgggcgg 900

gcgtaccttc acatcaactt ccgccaccgg ttcgtaccga agctgacgct cgcagacatc 960

gatgatgaca acatctatcc tgggctccgg gtgaagacga cgtatcgccc ccggcgagga 1020

catatcgtct ggggtctgcg ggacgagtgc gccaccgact cgctcaacac gctgggaaac 1080

cagtccgtcg ttgcatacca ccgcaacaat cagacaccta ttaacactga cctcctcgac 1140

gctatcgagg ccgctgaccg gcgagtcgtc gaaacccgac gtcaagggca cggcgatgat 1200

gctgtctcat tcccccaaga actgcttgcg gtcgaaccga atacgcacca aattaagcag 1260

ttcgcctccg acggattcca ccaacaggcc cgctcaaaga cgcgtctctc ggcctcccgc 1320

tgcagcgaga aagcgcaagc gttcgccgag cggcttgacc cggtgcgtct caatgggtcc 1380

acggtagagt tctcctcgga gtttttcacc gggaacaacg agcagcaact gcgcctcctc 1440

tacgagaacg gtgagtcggt tctgacgttc cgcgacgggg cgcgtggtgc gcaccccgac 1500

gagacattct cgaaaggtat cgtcaatcca ccagagtcgt tcgaggtggc cgtagtactg 1560

cccgagcagc aggcagatac ctgcaaagcg cagtgggaca cgatggctga cctcctcaac 1620

caagctggcg cgccaccgac acggagcgag accgtccaat atgatgcgtt ctcctcgcca 1680

gagagcatca gcctcaatgt ggctggagcc atcgacccta gcgaggtaga cgcggcattc 1740

gtcgtactgc cgccggacca agaaggattc gcagacctcg ccagtccgac agagacgtac 1800

gacgagctga agaaggcgct tgccaacatg ggcatttaca gccagatggc gtacttcgac 1860

cggttccgcg acgcgaaaat attctatact cgtaacgtgg cactcgggct gctggcagcc 1920

gctggcggcg tcgcattcac aaccgaacat gcgatgcctg gggacgcaga tatgttcatt 1980

gggattgatg tctctcggag ctaccccgag gacggtgcca gcggccagat aaacattgcc 2040

gcgacggcga ccgccgtcta caaggatgga actatcctcg gccactcgtc cacccgaccg 2100

cagctcgggg agaaactaca gtcgacggat gttcgtgaca ttatgaagaa tgccatcctc 2160

ggctaccagc aggtgaccgg tgagtcgccg acccatatcg tcatccaccg tgatggcttc 2220

atgaacgaag acctcgaccc cgccacggaa ttcctcaacg aacaaggcgt cgagtacgac 2280

atcgtcgaaa tccgcaagca gccccagaca cgcctgctgg cagtctccga tgtgcagtac 2340

gatacgcctg tgaagagcat cgccgctatc aaccagaacg agccacgggc aacggtcgcc 2400

accttcggcg cacccgaata cttagcgaca cgcgatggag gcggccttcc ccgcccaatc 2460

caaattgaac gagtcgccgg cgaaaccgac atcgagacgc tcactcgcca agtctatctg 2520

ctctcccagt cgcatatcca ggtccataac tcgactgcgc gcctacccat caccaccgca 2580

tacgccgacc aggcaagtac tcacgcgacc aagggttacc tcgtccagac cggagcgttc 2640

gagtctaatg tcggattcct ctaa 2664

<210> 3

<211> 140

<212> DNA

<213> Pasteurella multocida poultry

<400> 3

ttgatatttt ttcttgcaaa gaaccagttg agcagttata ctgctcagct catttatgtc 60

cttgacactt tgtttgagta tcctgaaaac gggcttttca agatcaaagt gtcaacttag 120

ttaaataata ggagtgcata 140

<210> 4

<211> 3031

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 4

ttttcattgt tatcgttcag gtaaccgtgg atggttatcg gcaactcggg tgatttacgt 60

tagtggtgat caggcttttt ttacaactgt ttgagaagag aaaagaaaac cgccgatcct 120

gtccaccgca ttactgcaag gtagtggaca agaccggcgg tcttaagttt tttggctgaa 180

agattattca gcagttgcag gcattttacc ttttgccgct ggacgttctg tcagacgctt 240

ctcaaaatta gcattaaatt gctttttctg ttccggcgtc aggatgttgt aaattttgtt 300

ctgggtttcc atgtgcgcca gcatgttagc tttgcgctgt tcttccattt ttgcgatctg 360

cgcttcagct tttactttat cgaaggtatc gctggcaatg atgtcatgca ttgcgcggcg 420

ttcttccagc ggcggacgtt tcatctggtc acgctggcct ttcatgattt cgcggatctg 480

ctgtttctgc gcgtcggtca ggttcaggtc tttgaacatc atgtcctgat gcggaccgaa 540

