CN109536627A - Identify the HRM primer and method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies - Google Patents
Identify the HRM primer and method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies Download PDFInfo
- Publication number
- CN109536627A CN109536627A CN201910032431.9A CN201910032431A CN109536627A CN 109536627 A CN109536627 A CN 109536627A CN 201910032431 A CN201910032431 A CN 201910032431A CN 109536627 A CN109536627 A CN 109536627A
- Authority
- CN
- China
- Prior art keywords
- mycoplasma
- capri
- hrm
- primer
- mycoides subsp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the HRM primer and method for identifying Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies, belongs to animal doctor's infectious disease quick diagnosis technical field.HRM inner primer upstream primer is 107F:CAATACATCCATTARMACTCTTGA, downstream primer is 107R:GAATWCAYTCAGGTTGATTATTAGGA, this method is to be formed by feature melting curve by the fluorescence signal that detection double-stranded DNA discharges in fusion processes to identify the difference of base in two mycoplasma species nucleic acid sequences the characteristics of hypochromic effect occurring in temperature elevation process using the double-stranded DNA in conjunction with fluorescent dye.It is extracted including DNA, PCR amplification obtains aim sequence and carries out melting curve analysis.Discrimination method high specificity of the present invention, sensibility are high, reproducible, easy to operate.
Description
Technical field
The invention belongs to animal doctor's infectious disease quick diagnosis technical fields, and in particular to a kind of quickly to identify Filamentous mycoplasma mountain
The HRM primer and method of sheep subspecies and mycoplasma capri goat pneumonia subspecies.
Background technique
Sheep mycoplasmal pneumonia is a kind of pneumonia sexually transmitted disease of sheep, which is 20% ~ 60%, the death rate is 10% ~
50%.Mycoplasma mycoides subsp.capri (Mycoplasma mycoidessubsp.capri, Mmc) and mycoplasma ovine pneumoniae
(Mycopalsamovipneumonia,Movi) be mycoplasmal pneumonia 2 kinds of main pathogens.Goats contagious pleuropneumonia
(Contagious caprinepleuropneumonia,CCPP) to be that goat is distinctive be with fibrinous pneumonia and pleurisy
The acute or chronic highly contagious disease of feature, disease incidence may be up to 80 ~ 100%, and for the death rate up to 60 ~ 80%, the disease is main
It is popular in Africa, the Middle East and Asia, is that World Organization for Animal Health is classified as one of zoonosis of statutory report, the disease of the disease
Original be mycoplasma capri goat pneumonia subspecies (Mycoplasma capricolumsubsp.capripneumoniae,Mccp).
Mmc and Mccp belongs to Filamentous mycoplasma cluster member, and genome similarity is high, and biochemical characteristic is similar, in serology
There are apparent antigenic cross reactions, therefore, not easily pass through the identification that immunological method carries out 2 mycoplasma species.It is common at present
Detection method mainly there is mycoplasma to be separately cultured identification, PCR (D ' Angelo A R et al, 2010), quantitative fluorescent PCR
Deng (abundant victory of woods etc.).Through consulting existing literature, there is not yet identifying Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia
The HRM primer and method of subspecies.Foundation of the invention can fill up the blank in the field, be Mycoplasma mycoides subsp.capri and mountain
The quick and precisely identification of sheep mycoplasma goat pneumonia subspecies provides a kind of practical approach, has important application value.
Summary of the invention
The purpose of the present invention is to provide a kind of identification Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia are sub-
The HRM primer and method of kind.This method can be subtracted in temperature elevation process using the double-stranded DNA in conjunction with fluorescent dye
The characteristics of chromatic effect, by detect the fluorescence signal that is discharged in fusion processes of double-stranded DNA be formed by feature melting curve come
Identify the difference of base in two mycoplasma species nucleic acid sequences.This method can rapidly and accurately identify Mmc and Mccp, be sheep mycoplasma
Property pneumonia and goats contagious pleuropneumonia provide fast and accurately diagnosis and this two kinds sick epidemiological survey providing methods.
To achieve the above object, using following technical scheme:
The present invention according to F38 plants of MCCPF38_00984 gene orders of 95010 plants of MLC_0560 gene orders of Mmc and Mccp,
Two pairs of primers are designed, outer primer SEQ ID No.1:MFW325:GAATGTTTAATCGATCAACTGCT, SEQ ID No.2:
MRW325:TGCTAATAGTGG
TCCTGCTAAGA；Inner primer SEQ ID No.3:107F:5'-CAATACATCCATTARMACTC
TTGA-3', SEQ ID No.4:107R:5'-GAATWCAYTCAGGTTGATTATTAGGA -3'.
Identify the HRM method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies, comprising the following steps:
1) genomic DNA of mycoplasma is extracted from sample to be identified；
2) PCR is expanded in advance: using step (1) extract mycoplasma genomic DNA as template, using outer primer SEQ ID No.1 with
SEQ ID No.2 carries out PCR and expands in advance；Amplification system are as follows: upstream and downstream primer (10 μm of ol/L) each 0.5 μ L, 2 μ L, taq enzyme of template
12.5 μ L, moisturizing to 25 μ L；Amplification condition are as follows: 95 DEG C of 3min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 20s, 40 recycle
To corresponding pre- amplified production, size is respectively 327bp；
3) PCR amplification and HRM analysis: using pre- amplified production as template, it is with inner primer SEQ ID No.3 and SEQ ID No.4
Primer carries out PCR amplification, amplification system are as follows: upstream and downstream primer (10 μm of ol/L) each 0.5 μ L, 2 μ L, taq enzyme of template, 12.5 μ L,
0.5 μ L of syto9 dyestuff, moisturizing to 25 μ L；Amplification condition are as follows: 95 DEG C of 3min；95 DEG C of 15s, 53 DEG C of 15s, 72 DEG C of 10s, 40
A circulation, amplified production size are 107bp；After amplification, carry out HRM analysis, condition be 95 DEG C of 1min, 45 DEG C of 1min,
Then 90 DEG C are warming up to 0.3 DEG C/s.
4) HRM interpretation of result: analyzing HRM result, according to the other Mycoplasma mycoides subsp.capri of melting curve illustrated handbook
With mycoplasma capri goat pneumonia subspecies；The Tm value of Mmc is 71.08 DEG C, and the Tm value of Mccp is 69.55 DEG C.
Any of the above-described primer identifies Mycoplasma mycoides subsp.capri and the inspection of mycoplasma capri goat pneumonia subspecies in preparation
Application on test agent box.
Beneficial effects of the present invention:
The method that the present invention identifies Mmc and Mccp has the advantages that high specificity, reproducible, quick and at low cost, is suitable for
The customs of sheep mycoplasmal pneumonia and goats contagious pleuropneumonia, border inspection and quarantine, clinical diagnosis and epidemiological survey,
The blank of the domestic and international area research has been filled up in the invention, has important economic significance.
Detailed description of the invention
Fig. 1: HRM detection specificity verification figure.Mmc: Mycoplasma mycoides subsp.capri；Mccp: mycoplasma capri Lung in Goats
Scorching subspecies.
Fig. 2: 23 parts of clinics sample HRM testing result to be identified.Mmc: Mycoplasma mycoides subsp.capri；Mccp: goat branch
Substance goat pneumonia subspecies.
Specific embodiment
Below with reference to embodiment, the present invention will be further described.
Embodiment 1
1, bacterial strain
FJ-GT plants of Mycoplasma mycoides subsp.capri, mycoplasma capri goat pneumonia subspecies type strain MccpF38 are by Fujian Province's agriculture
Plant-eating animal disease research department, animal and veterinary research institute, the industry academy of sciences saves.
2, design of primers and synthesis
According to 95010 plants of MLC_0560 genes of Mmc (GenBank accession number FQ377874.1) sequence and F38 plants of Mccp
MCCPF38_00984 gene (GenBank accession number LN515398.1) sequence, designs two pairs of specific primers:
Outer primer SEQ ID No.5:MFW325:5'-GAATGTTTAATCGATCAACTGCT-3',
SEQ ID No.6:MRW325:5'-TGCTAATAGTGGTCCTGCTAAGA-3'.
Inner primer SEQ ID No.7:107F:5'-CAATACATCCATTARMACTCTTGA-3',
SEQ ID No.8:107R:5'-GAATWCAYTCAGGTTGATTATTAGGA -3'.
3, identify the HRM method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies, including following step
It is rapid:
(1) genomic DNA of mycoplasma is extracted from sample to be identified
It is extracted from FJ-GT plants of bacterial strain Mycoplasma mycoides subsp.capri, mycoplasma capri goat pneumonia subspecies type strain MccpF38
Genomic DNA is extracted using Ezup pillar bacterial genomes DNA extraction agent box.
(2) PCR is expanded in advance
With FJ-GT plants of the Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies type strain of said extracted
The genomic DNA of MccpF38 is template, carries out PCR as primer using outer primer SEQ ID No.5 and SEQ ID No.6 and expands in advance.
Amplification system are as follows: upstream and downstream primer (10 μm of ol/L) each 0.5 μ L, 2 μ L, taq enzyme of template, 12.5 μ L, moisturizing to 25 μ L amplification conditions
Are as follows: 95 DEG C of 3mi；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C of 20s, 40 circulations obtain corresponding pre- amplified production, size difference
For 327bp.
(3) PCR amplification and HRM analysis
It is that primer carries out PCR amplification with inner primer SEQ ID No.7 and SEQ ID No.8 using pre- amplified production as template, amplification
System are as follows: upstream and downstream primer (10 μm of ol/L) each 0.5 μ L, 2 μ L, taq enzyme of template, 12.5 μ L, syto9 dyestuff, 0.5 μ L, moisturizing is extremely
25 μ L, amplification condition are as follows: 95 DEG C of 3min；95 DEG C of 15s, 53 DEG C of 15s, 72 DEG C of 10s, 40 circulations, amplified production size are
107bp after amplification, carries out HRM analysis, and condition is 95 DEG C of 1min, then 45 DEG C of 1min are warming up to 90 with 0.3 DEG C/s
℃。
(4) HRM interpretation of result
HRM result is analyzed using Rotor-Gene Q Series Software software, it is other according to melting curve illustrated handbook
Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies.As the result is shown: the melting curve Tm value of Mmc is 71.08
DEG C, the melting curve Tm value of Mccp is 69.55 DEG C, no non-specific amplification, it is seen that designed primer can be by Mmc and Mccp
It distinguishes, shows that the HRM method for identifying Mmc and Mccp is successfully established, the quick identification of Mmc and Mccp can be used for.
2 specificity verification of embodiment
Mmc, Mccp, mycoplasma ovine pneumoniae (Movi), sheep of virus are extracted with the method for step (1) in embodiment 1
(ORFV), Escherichia coli, salmonella, Pasteurella, mycoplasma arginini genomic DNA, respectively as template, with HRM
Method is identified, and the side HRM for identifying Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies is established in verifying
The specificity of method.The result is shown in Figure 1.Fig. 1 the result shows that: the present invention can accurately, quickly identify Mycoplasma mycoides subsp.capri and
Mycoplasma capri goat pneumonia subspecies, can be used for clinical diagnosis and the stream of sheep mycoplasmal pneumonia and goats contagious pleuropneumonia
Row disease learns investigation.
3 repeatability verifying of embodiment
The Mmc and Mccp genomic DNA extracted using Ezup pillar bacterial genomes DNA extraction agent box is as template, with drawing
Object MF-107, MR-107 carry out PCR amplification to the template of extraction, and amplified production recovery purifying after agargel electrophoresis will be pure
The target gene connection of change converts DH5 α competent cell, utilizes TaKaRaMiniBEST on PMD-19T cloning vector
Plasmid Purification Kit Ver.4.0 extracting plasmid does PCR identification and digestion identification, measures its concentration and calculates
The standard items that copy number is detected as HRM.Standard items are done into template by 10 times of gradient dilutions, carry out the repeatability detection of HRM.Batch
Interior repetition test is with sample replication 3 times of each concentration；Test is repeated between batch is surveyed altogether with the standard items of 3 dilutions
3 times fixed, every minor tick 3d, HRM reaction system and loop parameter are the same as described in embodiment 1.The melting peakss presented according to two kinds of cause of diseases
Tm value calculates separately within-run and between-run analysis coefficient.Verify the repeatability and stability of this method.It the results are shown in Table 1,1 result table of table
Bright, method of the invention is reproducible, good stability.
Table 1HRM repetitive test result
Note！TM1 is the Tm value of Mccp；TM2 is the Tm value of Mmc.
4 clinical application embodiment of embodiment
23 parts of the clinical sample (nose swab) that doubtful mycoplasma infection is collected from Yang Chang, using mycoplasma ovine pneumoniae (Movi) as
Negative control carries out the identification detection of HRM method in method described in embodiment 1, as a result sees Fig. 2.Fig. 2 is the results show that the party
Method detects 3 parts of Mmc, and Mccp is not detected.Detected 3 parts of positive samples are sequenced, are as a result compared online using BLAST
It is 100% to the rear homology with Mmc, the HRM method accuracy for showing that this research institute establishes is high.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, all should belong to covering scope of the invention.
SEQUENCE LISTING
<110>Fujian Province Academy Of Agricultural Sciences Animal Husbandry And Veterinary Medicine Institute
<120>identify the HRM primer and method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies
<130> 8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> MFW325
<400> 1
gaatgtttaa tcgatcaact gct 23
<210> 2
<211> 23
<212> DNA
<213> MRW325
<400> 2
tgctaatagt ggtcctgcta aga 23
<210> 3
<211> 24
<212> DNA
<213> 107F
<400> 3
caatacatcc attarmactc ttga 24
<210> 4
<211> 26
<212> DNA
<213> 107R
<400> 4
gaatwcaytc aggttgatta ttagga 26
<210> 5
<211> 23
<212> DNA
<213> MFW325
<400> 5
gaatgtttaa tcgatcaact gct 23
<210> 6
<211> 23
<212> DNA
<213> MRW325
<400> 6
tgctaatagt ggtcctgcta aga 23
<210> 7
<211> 24
<212> DNA
<213> 107F
<400> 7
caatacatcc attarmactc ttga 24
<210> 8
<211> 26
<212> DNA
<213> 107R
<400> 8
gaatwcaytc aggttgatta ttagga 26
Claims (6)
1. identifying the HRM primer of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies, it is characterised in that: including
Outer primer: SEQ ID No.1:MFW325:5'-GAATGTTTAATCGATCAACT
GCT-3', SEQ ID No.2:MRW325:5'-TGCTAATAGTGGTCCTGCTAAGA-3'；With inner primer SEQ ID
No.3:107F:5'-CAATACATCCATTARMACTCTTGA-3', SEQ ID No.4:107R:5'-
GAATWCAYTCAGGTTGATTATTAGGA -3'。
2. identifying the HRM method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies, which is characterized in that including
Following steps:
1) genomic DNA of mycoplasma is extracted；
2) PCR is expanded in advance: the mycoplasma genome extracted using outer primer SEQ ID No.1 and SEQ ID No.2 with step (1)
DNA is that template expands Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies progress PCR in advance, is obtained corresponding
Target fragment, size be 327bp；
3) PCR amplification and HRM analysis: it is as template, with inner primer SEQ ID No.3 and SEQ ID No.4 using pre- amplified production
Primer carries out PCR amplification, and obtaining size is the target fragment for being 107bp, after amplification, carries out HRM analysis;
4) HRM interpretation of result: analyzing HRM result, according to the other Mycoplasma mycoides subsp.capri of melting curve illustrated handbook and mountain
Sheep mycoplasma goat pneumonia subspecies, the Tm value of Mmc are 71.08 DEG C, and the Tm value of Mccp is 69.55 DEG C.
3. the HRM according to claim 2 for identifying Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies
Method, which is characterized in that the amplification system that PCR is expanded in advance in step (2) are as follows: upstream and downstream primer (10 μm of ol/L) each 0.5 μ L, mould
2 μ L of plate, 12.5 μ L of Taq enzyme, moisturizing to 25 μ L, amplification condition are as follows: 95 DEG C of 3min；95 DEG C of 15s, 55 DEG C of 15s, 72 DEG C
20s, 40 circulations.
4. the HRM according to claim 2 for identifying Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies
Method, which is characterized in that the amplification system of PCR amplification in step (3) are as follows: upstream and downstream primer (10 μm of ol/L) each 0.5 μ L, template
2 μ L, 12.5 μ L, syto9 dyestuff of Taq enzyme, 0.5 μ L, moisturizing to 25 μ L, 95 DEG C of 3min；95 DEG C of 15s, 53 DEG C of 15s, 72 DEG C
10s, 40 circulations.
5. the HRM according to claim 2 for identifying Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies
Method, which is characterized in that the condition that HRM is analyzed in step (3) is 95 DEG C of 1min, 45 DEG C of 1min, then with 0.3 DEG C/s heating
To 90 DEG C.
6. a kind of any bar primer as described in claim 1 identifies Mycoplasma mycoides subsp.capri and mycoplasma capri mountain in preparation
Application in sheep pneumonia subspecies detection kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910032431.9A CN109536627B (en) | 2019-01-14 | 2019-01-14 | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910032431.9A CN109536627B (en) | 2019-01-14 | 2019-01-14 | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109536627A true CN109536627A (en) | 2019-03-29 |
| CN109536627B CN109536627B (en) | 2022-06-07 |
Family
ID=65834991
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910032431.9A Active CN109536627B (en) | 2019-01-14 | 2019-01-14 | HRM primer and method for identifying mycoplasma filiformis goat subspecies and mycoplasma capricolum goat pneumonia subspecies |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109536627B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235289A (en) * | 2020-03-15 | 2020-06-05 | 中国农业科学院兰州兽医研究所 | Specific PCR primer for detecting mycoplasma capricolum goat pneumonia subspecies |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200162A (en) * | 2015-08-06 | 2015-12-30 | 广东省农业科学院动物卫生研究所 | HRM detection method for rapidly distinguishing HP-PRRS live vaccine JXA1-R strains and wild strains and primer of HRM detection method |
| CN106434919A (en) * | 2016-09-28 | 2017-02-22 | 福建省农业科学院畜牧兽医研究所 | Primers for triple PCR of three types of sheep pathogenic mycoplasmas and detection method |
| CN107099608A (en) * | 2017-06-13 | 2017-08-29 | 中国农业科学院兰州兽医研究所 | A kind of iiPCR kits for detecting mycoplasma capri goat pneumonia subspecies |
-
2019
- 2019-01-14 CN CN201910032431.9A patent/CN109536627B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200162A (en) * | 2015-08-06 | 2015-12-30 | 广东省农业科学院动物卫生研究所 | HRM detection method for rapidly distinguishing HP-PRRS live vaccine JXA1-R strains and wild strains and primer of HRM detection method |
| CN106434919A (en) * | 2016-09-28 | 2017-02-22 | 福建省农业科学院畜牧兽医研究所 | Primers for triple PCR of three types of sheep pathogenic mycoplasmas and detection method |
| CN107099608A (en) * | 2017-06-13 | 2017-08-29 | 中国农业科学院兰州兽医研究所 | A kind of iiPCR kits for detecting mycoplasma capri goat pneumonia subspecies |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111235289A (en) * | 2020-03-15 | 2020-06-05 | 中国农业科学院兰州兽医研究所 | Specific PCR primer for detecting mycoplasma capricolum goat pneumonia subspecies |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109536627B (en) | 2022-06-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110699489B (en) | Real-time fluorescence PCR detection primer probe set, kit and method for African swine fever virus CD2V gene | |
| CN102605055A (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN106065419A (en) | The quick real-time fluorescence quantitative PCR detection primer differentiating duck circovirus genotype and detection method thereof | |
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN108531629A (en) | A kind of PCR amplification primer of quick detection Friedlander's bacillus and its application | |
| CN107099621B (en) | PCR-HRM detection method for rapidly identifying PRRSV vaccine strain GDr180 strain and other strains | |
| CN111876502B (en) | Method for identifying Brucella S2 vaccine strain by dual real-time fluorescent quantitative PCR and kit used by same | |
| CN106011315A (en) | RT-PCR discriminating diagnosis primers for type 1 and new serotype duck hepatitis virus | |
| CN113025734A (en) | Primer and probe for identifying Brucella vaccine strain A19 and wild strain and application | |
| CN108048600B (en) | Fluorescent quantitative PCR detection method for infectious bovine rhinotracheitis virus | |
| CN108070665A (en) | One kind is used to detect Mannheimia haemolytica real-time fluorescence PCR primer | |
| CN105154584B (en) | A kind of the HRM non-marked detecting probe method and its primer and probe of quick differentiation PRRSV classical strains and variation strain | |
| CN104946769B (en) | The kit of mycoplasma pneumoniae quick detection and Genotyping | |
| CN109337995A (en) | The PCR detection method and kit of bacillus tularense and its subspecies | |
| CN109536627A (en) | Identify the HRM primer and method of Mycoplasma mycoides subsp.capri and mycoplasma capri goat pneumonia subspecies | |
| CN104195265A (en) | PCR-HRM primer and method for rapidly distinguishing wild strain and vaccine strain of canine parvovirus | |
| CN107881259A (en) | A kind of pcr amplification primer thing of quick detection infectious bovine rhinotrachetis virus and its application | |
| CN102653798A (en) | Fluorescent PCR (polymerase chain reaction) detection method for identifying traditional strain and highly pathogenic strain of PRRSV (porcine reproductive and respiratory syndrome virus) | |
| Xu et al. | Comparative genomics of Mycoplasma synoviae and new targets for molecular diagnostics | |
| CN104975077B (en) | Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application | |
| CN107937615A (en) | For distinguishing the primer and probe of Latex agglutination test street strain and vaccine strain | |
| CN116622871B (en) | Pullorum disease and salmonella gallinarum molecular identification kit and non-diagnostic detection method thereof | |
| JP5279051B2 (en) | Oligonucleotides for detecting Salmonella Typhimurium and rapid serotype identification method using them | |
| CN116622872B (en) | Salmonella gallinarum molecular detection kit and non-diagnostic detection method thereof | |
| CN105779656A (en) | Porcine torque teno sus virus type 2 loop-mediated isothermal amplification kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |