CN109554477B

CN109554477B - Kit for multiple detection of chemotherapy drug toxicity related genotyping

Info

Publication number: CN109554477B
Application number: CN201910009412.4A
Authority: CN
Inventors: 蒋析文; 黄桃生; 李欣钰
Original assignee: Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Da'an Gene Co ltd
Priority date: 2019-01-04
Filing date: 2019-01-04
Publication date: 2022-04-01
Anticipated expiration: 2039-01-04
Also published as: CN109554477A

Abstract

The invention provides a kit for detecting toxicity-related genotyping of chemotherapeutic drugs in multiple ways, in particular to a kit for detecting toxicity-related genotyping of the chemotherapeutic drugs in multiple ways by utilizing multiple asymmetric PCR technology and an electrochemical gene sensor method and a detection method thereof.

Description

Kit for multiple detection of chemotherapy drug toxicity related genotyping

Technical Field

The invention relates to the technical field of in-vitro diagnostic reagents, in particular to a kit for detecting multiple chemotherapy drug toxicity related genotyping by utilizing multiple asymmetric PCR technology and an electrochemical gene sensor method and a detection method thereof.

Background

Nowadays, tumor chemotherapy is widely used in clinic, but the current "standard chemotherapy" scheme for tumor therapy is based on group sample research and is based on evidence-based medicine, and the limitations of this therapy method are that it cannot effectively consider the polymorphism of tumor and host gene, and cannot effectively predict the curative effect of the drug on tumor and some possible toxic reaction. The standard treatment scheme adopted for the same type of tumor is not individualized, more than half of tumor patients receive possibly ineffective chemotherapy, and the toxic and side effects of the medicine, the economic burden and the deterioration of the disease condition are borne for the treatment.

With the research on tumor chemotherapy drugs, people find that the curative effect and toxic and side effects of some drugs are closely related to some gene sites, the mechanism is that the activity of drug metabolism genes is reduced due to the change of a plurality of sites, and the activity of the genes is directly lost due to some drugs, so that the drug metabolism is obstructed and a series of serious chemotherapy toxic and side effects are caused. However, the heterogeneity of the tumors themselves and among different patients often results in a great difference in the sensitivity and toxic side effects of patients to "standard chemotherapy". Therefore, before clinical tumor treatment, relevant genes of patients are detected, the curative effect and the toxic and side effects of the antitumor drugs are predicted, the chemotherapeutic drugs are reasonably selected, the pain of the tumor patients can be fundamentally relieved by realizing individual treatment, the survival quality of the patients is improved, and the survival probability of the patients in the chemotherapeutic process is improved.

Currently, commonly used SNP genotyping detection methods include a real-time fluorescence PCR method, a PCR-Sanger sequencing method, a PCR-high resolution melting curve (HRM) method, a PCR-gene chip method and the like.

The real-time fluorescence PCR method has the advantages of high sensitivity, accurate typing, simple and quick operation, easy popularization of the used instruments and easy popularization and use. However, the method has low flux and high probe cost, the detection cost of a single site is related to the sample size, and the smaller the sample size is, the higher the cost is.

The PCR-Sanger sequencing method belongs to qualitative detection, and has the advantages of long sequencing length and discovery of new variation sites. The main defects are as follows: the sensitivity is not high, and particularly when the somatic mutation of the tumor tissue is detected, a false negative result can occur when the mutation proportion of a target gene in the tissue is lower than 20 percent; has special requirements on reagents and instruments, and is not easy to popularize; complex operation, relatively high cost, slow speed and low flux.

The PCR-high resolution melting curve (HRM) method has the advantages of simple and convenient operation, rapidness, large flux, low use cost, accurate result, contribution to realizing closed tube operation and capability of determining the methylation degree according to the melting curve during methylation detection. The disadvantages of this method are: the inability to exclude newly emerging genetic variations in the nucleic acid to be detected; since the single base mutation causes very little change in the melting temperature of DNA, the method has high requirements on the sensitivity and resolution of the instrument.

Therefore, those skilled in the art are dedicated to develop a novel molecular diagnostic method which has high accuracy and simple operation and can simultaneously detect SNP sites of toxicity-related genes of various chemotherapeutic drugs so as to guide the individual administration of various chemotherapeutic drugs.

Disclosure of Invention

The invention aims to provide a kit for detecting multiple chemotherapy drug toxicity related genotyping based on a multiple asymmetric PCR-electrochemical gene sensor method.

In a first aspect of the present invention, there is provided a primer pair set for detecting toxicity-related genotyping of a chemotherapeutic drug, the primer pair set comprising a first primer pair set comprising one or more primer pairs selected from the group consisting of primer pairs one to nine:

and (3) primer pair one:

1F：SEQ ID NO.:1；1R：SEQ ID NO.:2

and (3) primer pair II:

2F：SEQ ID NO.:3；2R：SEQ ID NO.:4

and (3) primer pair III:

3F：SEQ ID NO.:5；3R：SEQ ID NO.:6；

and (4) primer pair IV:

4F：SEQ ID NO.:7；4R：SEQ ID NO.:8

and a fifth primer pair:

5F：SEQ ID NO.:9；5R：SEQ ID NO.:10

and a sixth primer pair:

7F：SEQ ID NO.:13；7R：SEQ ID NO.:14

a seventh primer pair:

16F：SEQ ID NO.:31；16R：SEQ ID NO.:32

eight primer pairs:

17F：SEQ ID NO.:33；17R：SEQ ID NO.:34

and a primer pair is nine:

19F：SEQ ID NO.:37；19R：SEQ ID NO.:38。

in another preferred example, the primer pair set further comprises a second primer pair set comprising one or more primer pairs selected from the group consisting of primer pairs ten through primer pair twenty:

ten primer pairs:

6F：SEQ ID NO.:11；6R：SEQ ID NO.:12

eleven primer pairs:

8F：SEQ ID NO.:15；8R：SEQ ID NO.:16

twelve primer pairs:

9F：SEQ ID NO.:17；9R：SEQ ID NO.:18

thirteen primer pairs:

10F：SEQ ID NO.:19；10R：SEQ ID NO.:20

fourteen primer pairs:

11F：SEQ ID NO.:21；11R：SEQ ID NO.:22

fifteen primer pairs:

12F：SEQ ID NO.:23；12R：SEQ ID NO.:24

sixteen primer pairs:

13F：SEQ ID NO.:25；13R：SEQ ID NO.:26

seventeen primer pairs:

14F：SEQ ID NO.:27；14R：SEQ ID NO.:28

eighteen primer pairs:

15F：SEQ ID NO.:29；15R：SEQ ID NO.:30

nineteen primer pairs:

18F：SEQ ID NO.:35；18R：SEQ ID NO.:36

twenty primer pairs:

20F：SEQ ID NO.:39；20R：40。

in another preferred embodiment, the first primer pair set includes at least two primer pairs of primer pair one to primer pair nine.

In another preferred embodiment, the first primer pair set includes five primer pairs from the first primer pair to the ninth primer pair.

In another preferred example, the second set of primer pairs includes at least two primer pairs of primer pair ten to primer pair twenty.

In another preferred example, the second set of primer pairs includes six primer pairs of primer pairs ten to twenty.

In another preferred embodiment, the first set of primer pairs and/or the second set of primer pairs are used in multiplex asymmetric PCR.

In another preferred embodiment, the first primer pair set and/or the second primer pair set further comprises:

in a second aspect of the present invention, there is provided a signaling probe set for detecting chemotherapy drug toxicity-related genotyping, the signaling probe set comprising one or more signaling probes selected from the group consisting of:

targeting rs1799782 signaling probe:

SP-1：SEQ ID NO.:41

SP-2：SEQ ID NO.:42；

targeting rs25487 signaling probe:

SP-3：SEQ ID NO.:43

SP-4：SEQ ID NO.:44；

targeting rs 1695 signaling probe:

SP-5：SEQ ID NO.:45

SP-6：SEQ ID NO.:46；

targeting rs11615 signaling probe:

SP-7：SEQ ID NO.:47

SP-8：SEQ ID NO.:48；

targeting rs 1056836 signaling probe:

SP-9：SEQ ID NO.:49

SP-10：SEQ ID NO.:50；

targeting rs1045642 signaling probe:

SP-11：SEQ ID NO.:51

SP-12：SEQ ID NO.:52；

targeting rs2072671 signaling probe:

SP-13：SEQ ID NO.:53

SP-14：SEQ ID NO.:54；

targeting rs60369023 signaling probe:

SP-15：SEQ ID NO.:55

SP-16：SEQ ID NO.:56；

targeting rs3918290 signaling probe:

SP-17：SEQ ID NO.:57

SP-18：SEQ ID NO.:58；

targeting rs 1801159 signaling probe:

SP-19：SEQ ID NO.:59

SP-20：SEQ ID NO.:60；

targeting rs 1801265 signaling probe:

SP-21：SEQ ID NO.:61

SP-22：SEQ ID NO.:62；

targeting rs1801133 signaling probe:

SP-23：SEQ ID NO.:63

SP-24：SEQ ID NO.:64；

targeting rs2372536 signaling probe:

SP-25：SEQ ID NO.:65

SP-26：SEQ ID NO.:66；

targeting rs1042028 signaling probe:

SP-27：SEQ ID NO.:67

SP-28：SEQ ID NO.:68；

targeting rs4148323 signaling probe:

SP-29：SEQ ID NO.:69

SP-30：SEQ ID NO.:70；

targeting rs8175347 signaling probe:

SP-31：SEQ ID NO.:71

SP-32：SEQ ID NO.:72；

targeting rs 10046 signaling probe:

SP-33：SEQ ID NO.:73

SP-34：SEQ ID NO.:74；

targeting rs4646 signaling probe:

SP-35：SEQ ID NO.:75

SP-36：SEQ ID NO.:76；

targeting rs 1142345 signaling probe:

SP-37：SEQ ID NO.:77

SP-38：SEQ ID NO.:78；

targeting rs 1800460 signaling probe:

SP-39：SEQ ID NO.:79

SP-40：SEQ ID NO.:80；

targeting rs 1800462 signaling probe:

SP-41：SEQ ID NO.:81

SP-42：SEQ ID NO.:82；

targeting rs 116855232 signaling probe:

SP-43：SEQ ID NO.:83

SP-44：SEQ ID NO.:84。

in another preferred embodiment, the 5' end of the signaling probe is labeled with Fc (ferrocene molecule).

In a third aspect of the present invention, there is provided a capture probe set for detecting chemotherapy drug toxicity-related genotyping, the capture probe set comprising one or more capture probes selected from the group consisting of:

CP-1：SEQ ID NO.:85，

CP-2：SEQ ID NO.:86，

CP-3：SEQ ID NO.:87，

CP-4：SEQ ID NO.:88，

CP-5：SEQ ID NO.:89，

CP-6：SEQ ID NO.:90，

CP-7：SEQ ID NO.:91，

CP-8：SEQ ID NO.:92，

CP-9：SEQ ID NO.:93，

CP-10：SEQ ID NO.:94，

CP-11：SEQ ID NO.:95，

CP-12：SEQ ID NO.:96，

CP-13：SEQ ID NO.:97，

CP-14：SEQ ID NO.:98，

CP-15：SEQ ID NO.:99，

CP-16：SEQ ID NO.:100，

CP-17：SEQ ID NO.:101，

CP-18：SEQ ID NO.:102，

CP-19：SEQ ID NO.:103，

CP-20：SEQ ID NO.:104，

CP-21: 105 of SEQ ID NO. and

CP-22：SEQ ID NO.:106。

in another preferred example, the 3' end of the capture probe is labeled with C6S-S, and the capture probe is covalently immobilized on the surface of the gold electrode of the printed circuit board through C6S-S.

In a fourth aspect of the present invention, a kit for detecting a chemotherapeutic drug toxicity-related genotyping is provided, wherein the kit comprises the primer pair group of the first aspect of the present invention.

In another preferred embodiment, the kit further comprises a signaling probe set according to the second aspect of the present invention.

In another preferred embodiment, the kit further comprises a capture probe set according to the third aspect of the present invention.

In another preferred embodiment, the kit further comprises one or more components selected from the group consisting of: Tris-HCl, deoxyribonucleoside triphosphates, (NH)₄)₂SO₄、MgCl₂KCl, fetal bovine serum (NBS), NaClO₄C-MMLV reverse transcriptase, RNase inhibitor, and hot start Taq enzyme.

In a fifth aspect of the present invention, there is provided a method for detecting a chemotherapeutic drug toxicity-related genotyping, said method comprising the steps of:

(1) providing a sample to be detected, and extracting the genomic nucleic acid of the sample to be detected;

(2) adding the genomic nucleic acid of the sample to be detected extracted in the step (1) into a PCR tube filled with a first reaction solution and a second reaction solution respectively, and performing multiple asymmetric PCR amplification to obtain a first PCR amplification product and a second PCR amplification product respectively;

wherein the first reaction solution comprises the first primer pair set; the second reaction solution comprises the second primer pair set;

(3) PCR product hybridization detection

And uniformly mixing the first PCR amplification product and the second PCR amplification product, mixing with the electrochemical hybridization solution, adding the mixture to an electrochemical detection chip, and detecting in the electrochemical gene chip.

In another preferred embodiment, the PCR amplification conditions are: 50 ℃ for 3 minutes, 96 ℃ pre-denaturation for 15 minutes, then 96 ℃ for 45 cycles of 45 seconds → 62 ℃ for 30 seconds → 72 ℃ for 30 seconds amplification, and finally 72 ℃ extension for 7 minutes.

In another preferred embodiment, the electrochemical hybridization solution comprises: electrochemical hybridization solution I, NBS buffer solution and NaClO₄Wherein the electrochemical hybridization solution I comprises the signal probe group according to the second aspect of the present invention.

In another preferred embodiment, the electrochemical gene chip comprises the capture probe set according to the third aspect of the present invention.

In another preferred example, the sample to be tested is derived from a tumor patient.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 is a signal diagram of rs1799782 homozygous wild type at XRCC1 gene.

FIG. 2 Signal diagram of rs1799782 heterozygous mutant on XRCC1 gene.

FIG. 3 Signal diagram of rs1799782 homozygous mutant on XRCC1 gene.

FIGS. 4 to 25 show scattergrams of the results of each SNP site in 50 clinical specimens.

Fig. 26 shows the result of the test of comparative example 1.

Fig. 27 shows a part of the test results of comparative example 2.

Fig. 28 shows a part of the test results of comparative example 3.

Detailed Description

The invention obtains a kit for detecting toxicity-related genotyping of multiple chemotherapeutics by utilizing multiple asymmetric PCR technology and an electrochemical gene sensor method and a detection method thereof through extensive and intensive research, and experimental results show that the detection method and the kit have the advantages of good detection accuracy, high specificity, simple and automatic operation and higher flux, and can provide important references for medication guidance of various clinical common chemotherapeutics such as platinum drugs, taxol drugs, 5-fluorouracil and the like of tumor patients.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

Electrochemical gene chip method

The electrochemical gene chip method (cn201310166271.x, CN201210590669.1,) detects the current value (signal value) by an electrochemical gene chip analysis system, and determines the genotype of each point, thus easily completing the medium flux detection. In addition, the device has the advantages of low price, simple and light equipment, simple operation and quick and accurate test. In the invention, a novel molecular diagnosis method for simultaneously detecting the toxicity-related genotyping of various chemotherapeutic drugs based on a multiple asymmetric PCR-electrochemical gene chip method is established, and a kit thereof is developed, thereby having important significance for clinical use and monitoring of the chemotherapeutic drugs.

The electrochemical gene sensor chip takes a printed circuit board treated by a special chemical method as a carrier, fixes various probes or target segments on the surface of the printed circuit board in a chemical bond combination mode, and utilizes ferrocene derivatives as an electrochemical indicator to form a microarray chip for hybridization reaction or antigen-antibody reaction.

Multiplex asymmetric PCR

Multiplex PCR (multiplex PCR), also called multiplex PCR or multiplex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments, and the reaction principle, reaction reagents and operation process are the same as those of ordinary PCR.

Asymmetric PCR (asymmetric PCR) is a PCR amplification that produces large amounts of single-stranded DNA (ssDNA) using unequal amounts of a pair of primers. The pair of primers are referred to as non-limiting primer and limiting primer, respectively, and the ratio thereof is preferably 5-20: 1. In the first 10-15 cycles of the PCR reaction, the amplification product is mainly double-stranded DNA, but when the restriction primers (low concentration primers) are consumed, PCR using non-restriction primers (high concentration primers) will produce a large amount of single-stranded DNA. The key of asymmetric PCR is to control the absolute amount of the restriction primers, and to optimize the ratio of the two primers by multiple searches. Another method is to prepare ssDNA by PCR amplification using primers of equal concentration to prepare double-stranded DNA, (dsDNA), and then performing a second PCR using the dsDNA as a template and one of the primers. ssDNA prepared by asymmetric PCR is mainly used for nucleic acid sequence determination.

There are many factors that affect multiple asymmetric PCR reactions, such as:

(1) the imbalance of the reaction system causes some dominant primers and templates thereof to be rapidly amplified in the previous rounds of reactions, and a large amount of amplification products are obtained, and the amplification products are good inhibitors of DNA polymerase. Therefore, the polymerization ability of polymerase is more and more strongly inhibited with the occurrence of a large amount of amplification products, and thus, primers and templates thereof which are at a disadvantage in the early stage are more difficult to react, and finally, the amount of amplification products is so small that they cannot be detected.

(2) The primer specificity, if the primer has stronger binding force with other non-target gene fragments in the system, the ability of the target gene to bind the primer is contended, thereby leading to the reduction of the amplification efficiency.

(3) The optimal annealing temperatures are different, a plurality of pairs of primers are placed in a system for amplification, and the optimal annealing temperatures of each pair of primers are required to be close to each other because the annealing temperatures for PCR reaction are the same.

(4) Primer dimers, including dimers between primers and hairpin structures formed by the primers themselves, are third-party DNA-mediated dimers, and these dimers, like non-specific primers, interfere with the competition between primers and target binding sites, affecting amplification efficiency.

Although several factors affecting amplification efficiency are mentioned above, more are not clear. To date, there is no effective method for clearly predicting amplification efficiency.

The invention designs a primer and a probe after deeply comparing and analyzing the existing chemotherapy drug toxicity related gene typing, then optimally selects and verifies the designed primer and probe, and finally determines the primer and probe sequence for multiple asymmetric PCR amplification, thereby providing a PCR-electrochemical gene chip method detection kit for common chemotherapy drug toxicity related gene typing on the basis.

The inventor designs and experimentally verifies the chemotherapy drug toxicity related genotyping PCR amplification primer in the research process. The results show that the difficulty of simultaneously detecting 22 chemotherapy drug toxicity related genotypes by using a multiplex PCR amplification system is extremely high. Through intensive research and repeated experiments, the inventor unexpectedly discovers that the biggest problem of mutual interference inhibition between primers of a multiple asymmetric PCR system can be well solved by dividing the chemotherapy drug toxicity related genotyping into two groups (namely a first primer pair set and a second primer pair set) for carrying out multiple PCR amplification, and meanwhile, the design of specific primers and probes ensures the good specificity of the electrochemical gene chip method. The DNA electrochemical gene sensor biochip is a new method combining nucleic acid hybridization technology and electrochemical sensor technology to help diagnose the disease of patient simply, quickly, accurately and cheaply. The technology fixes a large number of ssDNA probes on a support (electrode) in a regular arrangement to form a two-dimensional ssDNA probe array, is used by combining with an electrochemical technology, can simultaneously detect and analyze a large number of DNAs, and has the advantages of simple operation, high detection efficiency and high automation degree.

The invention provides a multi-gene locus typing detection kit which is convenient to operate and high in detection efficiency and is used for guiding the individual administration of chemotherapeutic drugs, and the kit can be used for detecting the allelic gene types of 22 SNP loci on various genes closely related to the toxicity of the chemotherapeutic drugs at one time. For a detailed report of the genotyping associated with toxicity of chemotherapeutic agents, reference is made to the literature.

In a preferred embodiment of the invention, the invention provides a kit for detecting toxicity-related genotyping of multiple chemotherapeutic drugs based on a multiple asymmetric PCR-electrochemical gene sensor method, which comprises a reaction solution A and a reaction solutionB. Hybrid solution I, NBS, NaClO₄(ii) a The reaction solution A (containing a first primer pair set) and the reaction solution B (containing a second primer pair set) comprise PCR primers based on corresponding gene groups; the gene group comprises XRCC1, GSTP1, ERCC1, CYP1B1, MDR1, CDA, DPYD, MTHFR, ATIC, SULT1A1, UGT1A1, CYP19A1, TPMT and NUDT 15; specifically, each PCR primer is shown in table 1:

TABLE 1 primer characteristics Table

The PCR primers effectively solve the problems of ineffective, inefficient or non-specific amplification of the high GC content sequence PCR amplification, and have good applicability to the non-high GC content sequence PCR amplification.

The hybridization solution I comprises a group of oligonucleotide signal probes specifically binding to PCR products, and the sequences of the oligonucleotide signal probes are shown in Table 2:

TABLE 2 Signal Probe characterization Table

The kit for detecting toxicity-related genotyping of multiple chemotherapeutic drugs based on the multiple asymmetric PCR-electrochemical gene sensor method also comprises a group of oligonucleotide capture probes which can be fixed on the surface of a specially-made printed circuit board metal electrode in a covalent bond mode, and the sequence of the oligonucleotide capture probes is shown in Table 3:

TABLE 3 Capture Probe characterization Table

The 3' end of the capture probe is marked with C6S-S and is fixed on the surface of a specially-made printed circuit board gold electrode in a covalent bond mode for capturing PCR products; the 5' end of the signal probe is marked by different ferrocene markers, the signal probe is specifically hybridized with the captured PCR product, alternating voltage is applied to an electrode, ferrocene is subjected to redox reaction, and the result is judged to be positive or negative through detecting the current value. The hybridization mode of the PCR product and the double probes ensures the good specificity of the electrochemical gene chip method.