cttgcctttg tggtgcatca tcggcttcgc gtcagccggt gctgcggtag tggtgtctgc 600

ggcatgggcc aggttagccg cgccaagagc cagggtagag gcaacaaaca gtgcagttaa 660

tttacgcata ttctatatcc ttcctttcag ttatttatta cggctttctt aagtagcgtg 720

ccgtgttgac gagattaact ttactgactt tagcgtcaat taatcagagc aacggtaaaa 780

caatgaaagt gtaaaaaaca cttttgcgcc aattatggag aaaaaaagaa aatttgatgg 840

agagtgatga gagaatatta caacacgatg attttgcaga gattatgaag aactataccg 900

gatgactggt gataaataaa gcaaataacc aggattaatc tgtattaatt tataagaaag 960

caacttaata cccgcagaat gatttctgcg ggtaagtatt agcttatttt ttcgagcatt 1020

aatcccgcgc gtaatcccaa cgctaccaac ggattaggga ataacacata ctctacatca 1080

tgggttacgg taaaacgttc ctctccgtcc tgcgccagca atgttccttt ctcaaacggc 1140

ataaaattca gcgtgtcact tgccatatgc atttcgaagg acggcgagtg gcgagtaatt 1200

tgcgaaacca cccgataacg gagcggcggt gttctcacga taccgacact ctcaccagat 1260

agcagcgcag caattgcgct ggcagttact gcaaactggc gaagatcgtt ttgcccaaag 1320

ggcaacgctt tgccaagttc cagcgtacag gccagcgcgc caaaatgtct ggcgctgaaa 1380

tgggtaaacg taccaccagg ttcctgatgg aacaccagcg cctccagccc cgccgcaccc 1440

agccacgtca gaaatttctc gtcccaggga atgtcgcgtt gcggtaatac accgaactgc 1500

ggatgcaagg agccacgaat tgcggtatgt agatcaaggt gccagcgcac agattctttg 1560

ccctggtcat aaaaatcttc caggcactgt tccagttcgc gcgcccgaca ggtttctccg 1620

ctttcagcaa atagctgcca acgaccgcca aacattcgat tcatatcgct atggcaataa 1680

cgtttccctt gcttcagcgc aggaggattc ccgaggatca ccagcaaccg ccaacgtaac 1740

gggatctcgc cgtgagatat cgcgccaagc aacgcgtcca gcatctccac aggtgccgtc 1800

tcattaccgt gtattcccgc tgaaatcacc agtgcgcctt gcggtggcgt taatggcgtc 1860

agttccagca caccatcgcc cagccagcgc cagcgaacgc cgttgatttc tcgctcggtg 1920

ataaccggtt ttttacccgt taaggtcaga gcaagaaaat tatccattgc cccctccctc 1980

gcgctggaac ggataaaccg aaccgagatt cagtaattgg ctcaatacat ccagtgcttc 2040

ccgcccttcg cgcagcaatt gcgggtcggc cagatcggca gcagtaaggc gatcgcggta 2100

gtaacgatcc acccagtcat tgagcgcatt aaacagcgta tcgttcatca tcaccgccgg 2160

attcaccgcc cggcgttctt cttctgtcaa taccacccgc aaccgcaggc acgccgggcc 2220

gccgccattc gccatgcttt cacgtaaatc aaagactttt agttcgctaa tcgggttgtc 2280

agcggcaagg agttcattga gataacccca tactccggcg tgttcccgac actcctgagg 2340

cagcaccaac atcatggaac catcatcgcg gctcagcagt tggctgttaa acagataggt 2400

agacaccgta tcagacacgg aaacctgagt tgccggaact tctatcgcca taaaaccatt 2460

gacccgcgca cgcaggtttg ccagtaactg tgactggcga gcgaacgcct gttggtggca 2520

aaacagcacc tggcggttac tcacggcaat cacgtcatta tgaaaaacgc cctggtcgat 2580

aacgtccggg ttttgctggg cgaaaatcac ctgttgggga ttcacctgat tcagccttgc 2640

caccgcctcg ctggcttcgc gagtctgtcg cgccggataa cgggaaggcc gggtatcatt 2700

gccttcttct cgcccgtaga caaaaagttg catacccggt tcaccgtaat gaccgccgag 2760

acgattgtgg tttgccgccc cctcatcacc gagcaacgct acctgtggca acgccgaatg 2820

gacgctaaat ttctcttcgt cgttaaaaat cgcttttaac agcgattcag tgacgggcgc 2880

ttccagcgaa cggtgaaatt tattgttcag gttggcaacg gtgagatgca ctttgccatc 2940

cagcgtatcg gcagatggcg cgatcgttgc cgcattggct acccacattg gcgaagcgga 3000

actgacgctg gaaagccagt gcggtgcctg g 3031

Claims (4)

