CN109536588A - Detect the method and device of the FFPE sample state of oxidation - Google Patents
Detect the method and device of the FFPE sample state of oxidation Download PDFInfo
- Publication number
- CN109536588A CN109536588A CN201811604282.0A CN201811604282A CN109536588A CN 109536588 A CN109536588 A CN 109536588A CN 201811604282 A CN201811604282 A CN 201811604282A CN 109536588 A CN109536588 A CN 109536588A
- Authority
- CN
- China
- Prior art keywords
- oxidation
- ffpe sample
- sample
- state
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Abstract
The invention discloses a kind of method and devices for detecting the FFPE sample state of oxidation.Wherein, method includes the following steps: S1, obtains the sequence information of the target gene of FFPE sample to be detected；And S2, sequence information is analyzed, body cell Mutation information is filtered out, the state of oxidation of FFPE sample to be detected is determined by calculating wherein specific type mutant proportion.It applies the technical scheme of the present invention, the judgement of the sample state of oxidation is carried out based on sequencing data, since positive reference product and negative reference product can be saved, cost has been saved, and have the characteristics that high sensitivity and high specific.
Description
Technical field
The present invention relates to field of biotechnology, in particular to a kind of method for detecting the FFPE sample state of oxidation and
Device.
Background technique
In tumor sample, usually since oncogenic occurrence and development are led in various somatic variations, it is thin accurately to assess body
Born of the same parents' variation is for instructing patient's treatment to play an important role.However, FFPE (formalin-fixed paraffin-
Embedded, FFPE, the fixed paraffin embedding of formalin) tumor sample is normal due to the holding time is longer and condition is limited etc.
Often aoxidize, however oxidation also results in the variation of base, variation caused by this oxidation and somatic variation are not easily distinguishable,
So so that people can not accurate evaluation FFPE sample somatic variation.Therefore, accurately determine the FFPE sample state of oxidation
The detection of somatic variation is played an important role.
Existing method usually will not directly determine the FFPE sample state of oxidation, but general technology guidance is sequenced according to two generations
Principle designs positive reference product and negative reference product in each batch.However in true clinical practice, often due to cost
Preferential considers, and has ignored the purchase and setting of reference material, there are the risks that the sample state of oxidation can not accurately identify.
It would therefore be highly desirable to solve the problems, such as to accurately identify existing for the sample oxidation detection of no reference material.
Summary of the invention
The present invention is intended to provide it is a kind of detect the FFPE sample state of oxidation method and device, with solve in the prior art without
The technical issues of can not being accurately identified existing for the sample oxidation detection of reference material.
To achieve the goals above, according to an aspect of the invention, there is provided a kind of detection FFPE sample state of oxidation
Method.Method includes the following steps: S1, obtains the sequence information of the target gene of FFPE sample to be detected；And S2, it is right
Sequence information is analyzed, and body cell Mutation information is filtered out, by calculate wherein specific type mutant proportion determine to
Detect the state of oxidation of FFPE sample.
Further, S1 includes: the amplified production for obtaining target gene from DNA by target area capture technique, so
Sequence information is obtained by high-flux sequence method afterwards.
Further, in S2 screen body cell site variation information include counterweight answer area nearby mutation be filtered.
Further, screen body cell site variation information further includes carrying out to chain Preference site and low frequency variation in S2
Filtering.
Further, specific type mutant proportion sports thymidine/guanine for cytimidine and sports adenine.
Further, the state of oxidation packet of FFPE sample to be detected is determined by calculating wherein specific type mutant proportion
It includes: thymidine/guanine is sported according to cytimidine in the FFPE sample of the known state of oxidation and unoxidized FFPE sample
Sport the ratio given threshold of adenine；Cytimidine in FFPE sample to be detected is sported into thymidine/guanine mutation
Ratio for adenine is compared with threshold value and then the state of oxidation of determining FFPE sample to be detected.
Further, it is known that the FFPE sample of the state of oxidation and unoxidized FFPE sample are respectively multiple samples.
Further, in S1 to including the steps that data processing after carrying out high-flux sequence, the step of data processing, includes:
Using software is compared by high-flux sequence sequence alignment to reference gene, the sequence not compared forms soft truncation, then root
It is ranked up according to the position of comparison, and establishes index with samtools software；File after being compared using the input of VarScan software
Carry out variation detection.
Further, comparing software using BWA-mem will be on high-flux sequence sequence alignment to reference gene.
According to another aspect of the present invention, a kind of device for detecting the FFPE sample state of oxidation is provided.The device is used for
Storage or operation module or module are the component part of device；Wherein, module is multiple, and module is any of the above-described for executing
Kind method.
It applies the technical scheme of the present invention, the judgement of the sample state of oxidation is carried out based on sequencing data, due to that can save
Therefore positive reference product and negative reference product have saved cost, and have the characteristics that high sensitivity and high specific.
Detailed description of the invention
The accompanying drawings constituting a part of this application is used to provide further understanding of the present invention, and of the invention shows
Examples and descriptions thereof are used to explain the present invention for meaning property, does not constitute improper limitations of the present invention.In the accompanying drawings:
Fig. 1 shows the flow diagram of the method for the detection FFPE sample state of oxidation of an embodiment of the present invention.
Specific embodiment
It should be noted that in the absence of conflict, the features in the embodiments and the embodiments of the present application can phase
Mutually combination.The present invention will be described in detail below with reference to the accompanying drawings and embodiments.
The technical issues of for recording in background technique, the present invention is based on sequencing datas to carry out the judgement of the sample state of oxidation,
Using all somatic variations detected in sample, the methods of the filtering process and threshold value of auxiliary designed, designed setting is determined
The state of oxidation of sample, proposes following technical scheme.
A kind of typical embodiment according to the present invention provides a kind of method for detecting the FFPE sample state of oxidation.The party
Method obtains the sequence information of the target gene of FFPE sample to be detected the following steps are included: S1；And S2, to sequence information into
Row analysis, filters out body cell Mutation information, determines FFPE sample to be detected by calculating wherein specific type mutant proportion
This state of oxidation.
It applies the technical scheme of the present invention, the judgement of the sample state of oxidation is carried out based on sequencing data, due to that can save
Therefore positive reference product and negative reference product have saved cost, and have the characteristics that high sensitivity and high specific.
Preferably, S1 includes: the amplified production for obtaining target gene from DNA by target area capture technique, then
Sequence information is obtained by high-flux sequence method.The high throughput sequencing technologies of combining target areas captured, further improve
The sensitivity and specificity of this method.
A kind of typical embodiment according to the present invention, screen body cell site variation information includes that answer area attached for counterweight in S2
Nearly mutation is filtered, and further decreases the vacation sun for the body cell Mutation for being subsequently used for calculating specific type mutant proportion
Property.Preferably, screen body cell site variation information further includes being filtered to chain Preference site and low frequency variation in S2, is had
The accuracy determined using the state of oxidation for improving subsequent FFPE sample to be detected.
Preferably, specific type mutant proportion sports thymidine/guanine for cytimidine and sports adenine, uses
This ratio can be good at determining the state of oxidation of FFPE sample.In general, born of the same parents are phonetic in the FFPE sample of the state of oxidation
Pyridine sports thymidine/guanine and sports the ratio of adenine higher than 60%；Cytimidine is prominent in unoxidized FFPE sample
Become thymidine/guanine and sports the ratio of adenine lower than 40%.
A kind of typical embodiment according to the present invention, by calculate wherein specific type mutant proportion determine it is to be detected
The state of oxidation of FFPE sample include: in FFPE sample and unoxidized FFPE sample according to the known state of oxidation cytimidine it is prominent
Become the ratio given threshold that thymidine/guanine sports adenine；Cytimidine in FFPE sample to be detected is sported
The ratio that thymidine/guanine sports adenine is compared with threshold value and then determines the oxidation shape of FFPE sample to be detected
State.For example, cytimidine in the FFPE sample of the known state of oxidation and unoxidized FFPE sample can be sported thymidine/
The median that guanine sports the ratio of adenine is set as threshold value, when cytimidine sports thymus gland in FFPE sample to be detected
The cytimidine for the FFPE sample that the ratio that pyrimidine/guanine sports adenine is biased to the state of oxidation sports thymidine/bird
When purine mutation is the ratio of adenine, then determine that FFPE sample to be detected is the state of oxidation, conversely, not aoxidize sample.
In order to improve the accuracy of set threshold value, it is preferred that the FFPE sample of the known state of oxidation and unoxidized
FFPE sample is respectively multiple samples.
A kind of typical embodiment according to the present invention, in S1 to carry out include after high-flux sequence data processing step
Suddenly, the step of data processing includes: and is not compared using software is compared by high-flux sequence sequence alignment to reference gene
Sequence forms soft truncation, is then ranked up according to the position of comparison, and establishes index with samtools software；It uses
File carries out variation detection after the input of VarScan software compares.Preferably, software is compared by high-flux sequence using BWA-mem
On sequence alignment to reference gene.
In an exemplary embodiment of the invention, for detecting the key step of the FFPE cancer sample state of oxidation such as
Under: 1) sample preprocessing and extract DNA；2) target area capture principle captures the body cell of sample using the probe of particular sequence
Variant sites；3) it is sequenced by high-throughput method, obtains sequence；4) low-quality sequence is filtered out, the present invention is utilized
Determination flow detected.
Specific step is as follows (referring to Fig. 1):
In the present embodiment, concrete operations are broadly divided into two large divisions, and first part is to complete part outside detection program,
Second part is to complete part in detection program.
First part: sample process
Step1: sample DNA extracts, interrupts, adjunction head, hybrid capture, elution, enrichment, sequencing.
Second part: data processing, process as shown in Figure 1, including detection program are completed and detected outside to be completed in program
Two parts.Wherein, it completes to specifically include that lower machine data compare software for high-flux sequence sequence using BWA-mem outside detection program
Column are compared to the mankind with reference on gene, and the sequence not compared forms soft truncation；Then it is ranked up according to the position of comparison, and
Index is established with samtools software.Completion specifically includes that sequence and check sample ratio after tumor sample comparison in detection program
Variation detection is carried out to the sequence in comparison using VarScan2 software to rear sequence；Determine that monokaryon glycosides occurs in somatic variation
The variation in sour site is nearby mutated duplicate block in the above variation and is filtered；Chain Preference site and low frequency variation are carried out
Filtering；Finally, calculating oxidation using the somatic variation obtained after filtering leads to the proportion that makes a variation, i.e. cytimidine is converted to chest
Gland pyrimidine/guanine is converted to adenine (C > T/G > A) variation proportion, determines the state of oxidation of this FFPE sample.
A kind of typical embodiment according to the present invention provides a kind of device for detecting the FFPE sample state of oxidation.The dress
It sets for storing or running module or module as the component part of device；Wherein, module is multiple, and module is for executing
State any method.
Beneficial effects of the present invention are further illustrated below in conjunction with embodiment, are not limited clearly in the present embodiment
Method, standard or reagent can be used the conventional method of this field, this field approve standard or conventional reagent come realize without
Substantive influence can be caused to testing result.
Embodiment 1
In the present embodiment, concrete operations are broadly divided into two large divisions, and first part is to complete part outside detection program, the
Two parts are to complete part in detection program.
In the present embodiment, sample to be checked in first part be known to occur Strong oxdiative lung cancer FFPE pathology sample and
Corresponding check sample.In the present embodiment, the target gene of covering includes more cancer kind related genes, amounts to 549.Oligogene
Have: EGFR, ALK, ROS1, ERBB2, BRAF, KRAS, NRAS, FGFR1, FGFR2, FGFR3 etc..
In an embodiment of the present invention, main agents articles are commercially available, information such as the following table 1:
Table 1
Specific steps are as follows:
1. sample preprocessing simultaneously extracts DNA, being quantified using fluorescent quantitation meter (Qubit), concentration is 3.8ng/ μ l,
Volume is 130 μ l；Fragmentation is carried out to sample using Ultrasonic Cell Disruptor (Covaris), makes DNA fragmentation size in 200~400bp
Between, then whether met the requirements using agarose gel electrophoresis detection clip size.
2. the sample of fragmentation is first carried out magnetic beads for purifying, then carries out end and repair and 3 ' polyadenylation, the system configurations in end
See the table below 2, basic step is as follows: first in 20 DEG C of warm bath 30min, secondly in 65 DEG C of warm bath 30min, reaction was completed.
Table 2
| End is repaired and 3 ' the polyadenylation buffers in end | 7μl |
| End is repaired and 3 ' end adenylase mixed liquors | 3μl |
| DNA | 50μl(500ng) |
3. the DNA after above-mentioned reparation is carried out connector (common commercial connector: NEXTflex DNA Barcodes-24) even
It connects, the following table 3 is detailed in connector interfaces system, in 20 DEG C of warm bath 15min.
Table 3
| Reagent | Volume |
| The connector of tape label | 2.5μl |
| DNA sample | 60μl |
| Connect reaction solution | 30μl |
| Ligase | 10μl |
| The water of nuclease free | 7.5μl |
4. the product after the connection of above-mentioned connector is carried out magnetic beads for purifying, PCR amplification is then carried out, enough belt lacings are obtained
DNA fragmentation, basic step is as follows: first in 98 DEG C of initial denaturation 45s, secondly in 98 DEG C of denaturation 15s, then in 60 DEG C of annealing 30s,
72 DEG C of extension 30s；Repeat denaturation annealing extension process 7 times；Finally in 72 DEG C of extension 1min, reaction was completed.Amplification system is seen below
Table 4:
Table 4:
5. after pair pcr amplification product carries out magnetic beads for purifying, after quantitatively obtaining concentration using Qubit, taking out 500ng amplification and producing
Object (P5 tip side primer, SEQ ID NO.1:aatgatacggcgaccaccgaga, P7 tip side primer, SEQ ID NO.2:
Caagcagaagacggcatacgag), using concentrating instrument by amplified production volume concentration to 4.4 μ l, then closed and visited
Needle (being commercially available from Agilent) hybridization, hybridization reaction system are as shown in table 5 below.
Table 5
| Reagent | Volume |
| Closed reagent mixed liquor | 5.6μl |
| P5, P7 closed reagent | 2μl |
| Quick closure reagent | 5μl |
| RNA enzyme closed reagent | 2μl |
| For the biotinylated probes of target area | 2μl |
| Hybridization buffer | 6μl |
| The water of nuclease free | 3μl |
| Pcr amplification product | 4.4μl |
Hybridization reaction condition is as shown in table 6 below:
Table 6
6. being captured using the sample that streptavidin magnetic bead combines probe, steps are as follows: 50 μ l magnetic beads are added
1.5ml centrifuge tube, is placed on magnetic frame, abandons supernatant, after 200 μ l connection buffer solution for cleaning three times, is buffered using 200 μ l connections
Magnetic bead is resuspended in liquid, and magnetic bead is added in the sample hybridized with probe, 30min is mixed by inversion on blending instrument, is placed on magnetic frame, in abandoning
Clearly, it is cleaned 1 time with cleaning solution 1, is then cleaned 3 times with the cleaning solution 2 for being preheating to 65 DEG C, during which guarantee magnetic bead and buffer 2
Temperature is at 65 DEG C.It is finally placed on magnetic frame, abandons supernatant, the water of 38 μ l nuclease frees is added, magnetic bead is resuspended.
7. the DNA fragmentation that magnetic capture is arrived carries out PCR amplification, amplification system see the table below 7, obtain enough plus connector
The DNA fragmentation of (common commercial connector: NEXTflex DNA Barcodes-24), basic step are as follows: first in 98 DEG C of initial denaturations
2min, secondly in 98 DEG C of denaturation 30s, then in 60 DEG C of annealing 30s, 72 DEG C of extension 1min；Repeat denaturation annealing extension process 14
It is secondary；Finally in 72 DEG C of extension 5min, reaction was completed.
Table 7
| Reagent | Volume |
| High-fidelity DNA polymerase | 1μl |
| Amplimer (P5 tip side primer and P7 tip side primer) | 1μl |
| High-fidelity DNA polymerase reacts mixed liquor | 10μl |
| Mononucleotide mixed liquor | 0.5μl |
| Target area domain dna on magnetic bead | 37.5μl |
8. obtained pcr amplification product is subjected to magnetic beads for purifying, it is then quantitative using qPCR, it is big that segment is carried out using 2100
Small detection.
9. sequencing, completes sequencing on gene sequencer, microarray dataset converts obtained optical signal under base sequence
Machine data are that fq file stores all sequencing fragment results.
In the second part of the present embodiment, lower machine data fq file is compared and refers to genome, removes low quality sequence
Column, are detected using the testing process of the present embodiment.
Process mainly comprises the steps that sequence makes after sequence and check sample compare after tumor sample compares referring to Fig. 1
Variation detection is carried out to the sequence in comparison with VarScan2 software；Determine the change that mononucleotide site occurs in somatic variation
It is different, duplicate block in the above variation is nearby mutated and is filtered；Chain Preference site and low frequency variation are filtered；Finally,
Calculating oxidation using the somatic variation obtained after filtering leads to the proportion that makes a variation, i.e. cytimidine is converted to thymidine/bird
Purine is converted to adenine (C > T/G > A) variation proportion, determines the state of oxidation of this FFPE sample.
Pattern detection result are as follows: this sample state of oxidation score value is 0.7, greater than the threshold value 0.55 being currently set.It is higher than
The threshold value is judged as sample oxidation, consistent with sample time of day.
It is detected using the FFPE sample of 10 known states of oxidation, all sample standard deviations can be appropriately determined, and be specifically shown in
Table 8.
Table 8
| Sample number | Sample type | Time of day | Oxidation scoring | Oxidation determines | It is whether consistent |
| S1 | Lung cancer sample | Oxidation | 0.92 | Oxidation | Unanimously |
| S2 | Lung cancer sample | Oxidation | 0.81 | Oxidation | Unanimously |
| S3 | Lung cancer sample | Oxidation | 0.76 | Oxidation | Unanimously |
| S4 | Lung cancer sample | Oxidation | 0.66 | Oxidation | Unanimously |
| S5 | Lung cancer sample | Oxidation | 0.85 | Oxidation | Unanimously |
| S6 | Lung cancer sample | It does not aoxidize | 0.33 | It does not aoxidize | Unanimously |
| S7 | Lung cancer sample | It does not aoxidize | 0.32 | It does not aoxidize | Unanimously |
| S8 | Lung cancer sample | It does not aoxidize | 0.41 | It does not aoxidize | Unanimously |
| S9 | Lung cancer sample | It does not aoxidize | 0.28 | It does not aoxidize | Unanimously |
| S10 | Lung cancer sample | It does not aoxidize | 0.34 | It does not aoxidize | Unanimously |
It can be seen from the above description that the above embodiments of the present invention realized the following chievements: with setting sun
Property compared with the method for negative reference product, this method detection precision it is higher, available specific decision threshold.Except this it
Outside, the testing process of development can utilize the sequencing data of pathology sample and check sample, the mistake of auxiliary designed, designed well
Process is filtered, sample state of oxidation identification can be accurately carried out, so that identification sample aoxidizes shape in the case where reference material missing
State is possibly realized.
The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, for the skill of this field
For art personnel, the invention may be variously modified and varied.All within the spirits and principles of the present invention, made any to repair
Change, equivalent replacement, improvement etc., should all be included in the protection scope of the present invention.
Sequence table
<110>Beijing You Xun Laboratory of medical test Co., Ltd
<120>method and device of the FFPE sample state of oxidation is detected
<130> PN102118YXYX
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(22)
<223>P5 tip side primer
<400> 1
aatgatacgg cgaccaccga ga 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<220>
<221> primer_bind
<222> (1)..(22)
<223>P7 tip side primer
<400> 2
caagcagaag acggcatacg ag 22
Claims (10)
1. a kind of method for detecting the FFPE sample state of oxidation, which comprises the following steps:
S1 obtains the sequence information of the target gene of FFPE sample to be detected；And
S2 analyzes the sequence information, filters out body cell Mutation information, prominent by calculating wherein specific type
Control with changed scale determines the state of oxidation of the FFPE sample to be detected.
2. the method according to claim 1, wherein the S1 includes: by target area capture technique from DNA
The middle amplified production for obtaining the target gene, then obtains the sequence information by high-flux sequence method.
3. the method according to claim 1, wherein screen body cell site variation information includes pair in the S2
Duplicate block is nearby mutated and is filtered.
4. according to the method described in claim 3, it is characterized in that, screen body cell site variation information further includes in the S2
Chain Preference site and low frequency variation are filtered.
5. the method according to claim 1, wherein the specific type mutant proportion is that cytimidine sports chest
Gland pyrimidine/guanine sports adenine.
6. according to the method described in claim 5, it is characterized in that, described determined by calculating wherein specific type mutant proportion
The state of oxidation of the FFPE sample to be detected includes:
Thymidine/guanine is sported according to cytimidine in the FFPE sample of the known state of oxidation and unoxidized FFPE sample
Sport the ratio given threshold of adenine；
By cytimidine in the FFPE sample to be detected sport thymidine/guanine sport the ratio of adenine with it is described
Threshold value is compared and then determines the state of oxidation of the FFPE sample to be detected.
7. according to the method described in claim 6, it is characterized in that, the FFPE sample of the known state of oxidation and unoxidized
FFPE sample is respectively multiple samples.
8. according to the method described in claim 2, it is characterized in that, in the S1 to carry out high-flux sequence after include data at
The step of the step of reason, the data processing include: using comparing software on high-flux sequence sequence alignment to reference gene,
The sequence not compared forms soft truncation, is then ranked up according to the position of comparison, and is established with samtools software
index；File carries out variation detection after being compared using the input of VarScan software.
9. according to the method described in claim 8, it is characterized in that, comparing software for high-flux sequence sequence using BWA-mem
It compares on reference gene.
10. a kind of device for detecting the FFPE sample state of oxidation, which is characterized in that described device is used to storing or running module,
Or the module is the component part of described device；Wherein, the module is multiple, and the module is for executing as right is wanted
Method described in asking any one of 1 to 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811604282.0A CN109536588A (en) | 2018-12-26 | 2018-12-26 | Detect the method and device of the FFPE sample state of oxidation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811604282.0A CN109536588A (en) | 2018-12-26 | 2018-12-26 | Detect the method and device of the FFPE sample state of oxidation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109536588A true CN109536588A (en) | 2019-03-29 |
Family
ID=65858394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811604282.0A Pending CN109536588A (en) | 2018-12-26 | 2018-12-26 | Detect the method and device of the FFPE sample state of oxidation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109536588A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111477277A (en) * | 2020-05-29 | 2020-07-31 | 北京优迅医学检验实验室有限公司 | Sample quality evaluation method and device |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106874710A (en) * | 2016-12-29 | 2017-06-20 | 安诺优达基因科技(北京)有限公司 | A kind of device for using tumour FFPE pattern detection somatic mutations |
-
2018
- 2018-12-26 CN CN201811604282.0A patent/CN109536588A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106874710A (en) * | 2016-12-29 | 2017-06-20 | 安诺优达基因科技(北京)有限公司 | A kind of device for using tumour FFPE pattern detection somatic mutations |
Non-Patent Citations (3)
| Title |
|---|
| HONGDO DO 等: "Sequence Artifacts in DNA from Formalin-Fixed Tissues:Causes and Strategies for Minimization", 《CLINICAL CHEMISTRY》 * |
| MAURA COSTELLO 等: "Discovery and characterization of artifactual mutations in deep coverage targeted capture sequencing data due to oxidative DNA damage during sample preparation", 《NUCLEIC ACIDS RESEARCH》 * |
| YOST S E ET AL.: "Identification of high-confidence somatic mutations in whole genome sequence of formalin-fixed breast cancer specimens", 《NUCLEIC ACIDS RESEARCH》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111477277A (en) * | 2020-05-29 | 2020-07-31 | 北京优迅医学检验实验室有限公司 | Sample quality evaluation method and device |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109207594B (en) | Method for detecting microsatellite stability state and genome change through plasma based on next generation sequencing | |
| CN105861710B (en) | Sequence measuring joints, its preparation method and its application in ultralow frequency variation detection | |
| CN107058551B (en) | Method and device for detecting instability of microsatellite locus | |
| CN108315424B (en) | PCR (polymerase chain reaction) specific primer, detection kit and detection method for thyroid nodule benign and malignant related genes | |
| CN106399504A (en) | Targeting-based new generation sequencing deafness gene detection set and kit, and detection method | |
| CN106834502A (en) | A kind of spinal muscular atrophy related gene copy number detection kit and method based on gene trap and two generation sequencing technologies | |
| CN108588194A (en) | Utilize the method and device of high-flux sequence Data Detection Tumor mutations load | |
| CN111349719B (en) | Specific primer for detecting novel coronavirus and application thereof | |
| CN110878343A (en) | Cpf1 kit for quickly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof | |
| CN111073961A (en) | High-throughput detection method for gene rare mutation | |
| CN109022562A (en) | For detecting the screening technique of the SNP site of sample contamination and the method for detecting sample contamination in high-flux sequence | |
| CN109686404A (en) | The method and device that detection sample is obscured | |
| CN109182483A (en) | The method and device that genetic mutation is interpreted | |
| WO2023001211A1 (en) | Gene chip, molecular probe combination and kit for analyzing traits of sheep wool, and use | |
| CN111662981A (en) | Cancer gene detection kit based on second-generation sequencing probe capture method | |
| CN110468189A (en) | The method and device of detection sample somatic variation is sequenced based on single two generation of sample | |
| CN106636441A (en) | Probe for detecting mutation of gene ALDH2, as well as application thereof and kit | |
| CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
| Kim et al. | Novel method of real-time PCR-based screening for common fetal trisomies | |
| CN110863053A (en) | Primer, probe and method for detecting EGFR vIII mutant | |
| Salvi et al. | Urinary cell-free DNA: potential and applications | |
| CN109593832A (en) | A kind of detection method of ARMS-ddPCR point mutation | |
| CN109536588A (en) | Detect the method and device of the FFPE sample state of oxidation | |
| CN111477277A (en) | Sample quality evaluation method and device | |
| CN109321651A (en) | A kind of composition, kit, sample treatment and application detecting people CYP2D6 gene pleiomorphism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190329 |
|
| RJ01 | Rejection of invention patent application after publication |