In a preferred embodiment of the present invention, the specific components and amounts of the above-mentioned genotyping kit for toxicity of heavy chemotherapeutic drugs according to the present invention are as follows in tables 4 and 5:

TABLE 4PCR reaction solution recipe (reaction solution A)

TABLE 5PCR reaction solution recipe (reaction solution B)

The invention also provides a method for detecting 22 SNP sites of toxic genes of various chemotherapeutic drugs by a PCR-electrochemical gene sensor method, which specifically comprises the following steps:

(1) collecting a sample and extracting genome DNA by adopting a recommended extraction kit;

(2) and (3) adding 15 mu l of the extracted sample genome DNA into the reaction solution A, B respectively for multiple asymmetric PCR amplification, wherein the PCR reaction conditions are as follows: pre-denaturation at 50 ℃ for 3 min, 96 ℃ for 15 min, followed by amplification at 96 ℃ for 45 sec → 62 ℃ for 30 sec → 72 ℃ for 30 sec for 45 cycles, and final extension at 72 ℃ for 7 min;

(3) mixing the PCR amplification product A, B well, and sequentially adding 70 μ l of hybridization solution I, 10 μ l of NBS and 20 μ l of NaClO₄Mixing, transferring to tube of electrochemical sensor, and pressing tube cover. And then inserting the sensor into an electrochemical instrument for detection to obtain a result.

The main advantages of the invention are:

the kit for detecting the toxicity-related genotyping of the multiple chemotherapeutic drugs based on the multiple asymmetric PCR-electrochemical gene sensor method has the advantages of good detection accuracy, high specificity, simplicity and automation in operation and higher flux, and provides important reference for the medication guidance of various clinical common chemotherapeutic drugs such as platinum drugs, taxol drugs, 5-fluorouracil and the like for tumor patients.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

The invention establishes a detection method for typing 22 SNP loci of genes related to toxicity of various chemotherapeutic drugs by a multiple asymmetric PCR-electrochemical gene sensor method.

EXAMPLE 1 optimization and determination of multiple chemotherapeutic drug toxicity-related genotyping kit

1.1 design and optimization of primers:

the sequences near the corresponding SNP sites are searched and downloaded by using the NCBI database, primers are designed, a large amount of screening research work is carried out, and finally each PCR primer and the multiple PCR reaction system in the table 1 are determined.

Optimization of primer concentration: using orthogonal design experiments, agarose gel electrophoresis and PCR reaction tests were performed on the upstream and downstream primers in a 50. mu.l reaction system at a ratio of 1/10 to 5/50, and the optimal working concentration of each primer was determined by repeating the tests for a number of times as shown in Table 4 above.

1.2 reaction system optimization:

optimizing the dosage of the hot start Taq enzyme: by utilizing an orthogonal design experiment, PCR reaction is carried out in a 50 mu l reaction system by using enzyme dosage/reaction with concentration gradient from 2U (enzyme unit) to 10U respectively, and the optimal Taq enzyme dosage is finally determined to be 7U/reaction after repeated experiments.

Optimization of the dosage of UNG enzyme: by utilizing an orthogonal design experiment, PCR reactions are respectively carried out in a 50 mu l reaction system by using enzyme dosage/reaction with a concentration gradient from 0.05U (enzyme unit) to 0.2U, and the optimal UNG enzyme dosage is finally determined to be 0.1U/reaction after repeated experiments.

Optimization of dNTPs concentration: by utilizing an orthogonal design experiment, carrying out PCR reaction by respectively using dNTPs with concentration gradient from 1.0mmol/L to 2mmol/L in a 50 mu L reaction system, and finally determining the optimal concentration of the dNTPs to be 1.8mmol/L through repeated experiments.

Optimizing template sample adding amount: under the condition that other components in the reaction system are not changed, the sample adding amount of the gradient from 5 mu l to 20 mu l is respectively tested, PCR reaction is carried out, and the optimal sample adding amount is finally determined to be 15 mu l through repeated tests.

Optimization of reaction temperature: the annealing temperature and extension time are mainly optimized according to the activity of the enzyme and the length of the oligonucleotide, and the optimal reaction temperature and time are finally determined through repeated experiments: pre-denaturation at 50 ℃ for 3 min and 96 ℃ for 5 min; then 45 cycles of 96 ℃ for 45 seconds, 62 ℃ for 30 seconds, 72 ℃ for 30 seconds; final extension at 72 ℃ for 7 min.

1.3 determination of detection limit of kit:

extracting genome DNA from subcultured human gastric cancer cells, measuring the concentration of the genome DNA, diluting the genome DNA in a gradient manner to a concentration gradient of 100 ng/microliter, 50 ng/microliter, 10 ng/microliter, 5 ng/microliter and 1 ng/microliter, repeating the concentration gradient for 10 times respectively, performing multiple asymmetric PCR (polymerase chain reaction) qualitative amplification, and performing hybridization detection in an electrochemical gene sensor detection system, wherein the detection result shows that when the concentration of the human genome DNA is 1 ng/microliter, part of loci have no signals; when the DNA concentration is 5 ng/. mu.l to 100 ng/. mu.l, the detection result of each site is correct through Sanger sequencing and rechecking. Therefore, the detection limit of the kit is determined to be 5 ng/. mu.l.

Example 2 multiple chemotherapy drug toxicity-related genotyping kit clinical sample detection Material and method

2.1 sample genomic DNA extraction sample requirements:

(1) the types of applicable specimens are as follows: peripheral whole blood.

(2) Collecting a specimen: 2ml of venous blood of a detected person is extracted by a disposable sterile syringe, the venous blood is injected into a glass tube containing EDTA or sodium citrate anticoagulant, the glass tube is immediately and slightly inverted and mixed for 5-10 times, the anticoagulant and the venous blood are fully and uniformly mixed, and the venous blood is sealed and sent for inspection.

(3) Specimen preservation and transport: the specimen can be immediately used for testing; the preservation period is 12 months at the temperature of minus 20 plus or minus 5 ℃; if long-term storage is required, the product is stored at minus 80 +/-5 ℃; repeated freezing and thawing of the specimen should be avoided. The specimen is transported in a sealed mode by adding ice in an ice kettle or adding ice in a foam box, and the transportation time is not more than 4 days.

The method comprises the following operation steps:

50 samples of peripheral whole blood of tumor patients are collected, and genomic DNA is extracted by using a nucleic acid extraction kit (such as a nucleic acid extraction and purification kit (centrifugal column method) and a nucleic acid extraction and purification kit (magnetic bead method)) produced by Daan GenBank of China university, wherein the specific operation steps are carried out according to the directions of kit specifications.

2.2 multiplex asymmetric PCR amplification and electrochemical hybridization detection

Adding 15 mul of extracted sample genome DNA into the reaction solution A, B respectively to carry out multiple asymmetric PCR amplification, wherein the PCR reaction conditions are as follows: 50 ℃ for 3 min, 96 ℃ for 15 min, followed by amplification for 45 cycles of 96 ℃ for 45 sec → 62 ℃ for 30 sec → 72 ℃ for 30 sec, and finallyPost 72 ℃ extension for 7 minutes; mixing the PCR amplification product A, B uniformly, and sequentially adding 70 μ l of signal probe mixture, 10 μ l of NBS and 20 μ l of NaClO₄Mixing, transferring to electrochemical sensor, and pressing tube cover. The sensor was then inserted into an electrochemical instrument for detection and results were obtained (see fig. 4-25).

2.3 analysis of electrochemical results

The kit can simultaneously detect the allelic type of 22 SNP loci on 14 genes related to the toxicity of chemotherapeutic drugs so as to guide the clinical medication of various antitumor drugs; the electrochemical results can be analyzed specifically with reference to table 6.

TABLE 6

Comparative example 1

The inventor designs dozens of pairs of primers and dozens of probes aiming at each target sequence after deeply comparing and analyzing 22 SNP sites on the existing genes related to the toxicity of chemotherapeutic drugs, and is difficult to obtain effective multiple asymmetric PCR amplification primers and probe sequences due to unbalanced reaction system, primer specificity difference, inconsistent annealing temperature, primer dimer and the like. The inventor optimally selects and verifies the designed primers and probes through a large number of experiments, and finally determines the primers, probe sequences and combination thereof which can be used for multiple asymmetric PCR amplification.

Even in the case where the primer pair and probe sequence for each target nucleic acid have been basically determined, there is a significant difference in the effect of multiplex amplification by different primer pair combinations.

For example, in the multiple asymmetric PCR step, the first primer pair set and the second primer pair set are combined and subjected to multiple asymmetric PCR in one tube, and then the electrochemical gene chip method is performed for detection, and other detection steps and conditions are the same as those in example 1: the result of the specificity test shows that the detection reagent can not detect the locus of rs1801133, rs11615, rs180159, rs2372536, rs1045642, rs8175347, rs25487, rs2072671 and rs1042028SNP, and the result is shown in figure 26; sensitivity test results show that the detection limit of each detectable site is increased to about 50 ng/mul, and the detection sensitivity is obviously reduced.

Comparative example 2 optimization of primers and probes for specific amplification of rs25487 site of XRCC1 gene

The inventor designs dozens of pairs of primers and dozens of probes aiming at each target sequence, and the comparative example takes the rs25487 site of the XRCC1 gene as an example, and shows the primers and the probes with partial undesirable effects.

Twenty-one primer pair:

2F-1：TTTGCCCCTCAGATCACACC(SEQ ID NO.:107)

2R-1：TGACTCCCCTCCAGATTCCT(SEQ ID NO.:108)

the probe is one:

CP-2CCTCACACGCCAACCCTGCT(SEQ ID NO.:86)

SP-3TCCCAGAGGTAAGG(SEQ ID NO.:43)

SP-4TCCCGGAGGTAAGG(SEQ ID NO.:44)

the twenty-one detection result of the primer pair is shown in FIG. 27, and the signal value is below 10, which indicates that the PCR amplification effect is poor.

And a primer pair twenty two:

2F-2：CTGTGCCTTTGCCAACACC(SEQ ID NO.:109)

2R-2：CCCGCTCCTCTCAGTAGTCT(SEQ ID NO.:110)

the probe is one:

CP-2CCTCACACGCCAACCCTGCT(SEQ ID NO.:86)

SP-3TCCCAGAGGTAAGG(SEQ ID NO.:43)

SP-4TCCCGGAGGTAAGG(SEQ ID NO.:44)

twenty three primer pairs:

2F-3：GCCTTTGCCAACACCC(SEQ ID NO.:111)

2R-3：TCCCAGGCAGGTCCTC(SEQ ID NO.:112)

the probe is one:

CP-2CCTCACACGCCAACCCTGCT(SEQ ID NO.:86)

SP-3TCCCAGAGGTAAGG(SEQ ID NO.:43)

SP-4TCCCGGAGGTAAGG(SEQ ID NO.:44)

the signal values of the primer pair twenty-two and the primer pair twenty-three are both below 15.

Comparative example 3 optimization of primers and probes for specific amplification of CDA gene rs2072671 site

The inventor designs dozens of pairs of primers and dozens of probes aiming at each target sequence, and the comparative example takes the rs2072671 site of the CDA gene as an example, and shows the primers and the probes with partial undesirable effects.

Twenty-seven primer pairs:

7F-1：GCTCCTGTTTCCCGCTGCT(SEQ ID NO.:113)

7R-1：CCTGTGCCTCTGCGCCTC(SEQ ID NO.:114)

the probe pair:

CP-7-1CTGCTGGTTTGCTCCCAGGAGG(SEQ ID NO.:91)

SP-13CCAAGAAGTCAGCC(SEQ ID NO.:53)

SP-14CCAAGCAGTCAGCC(SEQ ID NO.:54)

the detection result of the twenty-seventh primer pair is shown in fig. 28, the signal value is about 10, and the detection result shows that the PCR amplification effect of the twenty-seventh primer pair is poor.

Twenty-eight primer pairs:

7F-2：CCGGGGTACCAACATGGCCCAGAAGCGTCCT(SEQ ID NO.:115)

7R-2：GCCGCGCTCTTGCCACTGCCTGTGCCTC(SEQ ID NO.:116)

the probe is used for four:

CP-7CTGCTGGTTTGCTCCCAGGAGG(SEQ ID NO.:91)

SP-13CCAAGAAGTCAGCC(SEQ ID NO.:53)

SP-14CCAAGCAGTCAGCC(SEQ ID NO.:54)

twenty-nine primer pairs:

7F-3：CAACATGGCCCAGAAGCGTCCT(SEQ ID NO.:117)

7R-3：CTTCCTCATCCCAGTCCTCTAAGCA(SEQ ID NO.:118)

the probe is used for four:

CP-7CTGCTGGTTTGCTCCCAGGAGG(SEQ ID NO.:91)

SP-13CCAAGAAGTCAGCC(SEQ ID NO.:53)

SP-14CCAAGCAGTCAGCC(SEQ ID NO.:54)

the signal values of the primer pair twenty-eight and the primer pair twenty-nine are both between 10 and 20, the PCR amplification effect is poor, and the requirements of clinical application cannot be met.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Reference documents:

1.Wang Z,Xu B,Lin D,Tan W,Leaw S,Hong X,Hu X.XRCC1polymorphisms and severe toxicity in lung cancer patients treated with cisplatin-based chemotherapy in Chinese population[J].Lung Cancer 2008Oct；62(1):99-104.

2.YC Chen,CH Tzeng,PM Chen,JK Lin,TC Lin.Influence of gstp1i105v polymorphism on cumulative neuropathy and outcome of folfox-4treatment in asian patients with colorectal carcinoma[J].

3.O Mir,J Alexandre,A Tran,JP Durand，G Pons.Relationship between GSTP1Ile(105)Val polymorphism and docetaxel-induced peripheral neuropathy:clinical evidence of a role of oxidative stress in taxane toxicity[J].Annals of Oncology,2009,20(4):736-740.

4.RizzoR，Spaggiari F，Indelli M，et al.Association of CYP1B1with hypersensitivity induced by taxane therapy in breast cancer patients[J].Breast CancerRes Treat，2010，124(2):593-598.

5.KL Miller,KT Kelsey,JK Wiencke,M Moghadass,R Miike.The C3435T polymorphism of MDR1and susceptibility to adult glioma[J].Neuroepidemiology,2005,25(2):85.

6.LI Yan-Hong,WANG,Yong-Hu,LI Yan,YANG Ling.MDR1Gene Polymorphisms and Clinical Relevance[J].Acta Genetica Sinica,February 2006,33(2)：93–104.

7.Giovannetti E,Laan AC,Vasile E,et al.Nucleosides Nucleotides Nucleic Acids.2008；27:720-725.

8.Metharom E,Galettis P,Manners S,et al.The pharmacologi-cal advantage of prolonged dose rate gemcitabine is restricted to patients with variant alleles of cytidine deaminase c.79A>C[J].Asia Pac J Clin Oncol，2011，7(1)：65-74.

9.Zhang H,Li YM,Zhang H,et al.DPYD＊5gene mutation contributes to the reduced DPYD enzyme activity and chemo-therapeutic toxicity of 5-FU:results from genotyping study on 75gastric carcinoma and colon carcinoma patients[J].M ed Oncol,2007,24(2):251-258.

10.G rau JJ,Caballero M,M onzóM,et al.Dihydropyrimidine dehydrogenases and cy tidine-deaminase gene polymorphisms as outcome predictors in resected gastric cancer patients trea-ted with fluoropy rimidine adjuvant chemotherapy[J].J Surg Oncol,2008,98(2):130-134.

11.T erashima M.Genetic polymorphisms related to fluoropyrimi-dine sensitivity and toxicity[J].Gan T o Kagaku Ry oho,2008,35(7):1101-1104.

12.F Thomas,AA Motsingerreif,JM Hoskins,A Dvorak，S Roy.Methylenetetrahydrofolate reductase genetic polymorphisms and toxicity to 5-FU-based chemoradiation in rectal cancer[J].British Journal of Cancer,2011,105(11):1654-1662.

13.VV Prasad,H Wilkhoo.Association of the Functional Polymorphism C677T in the Methylenetetrahydrofolate Reductase Gene with Colorectal,Thyroid,Breast,Ovarian,and Cervical Cancers.Onkologie,2011,34(8-9):422-426.

14.A Lima,M Bernardes,R Azevedo,R Medeiros,V Seabra.SAT0064 Moving Towards Personalized Medicine in Rheumatoid Arthritis:Atic Polymorphisms as Pharmacogenetic Predictors of Methotrexate Therapeutic Outcome.Annals of the Rheumatic Diseases,2015,74(Suppl 2):671.2-671.

15.Caudle KE,Thorn CF,Klein TE,Swen JJ,McLeod HL,Diasio RB,Schwab M.Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing.Clin Pharmacol Ther 2013；94:640-5.

16.Terrazzino S,Cargnin S,Del RM,Danesi R,Canonico PL,Genazzani AA.DPYD IVS14+1G>A and 2846A>T genotyping for the prediction of severe fluoropyrimidine-related toxicity:a meta-analysis.Pharmacogenomics2013；14:1255-72.

17.Onoue M,Terada T,Kobayashi M,Katsura T,Matsumoto S,Yanagihara K,et al.UGT1A1*6 polymorphism is most predictive of severe neutropenia induced by irinotecan in Japanese cancer patients.Int J Clin Oncol2009；14:136-42.

18.Aithal GP,Day CP,Kesteven PJ,Daly AK.Association of polymorphisms in the cytochrome P450 CYP2C9 with warfarin dose requirement and risk of bleeding complications.Lancet 1999；353:717-9.

19.Fasching P A，Loehberg C R，Strissel P L，et al.Single nucleo-tide polymorphisms of the aromatase gene(CYP19A1)，HER2/neu status，and prognosis in breast cancer patients[J].Breast Cancer Res Treat，2008，112(1):89－98.

20.SC Ma.Y Zhao,T Zhang,XL Ling,D Zhao.Association between the ERCC1 rs11615 polymorphism and clinical outcomes of oxaliplatin-based chemotherapies in gastrointestinal cancer:a meta-analysis.Oncotargets&Therapy,2015,8(default):641-648

21.Park I H，Lee Y S，Lee K S，et al.Single nucleotide polymor-phisms of CYP19A1 predict clinical outcomes and adverse events associated with letrozole in patients with metastatic breast cancer[J].Cancer Chemother Pharmacol，2011，68(5):1263－71.

sequence listing

<110> Daan Gen-Shaw Co Ltd of Zhongshan university

<120> kit for multiple detection of chemotherapy drug toxicity related genotyping

<130> 00010

<160> 118

<170> SIPOSequenceListing 1.0

<210> 1

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

agcagcccac ctataatact gaccttgcgg gacct 35

<210> 2

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

aatattgttg ccaaaaccca ccagtgatcc aggagtccca 40

<210> 3

<211> 37

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

cccctgtctc gttccccttt gcccctcaga tcacacc 37

<210> 4

<211> 31

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

agcccctgcc ccgctcctct cagtagtctg c 31

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

cccagtcacg cggcctgctc ccctccaccc aa 32

<210> 6

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

cccaagaagg ggtcagccca agccacctga ggggta 36

<210> 7

<211> 32

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

agctggagac agacccgggg accctttagg aa 32

<210> 8

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

ctggcccagc acatagtcgg gaattacgtc gccaa 35

<210> 9

<211> 38

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

tgcctgtcac tattcctcat gccaccactg ccaacacc 38

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

tcttcgccaa tgcaccgcct tttgcccact 30

<210> 11

<211> 41

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

tcaaagtgtg ctggtcctga agttgatctg tgaactcttg t 41

<210> 12

<211> 42

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

ggccagatgc ttgtatacag gtaagggtgt gatttggttg ct 42

<210> 13

<211> 39

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

aggctcctct cctagaccct gcatcctgaa agctgcgta 39

<210> 14

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

ctcttgccac tgcctgtgcc tctgcgcctc 30

<210> 15

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

aatggggcaa acttcttact caacacacgc aacagg 36

<210> 16

<211> 48

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

agggcaaact ccatttctta tttatctcct tatcctcagc actcatcc 48

<210> 17

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

catgtatggc cctggacaaa gctcct 26

<210> 18

<211> 47

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

attcaccaac ttatgccaat tctcttgttt tagatgttaa atcacac 47

<210> 19

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

tccgtttctg ccaagcctga actacccctc 30

<210> 20

<211> 33

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

agcaatatat gcctgcccct tcttccatgg gac 33

<210> 21

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

agtccgagct acttgggaga ctaaggt 27

<210> 22

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 22

cagcatgaaa tagtgtatca gtggtactta caaagcagtt 40

<210> 23

<211> 38

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

ctctgcccag tccctgtggt ctcttcatcc ctcgcctt 38

<210> 24

<211> 45

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 24

tgatgcccat gtcggtgcat gccttcacaa agcggaagaa tgtgt 45

<210> 25

<211> 38

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 25

acagccagat tcgtctttgt tttatagagt tgttgcct 38

<210> 26

<211> 32

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 26

tactccagcc tgggtgacac agcaagactt ca 32

<210> 27

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 27

ctgagccgca cccaccctgt tctctacctc 30

<210> 28

<211> 39

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 28

tcatctcctt gaacgacgtg tgctgaacca tgaagtcca 39

<210> 29

<211> 31

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 29

actccctgct acctttgtgg actgacagct t 31

<210> 30

<211> 39

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 30

atgcccgaga ctaacaaaag actctttcac atcctccct 39

<210> 31

<211> 38

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 31

aggacagtgt gttgagagca tacagaagat acacgact 38

<210> 32

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 32

atccttctca aagcacattt ggtggaatcg ggtct 35

<210> 33

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 33

catgaactcc tgacctcaag tgatccacct 30

<210> 34

<211> 42

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 34

caggctttag cataattttc aattcctcaa aaacatgtca gt 42

<210> 35

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 35

atgcaccatg ggggacgctg ctcat 25

<210> 36

<211> 37

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 36

gaccaaggcc acacagcttg aaagtgattg agccaca 37

<210> 37

<211> 45

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 37

agatctgctt tcctgcatgt tctttgaaac cctatgaacc tgaat 45

<210> 38

<211> 40

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 38

acagtgaatc tgcgtgctaa ataggaacca tcggacacat 40

<210> 39

<211> 46

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 39

ccatggcata gcctttgtaa actgggcttc acattcaaat aacaca 46

<210> 40

<211> 39

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 40

cttctcggcc acctagagat gatttccttt gtatcccac 39

<210> 41

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 41

cttcagccgg atcaa 15

<210> 42

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 42

cttcagctgg atcaac 16

<210> 43

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 43

tcccagaggt aagg 14

<210> 44

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 44

tcccggaggt aagg 14

<210> 45

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 45

caaatacatc tccctc 16

<210> 46

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 46

aaatacgtct ccctc 15

<210> 47

<211> 12

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 47

cgcaacgtgc cc 12

<210> 48

<211> 13

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 48

cgcaatgtgc cct 13

<210> 49

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 49

atgacccact gaag 14

<210> 50

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 50

atgacccagt gaag 14

<210> 51

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 51

agattgtgag ggca 14

<210> 52

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 52

agatcgtgag ggca 14

<210> 53

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 53

ccaagaagtc agcc 14

<210> 54

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 54

ccaagcagtc agcc 14

<210> 55

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 55

cggaccgcta tcca 14

<210> 56

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 56

cggaccacta tccag 15

<210> 57

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 57

cagacaacgt aagtg 15

<210> 58

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 58

ccagacaaca taagtg 16

<210> 59

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 59

ttgaaggtta taaatcct 18

<210> 60

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 60

tgaagtttgt aaatcct 17

<210> 61

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 61

ctctgtgttc cacttcg 17

<210> 62

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 62

ctctgcgttc cact 14

<210> 63

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 63

gggagccgat ttca 14

<210> 64

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 64

gcgggagtcg attt 14

<210> 65

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 65

aggtgtaact gttgagg 17

<210> 66

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 66

aggtgtaagt gttgagg 17

<210> 67

<211> 11

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 67

ggcgctccct g 11

<210> 68

<211> 11

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 68

gggcactccc t 11

<210> 69

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 69

cagagacgga gcat 14

<210> 70

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 70

cagagacaga gcatt 15

<210> 71

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 71

tgccatatat atatataagt aggag 25

<210> 72

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 72

tgccatatgt atatatataa gtagg 25

<210> 73

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 73

acccactctg gagca 15

<210> 74

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 74

acctactctg gagca 15

<210> 75

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 75

ggtgctattt gtcatc 16

<210> 76

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 76

ggtgctagtt gtcatc 16

<210> 77

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 77

ctgtaagtag atataacttt tc 22

<210> 78

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 78

ctgtaagtag acataacttt tc 22

<210> 79

<211> 17

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 79

gatagaggag cattagt 17

<210> 80

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 80

ggatagagga acattagt 18

<210> 81

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 81

caggtttgca gaccg 15

<210> 82

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 82

caggtttcca gaccg 15

<210> 83

<211> 14

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 83

gggactgcgt tgtt 14

<210> 84

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 84

gggactgtgt tgttta 16

<210> 85

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 85

tgaggccggg tgctctctt 19

<210> 86

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 86

cctcacacgc caaccctgct 20

<210> 87

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 87

gcgtggagga cctccgctg 19

<210> 88

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 88

ggcaatcccg tactgaagtt cgtg 24

<210> 89

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 89

tgtcaaccag tggtctgtga atc 23

<210> 90

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 90

cgggtggtgt cacaggaag 19

<210> 91

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 91

ctgctggttt gctcccagga gg 22

<210> 92

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 92

cgctgggcat ctgtgctgaa 20

<210> 93

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 93

tcactgaact aaaggctgac ttt 23

<210> 94

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 94

attagtgtag aaatggccgg a 21

<210> 95

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 95

ttaaatcctc gaacacaaac tcatgcaa 28

<210> 96

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 96

ctgaagcact tgaaggagaa ggtgtct 27

<210> 97

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 97

ctttgtaaag acagtggctt ctcc 24

<210> 98

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 98

agattcaaaa gatcctggag tttgtgg 27

<210> 99

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 99

cacctgacgc ctcgttgtac at 22

<210> 100

<211> 31

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 100

caaacattaa cttggtgtat cgattggttt t 31

<210> 101

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 101

tggaacacta gagaaggctg gtcagt 26

<210> 102

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 102

ctcctatggg ttgtcaccaa gcta 24

<210> 103

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 103

aaaaagacag tcaattcccc aactt 25

<210> 104

<211> 26

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 104

ttccatcaat ccaggtgatc gcaaat 26

<210> 105

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 105

gggacacagt gtagttggtg tgga 24

<210> 106

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 106

acctcccctg gaccagcttt tctg 24

<210> 107

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 107

tttgcccctc agatcacacc 20

<210> 108

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 108

tgactcccct ccagattcct 20

<210> 109

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 109

ctgtgccttt gccaacacc 19

<210> 110

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 110

cccgctcctc tcagtagtct 20

<210> 111

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 111

gcctttgcca acaccc 16

<210> 112

<211> 16

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 112

tcccaggcag gtcctc 16

<210> 113

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 113

gctcctgttt cccgctgct 19

<210> 114

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 114

cctgtgcctc tgcgcctc 18

<210> 115

<211> 31

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 115

ccggggtacc aacatggccc agaagcgtcc t 31

<210> 116

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 116

gccgcgctct tgccactgcc tgtgcctc 28

<210> 117

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 117

caacatggcc cagaagcgtc ct 22

<210> 118

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 118

cttcctcatc ccagtcctct aagca 25

Claims

1. A primer pair set for detecting a genotype associated with toxicity of a chemotherapeutic agent, wherein the primer pair set comprises a first primer pair set comprising one to nine primer pairs:

and (3) primer pair one:

1F：SEQ ID NO.:1；1R：SEQ ID NO.:2

and (3) primer pair II:

2F：SEQ ID NO.:3；2R：SEQ ID NO.:4

and (3) primer pair III:

3F：SEQ ID NO.:5；3R：SEQ ID NO.:6；

and (4) primer pair IV:

4F：SEQ ID NO.:7；4R：SEQ ID NO.:8

and a fifth primer pair:

5F：SEQ ID NO.:9；5R：SEQ ID NO.:10

and a sixth primer pair:

7F：SEQ ID NO.:13；7R：SEQ ID NO.:14

a seventh primer pair:

16F：SEQ ID NO.:31；16R：SEQ ID NO.:32

eight primer pairs:

17F：SEQ ID NO.:33；17R：SEQ ID NO.:34

and a primer pair is nine:

19F：SEQ ID NO.:37；19R：SEQ ID NO.:38。

2. the primer-pair set of claim 1, further comprising a second set of primer pairs comprising primer pairs ten to primer pairs twenty:

ten primer pairs:

6F：SEQ ID NO.:11；6R：SEQ ID NO.:12

eleven primer pairs:

8F：SEQ ID NO.:15；8R：SEQ ID NO.:16

twelve primer pairs:

9F：SEQ ID NO.:17；9R：SEQ ID NO.:18

thirteen primer pairs:

10F：SEQ ID NO.:19；10R：SEQ ID NO.:20

fourteen primer pairs:

11F：SEQ ID NO.:21；11R：SEQ ID NO.:22

fifteen primer pairs:

12F：SEQ ID NO.:23；12R：SEQ ID NO.:24

sixteen primer pairs:

13F：SEQ ID NO.:25；13R：SEQ ID NO.:26

seventeen primer pairs:

14F：SEQ ID NO.:27；14R：SEQ ID NO.:28

eighteen primer pairs:

15F：SEQ ID NO.:29；15R：SEQ ID NO.:30

nineteen primer pairs:

18F：SEQ ID NO.:35；18R：SEQ ID NO.:36

twenty primer pairs:

20F：SEQ ID NO.:39；20R：40。

3. a kit for detecting a genotype associated with toxicity of a chemotherapeutic agent, the kit comprising the primer set of claim 1 or claim 2.

4. The kit of claim 3, further comprising a set of signaling probes; the signaling probe set comprises the following signaling probes:

targeting rs1799782 signaling probe:

SP-1：SEQ ID NO.:41

SP-2：SEQ ID NO.:42；

targeting rs25487 signaling probe:

SP-3：SEQ ID NO.:43

SP-4：SEQ ID NO.:44；

targeting rs 1695 signaling probe:

SP-5：SEQ ID NO.:45

SP-6：SEQ ID NO.:46；

targeting rs11615 signaling probe:

SP-7：SEQ ID NO.:47

SP-8：SEQ ID NO.:48；

targeting rs 1056836 signaling probe:

SP-9：SEQ ID NO.:49

SP-10：SEQ ID NO.:50；

targeting rs1045642 signaling probe:

SP-11：SEQ ID NO.:51

SP-12：SEQ ID NO.:52；

targeting rs2072671 signaling probe:

SP-13：SEQ ID NO.:53

SP-14：SEQ ID NO.:54；

targeting rs60369023 signaling probe:

SP-15：SEQ ID NO.:55

SP-16：SEQ ID NO.:56；

targeting rs3918290 signaling probe:

SP-17：SEQ ID NO.:57

SP-18：SEQ ID NO.:58；

targeting rs 1801159 signaling probe:

SP-19：SEQ ID NO.:59

SP-20：SEQ ID NO.:60；

targeting rs 1801265 signaling probe:

SP-21：SEQ ID NO.:61

SP-22：SEQ ID NO.:62；

targeting rs1801133 signaling probe:

SP-23：SEQ ID NO.:63

SP-24：SEQ ID NO.:64；

targeting rs2372536 signaling probe:

SP-25：SEQ ID NO.:65

SP-26：SEQ ID NO.:66；

targeting rs1042028 signaling probe:

SP-27：SEQ ID NO.:67

SP-28：SEQ ID NO.:68；

targeting rs4148323 signaling probe:

SP-29：SEQ ID NO.:69

SP-30：SEQ ID NO.:70；

targeting rs8175347 signaling probe:

SP-31：SEQ ID NO.:71

SP-32：SEQ ID NO.:72；

targeting rs 10046 signaling probe:

SP-33：SEQ ID NO.:73

SP-34：SEQ ID NO.:74；

targeting rs4646 signaling probe:

SP-35：SEQ ID NO.:75

SP-36：SEQ ID NO.:76；

targeting rs 1142345 signaling probe:

SP-37：SEQ ID NO.:77

SP-38：SEQ ID NO.:78；

targeting rs 1800460 signaling probe:

SP-39：SEQ ID NO.:79

SP-40：SEQ ID NO.:80；

targeting rs 1800462 signaling probe:

SP-41：SEQ ID NO.:81

SP-42：SEQ ID NO.:82；

targeting rs 116855232 signaling probe:

SP-43：SEQ ID NO.:83

SP-44：SEQ ID NO.:84。

5. the kit of claim 3, further comprising a set of capture probes comprising the following capture probes:

CP-1：SEQ ID NO.:85，

CP-2：SEQ ID NO.:86，

CP-3：SEQ ID NO.:87，

CP-4：SEQ ID NO.:88，

CP-5：SEQ ID NO.:89，

CP-6：SEQ ID NO.:90，

CP-7：SEQ ID NO.:91，

CP-8：SEQ ID NO.:92，

CP-9：SEQ ID NO.:93，

CP-10：SEQ ID NO.:94，

CP-11：SEQ ID NO.:95，

CP-12：SEQ ID NO.:96，

CP-13：SEQ ID NO.:97，

CP-14：SEQ ID NO.:98，

CP-15：SEQ ID NO.:99，

CP-16：SEQ ID NO.:100，

CP-17：SEQ ID NO.:101，

CP-18：SEQ ID NO.:102，

CP-19：SEQ ID NO.:103，

CP-20：SEQ ID NO.:104，

CP-21: 105 of SEQ ID NO. and

CP-22：SEQ ID NO.:106。

6. the kit of claim 4, wherein the signaling probe is labeled at its 5' end with a ferrocene molecule.

7. The kit of claim 5, wherein the capture probe is labeled at its 3' end with C6S-S, and is covalently immobilized on the surface of a printed circuit board metal electrode via C6S-S.

8. The kit of claim 3, further comprising one or more components selected from the group consisting of: Tris-HCl, deoxyribonucleoside triphosphates, (NH)₄)₂SO₄、MgCl₂KCl, fetal bovine serum (NBS), NaClO₄C-MMLV reverse transcriptase, RNase inhibitor, and hot start Taq enzyme.

9. A method for detecting a chemotherapeutic drug toxicity-associated genotyping for non-diagnostic or therapeutic purposes, said method comprising the steps of:

(3) PCR product hybridization detection

Uniformly mixing the first PCR amplification product and the second PCR amplification product, mixing with the electrochemical hybridization solution, adding the mixture onto an electrochemical detection chip, and detecting in the electrochemical gene chip;

wherein the first primer pair set comprises primer pair one to primer pair nine:

and (3) primer pair one:

1F：SEQ ID NO.:1；1R：SEQ ID NO.:2

and (3) primer pair II:

2F：SEQ ID NO.:3；2R：SEQ ID NO.:4

and (3) primer pair III:

3F：SEQ ID NO.:5；3R：SEQ ID NO.:6；

and (4) primer pair IV:

4F：SEQ ID NO.:7；4R：SEQ ID NO.:8

and a fifth primer pair:

5F：SEQ ID NO.:9；5R：SEQ ID NO.:10

and a sixth primer pair:

7F：SEQ ID NO.:13；7R：SEQ ID NO.:14

a seventh primer pair:

16F：SEQ ID NO.:31；16R：SEQ ID NO.:32

eight primer pairs:

17F：SEQ ID NO.:33；17R：SEQ ID NO.:34

and a primer pair is nine:

19F：SEQ ID NO.:37；19R：SEQ ID NO.:38；

the second set of primer pairs comprises ten primer pairs to twenty primer pairs:

ten primer pairs:

6F：SEQ ID NO.:11；6R：SEQ ID NO.:12

eleven primer pairs:

8F：SEQ ID NO.:15；8R：SEQ ID NO.:16

twelve primer pairs:

9F：SEQ ID NO.:17；9R：SEQ ID NO.:18

thirteen primer pairs:

10F：SEQ ID NO.:19；10R：SEQ ID NO.:20

fourteen primer pairs:

11F：SEQ ID NO.:21；11R：SEQ ID NO.:22

fifteen primer pairs:

12F：SEQ ID NO.:23；12R：SEQ ID NO.:24

sixteen primer pairs:

13F：SEQ ID NO.:25；13R：SEQ ID NO.:26

seventeen primer pairs:

14F：SEQ ID NO.:27；14R：SEQ ID NO.:28

eighteen primer pairs:

15F：SEQ ID NO.:29；15R：SEQ ID NO.:30

nineteen primer pairs:

18F：SEQ ID NO.:35；18R：SEQ ID NO.:36

twenty primer pairs:

20F：SEQ ID NO.:39；20R：40。