1. Based onNgThe piwi protein-mediated bovine-derived escherichia coli gene knockout strain is a deletion strain which deletes a potential virulence related sequence on a bovine-derived escherichia coli genome, wherein the potential virulence related sequence is an ORF sequence or a partial sequence of an ORF of the potential virulence related gene; the method is characterized in that: the method comprises the following steps:

1) build beltNgTemperature-sensitive suicide basic plasmid pSHK5TS of piwi geneNgPiwi；

a. To be provided withNatronobacterium gregoryiPiwi gene sequence is shown as SEQ ID No.2 and ribosome binding site fragment sequence is shown as SEQ ID No.3 as a template, and a primer pair is designed:

Ngforward and reverse amplification primers for Piwi:

NgPiwi-L：ATGACAGTGATTGACCTCGATTCG，

NgPiwi-RH-R：GCAAGAAAAAATATCAATTAGAGGAATCCGACAT；

forward reverse amplification primers for RBS:

RBS-RH-L：TGTCGGATTCCTCTAATTGATATTTTTTCTTGC，

RBS-R：TATGCACTCCTATTATTTAACTAAGTTGAC；

respectively amplified to obtainNgPiwi gene fragment and RBS fragment;

b. then will beNgFusing Piwi gene fragment and RBS fragment to obtain fusion productNgPiwi-RBS，

c. Then the fusion product is mixedNgPiwi-RBS was inserted between the promoter and coding region of the resistance gene Kan of plasmid PSHK5 Ts; construct to obtain a bandNgBasic plasmid pSHK5TS-NgPiwi；

2) Build beltNgPiwi and recombinant plasmid pSHK5TS with left and right homology arms of the potential virulence associated sequence RR to be deletedNgPiwi-RR-LR；

a. Designing a primer by taking an ORF deletion partial sequence of a gene corresponding to a potential virulence related sequence RR to be deleted and a sequence within 1000bp of each upstream and downstream of the ORF sequence as templates; the potential virulence related sequence RR to be deleted is a potential virulence related sequence deleted on the bovine Escherichia coli genome;

b. amplifying to obtain the left and right homologous arms of the potential virulence related sequence RR to be deleted as RR-LR, connecting the left and right homologous arms in series into a single sequence by fusion PCR, and connecting the single sequence with the basic plasmid pSHK5TS-NgPiwi carries out enzyme digestion and connection, PCR identification is carried out to screen out correct transformant, transformant plasmid is extracted, and sequencing identification is carried out to obtain the plasmid with the geneNgRecombinant plasmid pSHK5TS-NgPiwi-RR-LR；

3) Bovine-derived escherichia coli gene knockout strain

pSHK5TS-NgCaCl for Piwi-RR-LR₂The method is transformed into bovine Escherichia coli competence, PCR identification is carried out, and a strain carrying a target plasmid is obtained by screening; and subcultured and utilizedNgPiwi-mediated homologous recombination is carried out to obtain a double-exchange strain of a potential virulence related sequence RR; finally, culturing the obtained double-exchange strain of the potential virulence related sequence RR under the antibiotic-free condition, and inducing plasmid loss, thereby obtaining the bovine Escherichia coli RR gene sequence knockout strain, namely: RR gene sequence knockout strain delta RR-Ecoli.

2. The method of claim 1NgThe piwi protein-mediated bovine-derived escherichia coli gene knockout strain construction method is characterized by comprising the following steps: in the step 2), the potential virulence related sequence RR to be deleted is selected from the ORF sequence of the succinylglutamic acid desuccinyl gene in the arginine metabolic pathway.

3. The method according to claim 1 or 2NgThe piwi protein-mediated bovine-derived escherichia coli gene knockout strain construction method is characterized by comprising the following steps: in the step 2), when the potential virulence related sequence RR to be deleted is an ORF sequence or a partial sequence of an ORF of a succinylglutamic acid desuccinylase gene in an encoding arginine metabolic pathway, the ORF sequence of the succinylglutamic acid desuccinylase gene in the encoding arginine metabolic pathway and 1000bp sequences at the upstream and downstream are used as templates as shown in SEQ ID No.4, and a primer pair is designed:

left homology arm forward and reverse primers:

astE-L-SacI-1：TTGAGCTCTTGTTCTGGGTTTCCATGTGC，

astE-L-2：GGAGGGGGCAATGGATTAATACTTACCCGCAGAAATC；

right homology arm forward and reverse primers:

astE-R-3：TCTGCGGGTAAGTATTAATCCATTGCCCCCTCCCTCGC，

astE- R-BamHI- 4：TTGGATCCCTTTTTGTCTACGGGCGAGAAG。

4. a bovine-derived Escherichia coli gene knockout strain delta astE-Ecoli construction method is characterized in that the bovine-derived Escherichia coli gene knockout strain is a deletion strain which deletes an ORF sequence of a succinylglutamic acid desuccinylase gene in an arginine metabolic pathway on a bovine-derived Escherichia coli genome and is named as delta astE-Ecoli, wherein the ORF sequence of the succinylglutamic acid desuccinylase gene in the arginine metabolic pathway is shown as SEQ ID No. 1; the method is characterized in that: the method comprises the following steps:

1) construction of basic plasmid pSHK5Ts for bovine-derived E.coli target Gene knockoutNgThe Piwi specific method comprises the following steps:

a. respectively using SEQ ID No.2 and SEQ ID No.3 as templates for designNgPiwi fragment and RBS fragment amplification fusion primer andNgidentifying primers of Piwi fragments; respectively as follows:

Ngforward and reverse amplification primers for Piwi:

NgPiwi-L：ATGACAGTGATTGACCTCGATTCG，

NgPiwi-RH-R：GCAAGAAAAAATATCAATTAGAGGAATCCGACAT；

forward reverse amplification primers for RBS:

RBS-RH-L：TGTCGGATTCCTCTAATTGATATTTTTTCTTGC，

RBS-R：TATGCACTCCTATTATTTAACTAAGTTGAC；

b. with plasmids pSHK5Ts andNgdesigning fusion primers by taking Piwi-RBS fragment as template, respectively

Primers for amplification of the pSHK5Ts plasmid fusion fragment:

pSHK5TS-RBS-RH-F：AATAATAGGAGTGCATAATGAGCCATATTCAACGGG，

pSHK5TS-NgPiwi-RH-R：

AGGTCAATCACTGTCATAACACCCCTTGTATTACTG；

amplification ofNgPrimers for Piwi-RBS fusion fragment:

NgPiwi-Kan-RH-F：AGTAATACAAGGGGTGTTATGACAGTGATTGACCTC，

NgPiwi-kan-RH-R：CCGTTGAATATGGCTCATTATGCACTCCTATTATTTA；

c. using the above-mentionedNgPiwi forward and reverse amplification primersNgPiwi-L/NgCarrying out PCR amplification on the NgPiwi gene by Piwi-R, and purifying and recycling to obtain a NgPiwi fragment; using wild strain genome as template, using RBS amplification primer RBS-L/RBS-R to make PCR amplification, purifying and recovering to obtain RBS fragment; to be recoveredNgCarrying out tandem PCR on the Piwi fragment and the RBS fragment to obtain a fusion productNgPiwi-RBS；

d. Use of fusion primersNgPiwi-Kan-RH-F/NgPiwi-kan-RH-R, andNgPCR amplification was performed using Piwi-RBS as a template, and the fusion primer pSHK5TS-RBS-RH-F/pSHK5TS-NgPiwi-RH-R, using temperature sensitive plasmid vector PSHK5Ts as template to do PCR amplification; purifying and recovering the two PCR products, then performing infusion PCR, transforming 5 mu L of the infusion PCR product to Escherichia coli DH5 alpha, coating a kanamycin-resistant LB agar plate, selecting a single colony for screening and identifying, screening a correct transformant for culturing, extracting a plasmid, and after correct sequencing, naming the basic plasmid as pSHK5Ts-NgPiwi；

2) The method comprises the following steps of designing primers for knocking out the sequence of the succinylglutamic acid desuccinylase gene ORF in the encoding arginine metabolic pathway, wherein the sequence of the succinylglutamic acid desuccinylase gene ORF in the encoding arginine metabolic pathway and the sequence of each 1000bp at the upstream and downstream are shown as SEQ ID No.4 as templates, and the primers are respectively as follows:

left homology arm forward and reverse primers:

astE-L-SacI-1： TTGAGCTCTTGTTCTGGGTTTCCATGTGC，

astE-L-2： GGAGGGGGCAATGGATTAATACTTACCCGCAGAAATC；

right homology arm forward and reverse primers:

astE-R-3： TCTGCGGGTAAGTATTAATCCATTGCCCCCTCCCTCGC，

astE- R-BamHI- 4：TTGGATCCCTTTTTGTCTACGGGCGAGAAG；

primers on the left and right homologous arms of the ORF sequence of the succinylglutamic acid dessuccinyl gene in the metabolic pathway of coding arginine to be deleted on the genome:

astE-ID-F：CTGTCCACCGCATTACTGCAAG，

astE-ID-R：CTGGATGGCAAAGTGCATCTCAC；

3) taking bovine Escherichia coli genome as a template, respectively carrying out PCR amplification on astE-L-SacI-1/astE-L-2 and astE-R-3/astE-R-BamHI-4 by using an astE left homologous arm forward and reverse primer pair and an astE-R-BamHI-4 by using an astE right homologous arm forward and reverse primer pair, purifying and recovering to obtain a left homologous arm PCR product and a right homologous arm PCR product, and carrying out fusion PCR on the left homologous arm PCR product and the right homologous arm PCR product to obtain a fusion product astE-LR;

4) the fusion product site-LR and the base plasmid vector PSHK5Ts-NgPiwi respectively carries out double enzyme digestion, and the digestion product astE-LR and the linearized vector fragment PSHK5Ts-NgPiwi is connected, then the connection product is transformed into Escherichia coli DH5 alpha, a kanamycin-resistant LA agar plate is coated, a single colony is selected and dissolved in 20 mu L of sterilized water, 3 mu L of the single colony is taken out to be used as a template, a primer PSHK5Ts-MCS-ID-F/PSHK5Ts-MCS-ID-R is adopted for screening and identifying, a correct transformant is screened and cultured, and plasmids are extracted;

5) PSHK5 Ts-identified by enzyme digestion identification methodNgA Piwi-astELR recombinant plasmid; selecting the NcoI single enzyme digestion, BamHI + SacI and NcoI + SacI double enzyme digestion method for identification, carrying out electrophoresis observation result, carrying out sequencing after the enzyme digestion identification is correct, thereby obtaining the correct recombinant plasmid PSHK5Ts-NgPiwi-astELR；

6) Competent cells were prepared from isolates of Escherichia coli derived from cattle, and the recombinant plasmid pSHK5Ts-NgAdding Piwi-astELR into competent cells of bovine Escherichia coli isolate for chemical transformation, recovering for 1h, coating LA plate containing kanamycin, culturing, and culturing at 28 deg.C to obtain single colony; performing PCR amplification identification by using primers astE-ID-F/astE-ID-R on both sides of the homologous arms of the left and right sides of the ORF partial sequence of the astE gene to be deleted on the genome, wherein if the size of a strip is 1731bp, the strip is a deletion mutant strain;

7) and (3) carrying out passage on the bacteria amplified into two bands, carrying out streak culture for purification, carrying out PCR amplification identification by using an astE-ID-F/astE-ID-R primer again, screening to obtain the bacteria amplified to 1731bp, carrying out passage on the bacteria on an LB (lysogeny broth) culture medium without antibiotic addition at 37 ℃, and identifying to obtain a deletion strain of an ORF (ORF) sequence of the succinylglutamic acid desuccinylated gene in the arginine metabolic pathway, wherein the deletion strain is named as delta astE-Ecoli.

Images