CN109536627B - HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies - Google Patents
HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies Download PDFInfo
- Publication number
- CN109536627B CN109536627B CN201910032431.9A CN201910032431A CN109536627B CN 109536627 B CN109536627 B CN 109536627B CN 201910032431 A CN201910032431 A CN 201910032431A CN 109536627 B CN109536627 B CN 109536627B
- Authority
- CN
- China
- Prior art keywords
- mycoplasma
- subspecies
- goat
- amplification
- hrm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an HRM primer and a method for identifying mycoplasma filiform goat subspecies and mycoplasma capricolum goat pneumonia subspecies, belonging to the technical field of veterinary infectious disease rapid diagnosis. The HRM inner primer upstream primer is 107F: CAATACATCCATTARMACTCTTGA, the downstream primer is 107R: GAATWCAYTCAGGTTGATTATTAGGA, the method is characterized in that the difference of bases on the nucleic acid sequences of two mycoplasma is identified by detecting the characteristic melting curve formed by the fluorescence signal released by the double-stranded DNA during the melting process by utilizing the characteristic that the double-stranded DNA combined with the fluorescent dye can generate the color reduction effect during the temperature rising process. Comprises the steps of DNA extraction, PCR amplification to obtain a target sequence and melting curve analysis. The identification method of the invention has the advantages of strong specificity, high sensitivity, good repeatability and simple operation.
Description
Technical Field
The invention belongs to the technical field of veterinary infectious disease rapid diagnosis, and particularly relates to an HRM primer and a method for rapidly identifying mycoplasma filiform goat subspecies and mycoplasma caprium goat pneumonia subspecies.
Background
The mycoplasma pneumonia of sheep is a pneumonia infectious disease of sheep, the morbidity of the pneumonia infectious disease is 20% -60%, and the mortality of the pneumonia infectious disease is 10% -50%. Mycoplasma filiformis subsp. goat (C.)Mycoplasma mycoidessubsp．capriMmc) and Mycoplasma ovipneumoniae: (M.ovipneumoniae: (M.pneumoniae)Mycopalsamovipneumonia,Movi) is the 2 major etiological agents of mycoplasmal pneumonia. Contagious caprine pleuropneumonia (A. B.), (B.)Contagious caprinepleuropneumonia,CCPP) The infectious disease is an acute or chronic high-contact infectious disease which is characterized by the characteristic of the celluloid pneumonia and the pleurisy of a goat, the morbidity can reach 80-100%, the mortality can reach 60-80%, the disease mainly spreads in Africa, the middle east and Asia, and is one of animal infectious diseases listed as legal reports by the world animal health organization, and the pathogen of the disease is mycoplasma capricolum subspMycoplasma capricolumsubsp．capripneumoniae，Mccp）。
Mmc and Mcpc belong to the same members of the mycoplasma filiformis cluster, the genome similarity is high, the biochemical characteristics are similar, and serological obvious antigenic cross reaction exists, so that 2 mycoplasma can not be easily identified by an immunological method. The detection methods commonly used at present mainly include mycoplasma isolation culture identification, PCR (D' Angelo A R et al,2010), fluorescent quantitative PCR and the like (forest peptide and the like). By consulting the existing literature, no HRM primer and method for identifying the mycoplasma filiformis goat subspecies and the mycoplasma capricolum goat pneumonia subspecies are found. The establishment of the invention can fill the blank of the field, provides a practical method for quickly and accurately identifying the mycoplasma filiform goat subspecies and the mycoplasma caprium goat subspecies pneumonia, and has important application value.
Disclosure of Invention
The invention aims to provide an HRM primer and a method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies. The method is characterized in that the difference of bases on nucleic acid sequences of two mycoplasma is identified by detecting a characteristic melting curve formed by fluorescence signals released by double-stranded DNA in the melting process by utilizing the characteristic that the double-stranded DNA combined with a fluorescent dye can generate a color reduction effect in the temperature rising process. The method can quickly and accurately identify Mmc and Mcpc, and provides a quick and accurate diagnosis for mycoplasma ovipneumoniae and contagious pleuropneumonia of goats and a method for epidemiological investigation of the two diseases.
In order to realize the purpose, the following technical scheme is adopted:
the invention designs two pairs of primers according to Mmc 95010 MLC _0560 gene sequence and Mcpcp F38 MCCPF38_00984 gene sequence, wherein the outer primer SEQ ID No. 1: MFW 325: GAATGTTTAATCGATCAACTGCT, SEQ ID No. 2: MRW 325: TGCTAATAGTGG
TCCTGCTAAGA, respectively; inner primer SEQ ID No. 3: 107F: 5' -CAATACATCCATTARMACTC
TTGA-3'，SEQ ID No.4：107R: 5'-GAATWCAYTCAGGTTGATTATTAGGA -3'。
The HRM method for identifying the mycoplasma filiform goat subspecies and the mycoplasma caprium goat pneumonia subspecies comprises the following steps:
1) extracting genomic DNA of mycoplasma from a sample to be identified;
2) PCR pre-amplification: taking the mycoplasma genome DNA extracted in the step (1) as a template, and performing PCR (polymerase chain reaction) pre-amplification by using outer primers SEQ ID No.1 and SEQ ID No. 2; the amplification system is as follows: upstream and downstream primers (10. mu. mol/L) each 0.5. mu.L, template 2. mu.L, taq enzyme 12.5. mu.L, and water to 25. mu.L; the amplification conditions were: 3min at 95 ℃; obtaining corresponding pre-amplification products with sizes of 327bp respectively at 95 ℃ for 15s, 55 ℃ for 15s and 72 ℃ for 20s in 40 cycles;
3) PCR amplification and HRM analysis: taking the pre-amplification product as a template, and taking inner primers SEQ ID No.3 and SEQ ID No.4 as primers to carry out PCR amplification, wherein the amplification system is as follows: upstream and downstream primers (10. mu. mol/L) each 0.5. mu.L, template 2. mu.L, taq enzyme 12.5. mu.L, syto9 dye 0.5. mu.L, water to 25. mu.L; the amplification conditions were: 3min at 95 ℃; at 95 ℃ for 15s, 53 ℃ for 15s, 72 ℃ for 10s, and 40 cycles, wherein the size of an amplification product is 107 bp; after the amplification is finished, HRM analysis is carried out under the conditions of 95 ℃ for 1min and 45 ℃ for 1min, and then the temperature is raised to 90 ℃ at the rate of 0.3 ℃/s.
4) HRM result analysis: analyzing the HRM result, and identifying mycoplasma filiform goat subspecies and mycoplasma caprium goat pneumonia subspecies according to a melting curve diagram; the Tm value of Mmc is 71.08 ℃ and the Tm value of Mcpc is 69.55 ℃.
The application of any one primer in the preparation of a detection kit for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies.
The invention has the beneficial effects that:
the method for identifying Mmc and Mcpc has the advantages of strong specificity, good repeatability, rapidness and low cost, is suitable for customs inspection and quarantine, clinical diagnosis and epidemiological investigation of sheep mycoplasma pneumonia and goat infectious pleuropneumonia, fills the blank of research in the field at home and abroad, and has important economic significance.
Drawings
FIG. 1: HRM detection specificity verification map. Mmc: mycoplasma filiform goat subspecies; mccp: mycoplasma capricolum subsp pneumonia.
FIG. 2: HRM detection results of 23 clinical samples to be identified. Mmc: mycoplasma filiform goat subspecies; mccp: mycoplasma capricolum subsp pneumonia.
Detailed Description
The present invention will be further described with reference to the following examples.
Example 1
1. Strain of bacillus
The filamentous mycoplasma goat subspecies FJ-GT strain and the mycoplasma goat pneumonia subspecies MccpF38 are all preserved in the herbivorous animal disease research laboratory of the animal husbandry and veterinary research institute of agricultural and scientific academy in Fujian province.
2. Primer design and Synthesis
Based on the sequences of the Mmc 95010 strain MLC _0560 gene (GenBank accession number FQ377874.1) and the Mcp F38 strain MCCPF38_00984 gene (GenBank accession number LN515398.1), two pairs of specific primers were designed:
the outer primer SEQ ID No. 5: MFW 325: 5'-GAATGTTTAATCGATCAACTGCT-3' the flow of the air in the air conditioner,
SEQ ID No.6：MRW325：5'-TGCTAATAGTGGTCCTGCTAAGA-3'。
inner primer SEQ ID No. 7: 107F: 5'-CAATACATCCATTARMACTCTTGA-3',
SEQ ID No.8：107R: 5'-GAATWCAYTCAGGTTGATTATTAGGA -3'。
3. the HRM method for identifying the mycoplasma filiform goat subspecies and the mycoplasma caprium goat pneumonia subspecies comprises the following steps:
(1) extraction of genomic DNA of Mycoplasma from a sample to be identified
Genomic DNA was extracted from the strain Mycoplasma filiformis goat subspecies FJ-GT strain and the goat Mycoplasma goat pneumonia subspecies MccpF38, and extracted using an Ezup column type bacterial genomic DNA extraction kit.
(2) PCR Pre-amplification
The genomic DNA of the extracted mycoplasma filiform goat subspecies FJ-GT strain and the genomic DNA of the mycoplasma capricolum goat pneumonia subspecies MccpF38 are used as templates, and the primers SEQ ID No.5 and SEQ ID No.6 are used as primers for PCR pre-amplification. The amplification system is as follows: 0.5. mu.L of each of the upstream and downstream primers (10. mu. mol/L), 2. mu.L of the template, 12.5. mu.L of taq enzyme, and water addition to 25. mu.L under the amplification conditions: 3mi at 95 ℃; obtaining corresponding pre-amplification products with sizes of 327bp respectively at 95 ℃ for 15s, 55 ℃ for 15s and 72 ℃ for 20s in 40 cycles.
(3) PCR amplification and HRM analysis
Taking the pre-amplification product as a template, and taking inner primers SEQ ID No.7 and SEQ ID No.8 as primers to carry out PCR amplification, wherein the amplification system is as follows: 0.5. mu.L of each of the upstream and downstream primers (10. mu. mol/L), 2. mu.L of the template, 12.5. mu.L of taq enzyme, 0.5. mu.L of syto9 dye, and 25. mu.L of water, under the amplification conditions: 3min at 95 ℃; 95 ℃ for 15s, 53 ℃ for 15s, 72 ℃ for 10s, 40 cycles, the size of the amplified product is 107bp, after the amplification is finished, HRM analysis is carried out under the conditions of 95 ℃ for 1min and 45 ℃ for 1min, and then the temperature is raised to 90 ℃ at the rate of 0.3 ℃/s.
(4) HRM result analysis
And (3) analyzing the HRM result by using Rotor-Gene Q Series Software, and identifying the mycoplasma filiform goat subspecies and the mycoplasma caprium goat pneumonia subspecies according to a melting curve diagram. The results show that: the Tm value of the melting curve of Mmc is 71.08 ℃, the Tm value of the melting curve of Mcpc is 69.55 ℃, non-specific amplification does not exist, and the designed primer can be seen to distinguish Mmc from Mcpc, which shows that the HRM method for distinguishing Mmc from Mcpc is successfully established and can be used for rapidly distinguishing Mmc from Mcpc.
Example 2 specificity verification
Genomic DNAs of Mmc, Mcpc, Mycoplasma ovipneumoniae (Movi), orf virus (ORFV), Escherichia coli, Salmonella, Pasteurella, and Mycoplasma arginini were extracted by the method of step (1) in example 1, and they were identified by HRM method using the extracted genomic DNAs as templates, respectively, to verify the specificity of the established HRM method for identifying Mycoplasma filiformis and Mycoplasma caprinum subsp. The results are shown in FIG. 1. The results in FIG. 1 show that: the method can accurately and quickly identify the mycoplasma filiformis goat subspecies and the mycoplasma capricolum goat pneumonia subspecies, and can be used for clinical diagnosis and epidemiological investigation of mycoplasma capricolum pneumonia and contagious pleuropneumonia of goats.
Example 3 repeatability verification
Mmc and Mcp genomic DNA extracted by an Ezup column type bacterial genomic DNA extraction Kit is used as a template, PCR amplification is carried out on the extracted template by primers MF-107 and MR-107, an amplification product is recovered and purified after agarose gel electrophoresis, a purified target gene is connected with a PMD-19T cloning vector, DH5 alpha competent cells are transformed, a Plasmid is extracted by TaKaRaMiniBEST Plasmid Purification Kit Ver.4.0 for PCR identification and enzyme digestion identification, the concentration of the Plasmid is measured, and the copy number is calculated to be used as a standard product for HRM detection. Diluting the standard substance by 10 times gradient to be used as a template, and carrying out HRM repeatability detection. The in-batch repeat test was performed 3 times with each concentration of sample; the batch repeat test was performed 3 times with 3 dilutions of the standard, each 3d apart, and the HRM reaction system and cycle parameters were as described in example 1. And calculating the variation coefficient in batches and between batches according to the Tm values of the melting peaks presented by the two pathogens. And the repeatability and stability of the method are verified. The results are shown in table 1, and the results in table 1 show that the method provided by the invention is good in repeatability and stability.
TABLE 1HRM repeatability test results
Note! TM1 is the Tm of Mcpcp; TM2 is the Tm of Mmc.
Example 4 example of clinical application
23 clinical specimens (nasal swabs) suspected of mycoplasma infection were collected from the sheep farm and differential detection by the HRM method was performed as described in example 1 with Mycoplasma ovipneumoniae (Movi) as a negative control, and the results are shown in FIG. 2. The results in FIG. 2 show that 3 Mmc were detected and no Mcpc was detected by this method. 3 detected positive samples are sequenced, and the homology with Mmc is 100 percent after the results are compared on line by utilizing BLAST, which shows that the HRM method established by the research has high accuracy.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> animal husbandry and veterinary institute of agricultural academy of sciences of Fujian province
<120> HRM primer and method for identifying mycoplasma filiform goat subspecies and mycoplasma caprium goat pneumonia subspecies
<130> 8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> MFW325
<400> 1
gaatgtttaa tcgatcaact gct 23
<210> 2
<211> 23
<212> DNA
<213> MRW325
<400> 2
tgctaatagt ggtcctgcta aga 23
<210> 3
<211> 24
<212> DNA
<213> 107F
<400> 3
caatacatcc attarmactc ttga 24
<210> 4
<211> 26
<212> DNA
<213> 107R
<400> 4
gaatwcaytc aggttgatta ttagga 26
<210> 5
<211> 23
<212> DNA
<213> MFW325
<400> 5
gaatgtttaa tcgatcaact gct 23
<210> 6
<211> 23
<212> DNA
<213> MRW325
<400> 6
tgctaatagt ggtcctgcta aga 23
<210> 7
<211> 24
<212> DNA
<213> 107F
<400> 7
caatacatcc attarmactc ttga 24
<210> 8
<211> 26
<212> DNA
<213> 107R
<400> 8
gaatwcaytc aggttgatta ttagga 26
Claims (5)
1. The HRM primer for identifying the mycoplasma filiform goat subspecies and the mycoplasma capricolum goat pneumonia subspecies is characterized in that: comprises an outer primer: SEQ ID No. 1: MFW 325: 5' -GAATGTTTAATCGATCAACT
GCT-3', SEQ ID No. 2: MRW 325: 5'-TGCTAATAGTGGTCCTGCTAAGA-3', respectively; and the inner primer SEQ ID No. 3: 107F: 5'-CAATACATCCATTARMACTCTTGA-3', SEQ ID No. 4: 107R: 5 '-GAATWCAYTCAGGTTGATTATTAGGA-3'.
2. The use of the primer of claim 1 in the preparation of a test kit for identifying mycoplasma filiformis subspecies and mycoplasma capricolum subspecies pneumonia, comprising the steps of:
1) extracting the genomic DNA of mycoplasma;
2) PCR pre-amplification: performing PCR pre-amplification on the mycoplasma filiform goat subspecies and the mycoplasma capricolum goat pneumonia subspecies by using the outer primers SEQ ID No.1 and SEQ ID No.2 and taking the mycoplasma genomic DNA extracted in the step (1) as a template to obtain corresponding target fragments, wherein the sizes of the target fragments are 327 bp;
3) PCR amplification and HRM analysis: carrying out PCR amplification by using the pre-amplification product as a template and using the inner primers SEQ ID No.3 and SEQ ID No.4 as primers to obtain target fragments with the sizes of 107bp, and carrying out HRM analysis after the amplification is finished;
4) HRM result analysis: and analyzing the HRM result, and identifying the mycoplasma filiform goat subspecies and the mycoplasma capricolum goat pneumonia subspecies according to a melting curve chart, wherein the Tm value of Mmc is 71.08 ℃, and the Tm value of Mcpc is 69.55 ℃.
3. The use of claim 2, wherein the amplification system of the PCR pre-amplification in step (2) is: upstream and downstream primers with concentration of 10. mu. mol/L are respectively 0.5. mu.L, template is 2. mu.L, Taq enzyme is 12.5. mu.L, and water is supplemented to 25. mu.L, the amplification conditions are as follows: 3min at 95 ℃; 95 ℃ for 15s, 55 ℃ for 15s, 72 ℃ for 20s, 40 cycles.
4. The use of claim 2, wherein the amplification system of the PCR amplification in step (3) is: upstream and downstream primers with concentration of 10 μmol/L each 0.5 μ L, template 2 μ L, Taq enzyme 12.5 μ L, syto9 dye 0.5 μ L, water to 25 μ L, 95 deg.C 3 min; 95 ℃ for 15s, 53 ℃ for 15s, 72 ℃ for 10s, 40 cycles.
5. Use according to claim 2, wherein the conditions for the HRM analysis in step (3) are 95 ℃ for 1min, 45 ℃ for 1min, and then the temperature is raised to 90 ℃ at 0.3 ℃/s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910032431.9A CN109536627B (en) | 2019-01-14 | 2019-01-14 | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910032431.9A CN109536627B (en) | 2019-01-14 | 2019-01-14 | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109536627A CN109536627A (en) | 2019-03-29 |
| CN109536627B true CN109536627B (en) | 2022-06-07 |
Family
ID=65834991
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910032431.9A Active CN109536627B (en) | 2019-01-14 | 2019-01-14 | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109536627B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235289B (en) * | 2020-03-15 | 2022-04-22 | 中国农业科学院兰州兽医研究所 | Specific PCR primer for detecting mycoplasma capricolum goat pneumonia subspecies |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200162A (en) * | 2015-08-06 | 2015-12-30 | 广东省农业科学院动物卫生研究所 | HRM detection method for rapidly distinguishing HP-PRRS live vaccine JXA1-R strains and wild strains and primer of HRM detection method |
| CN106434919A (en) * | 2016-09-28 | 2017-02-22 | 福建省农业科学院畜牧兽医研究所 | Primers for triple PCR of three types of sheep pathogenic mycoplasmas and detection method |
| CN107099608A (en) * | 2017-06-13 | 2017-08-29 | 中国农业科学院兰州兽医研究所 | A kind of iiPCR kits for detecting mycoplasma capri goat pneumonia subspecies |
-
2019
- 2019-01-14 CN CN201910032431.9A patent/CN109536627B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200162A (en) * | 2015-08-06 | 2015-12-30 | 广东省农业科学院动物卫生研究所 | HRM detection method for rapidly distinguishing HP-PRRS live vaccine JXA1-R strains and wild strains and primer of HRM detection method |
| CN106434919A (en) * | 2016-09-28 | 2017-02-22 | 福建省农业科学院畜牧兽医研究所 | Primers for triple PCR of three types of sheep pathogenic mycoplasmas and detection method |
| CN107099608A (en) * | 2017-06-13 | 2017-08-29 | 中国农业科学院兰州兽医研究所 | A kind of iiPCR kits for detecting mycoplasma capri goat pneumonia subspecies |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109536627A (en) | 2019-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111020062A (en) | Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain | |
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN107099605B (en) | Primer and probe for detecting mycoplasma filiformis goat subspecies | |
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN107988340B (en) | PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof | |
| CN110951916A (en) | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology | |
| CN107099621B (en) | PCR-HRM detection method for rapidly identifying PRRSV vaccine strain GDr180 strain and other strains | |
| CN106636470B (en) | Dual PCR (polymerase chain reaction) special primer for sheep infective pustule virus and mycoplasma ovipneumoniae | |
| CN113025734A (en) | Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application | |
| WO2017219597A1 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| CN102776283B (en) | Visualized loop-mediated isothermal amplification kit for detecting Haemophilus parasuis | |
| CN107083443B (en) | Primer combination for PCR detection of Elizabeth meningitis and septica | |
| CN109536627B (en) | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies | |
| CN109371148B (en) | Fluorescent PCR kit for identifying three porcine respiratory bacteria and quantitative detection method | |
| CN108707697B (en) | LAMP (loop-mediated isothermal amplification) detection primer pair and detection method for seneca valley virus | |
| CN104195265A (en) | PCR-HRM primer and method for rapidly distinguishing wild strain and vaccine strain of canine parvovirus | |
| CN115044686B (en) | Real-time fluorescent quantitative PCR primer pair and probe combination for simultaneously detecting seven BRDC pathogens | |
| CN107164506B (en) | Method for detecting multiple sheep babesia and detection kit | |
| CN110735003A (en) | Universal primer, kit and detection method for detecting fungal contamination in cell product | |
| CN107937615B (en) | Primers and probes for distinguishing wild strains and vaccine strains of swine Japanese encephalitis virus | |
| CN111004869B (en) | Fluorescent quantitative PCR (polymerase chain reaction) primer and reference standard for identifying genetic evolutionary lineages of H1N1 subtype influenza viruses | |
| CN109666750B (en) | Multiplex real-time fluorescence PCR detection primer probe set and detection method for identifying streptococcus suis and pasteurella multocida | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| CN113416798A (en) | Primer group for amplifying or detecting human adenovirus DNA and application thereof | |
| CN107604102B (en) | Double Real time PCR detection kit for pigeon TTV and novel pigeon adenovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |