CN109517747B - Yellow wine yeast suitable for rapamycin-mediated regulation and control of protein subcellular localization - Google Patents

Abstract

The invention discloses yellow wine yeast suitable for rapamycin mediated regulation protein subcellular localization, and belongs to the field of genetic engineering. The invention takes yellow wine yeast XZ-11(MATa, delta ura3, delta trp1) as an initial strain, and blocks the combination of rapamycin and an endogenous gene FPR1 coding product by knocking out a rapamycin binding subunit coding gene FPR 1. Meanwhile, the 1972 serine residue of the TOR1 gene is mutated into arginine, so that the growth of the strain is not inhibited by rapamycin. The recombinant strain JNZ01(MATa, delta ura3, delta trp1, TOR1S1972R and delta fpr1) constructed in the method grows well in a culture medium containing 1 mu g/mL, 5 mu g/mL and 10 mu g/mL of rapamycin, and provides a basis for applying the subunit localization of the rapamycin-mediated regulatory protein.

Description

Yellow wine yeast suitable for rapamycin-mediated regulation and control of protein subcellular localization

Technical Field

The invention relates to yellow wine yeast suitable for rapamycin mediated regulation protein subcellular localization, and belongs to the field of genetic engineering.

Background

In eukaryotic cells, many proteins need to function in specific subcellular cells. For example, global regulators of the repression of nitrogen metabolism require entry into the nucleus in order to exert their transcriptional activation or repression of the expression of the gene of interest. In addition, in the field of metabolic engineering, the subcellular localization of specific protein is regulated and controlled to be in a better cell microenvironment, so that the method has an important influence on the improvement of the production performance of the strain. For example, anchoring Ehrlich pathway proteins to mitochondria can increase isobutanol production by 260%, etc. Therefore, there is a need for a reliable system to achieve the regulation of protein subcellular localization in yeast cells.

Small molecule mediated protein dimerization is an effective means to achieve regulation of protein subcellular localization, including rapamycin mediated protein dimerization. In the presence of rapamycin, the FK506 binding protein (FKBP12) binds to rapamycin, forming the FKBP 12-rapamycin complex. On this basis, the FKBP 12-rapamycin complex can bind to the FRB subunit of mammalian cell mTor, causing protein dimerization. Based on this, by fusing FKBP12 with a target protein and FRB with an anchoring protein known to be located in a specific organelle, a target protein-FKBP 12-FRB-anchoring protein complex is formed under the condition of adding rapamycin, and finally the target protein is located in the specific organelle under the action of the anchoring protein. However, due to the existence of the endogenous gene FPR1 encoding FKBP12 in Saccharomyces cerevisiae, the gene can competitively bind rapamycin, and the working efficiency of the subcellular localization and regulation system is reduced. In addition, the TOR1 gene coding product in the saccharomyces cerevisiae is an action target point of rapamycin, and the growth of the saccharomyces cerevisiae can be greatly inhibited under the condition of adding the rapamycin, so that the application of a protein subcellular localization and regulation system based on the rapamycin in saccharomyces cerevisiae cells is limited. Therefore, there is a need to construct a platform strain of saccharomyces cerevisiae that is not competitive for endogenous proteins binding to rapamycin and is insensitive to rapamycin.

Disclosure of Invention

The first purpose of the invention is to provide a construction method of yellow wine yeast, which comprises knocking out FPR1 gene and mutating 1972 th serine residue of protein coded by TOR1 gene.

In one embodiment of the invention, the FPR1 gene is knocked out to eliminate competitive inhibition of rapamycin by the endogenous protein of saccharomyces cerevisiae.

In one embodiment of the present invention, the mutant TOR1 gene encodes a protein wherein the 1972 th serine residue is arginine which abrogates the inhibition of growth of the strain of Saccharomyces cerevisiae by rapamycin.

In one embodiment of the invention, the FPR1 gene is knocked out and the TOR1 gene is point mutated simultaneously by the CRISPR-Cas9 system.

In one embodiment of the invention, the CRISPR-Cas9 system includes, but is not limited to, p414-TEF1p-Cas9-CYC1t, pRS426-Tor1sgRNA-Fpr1sgRNA-URA 3.

In one embodiment of the present invention, the method specifically comprises the following steps: (1) introducing a sgRNA expression element by taking pRS426-URA3 as a starting plasmid, and respectively positioning the sgRNA expression element on a 20nt sequence of an FPR1 site and a 20nt sequence of a TOR1 site to obtain a plasmid pRS426-TOR1sgRNA-Fpr1sgRNA-URA 3; (2) constructing a knockout frame for knocking out the FPR1 gene and a recombination frame for mutating the TOR1 gene respectively; transferring a plasmid p414-TEF1p-Cas9-CYC1t (Addgene number 43802) into a yellow wine yeast XZ-11(MATa, delta ura3, delta trp1) serving as a starting strain; (3) transferring the plasmid pRS426-Tor1sgRNA-Fpr1sgRNA-URA3, the FPR1 gene knockout frame and the TOR1 gene mutation recombination frame into an original strain with p414-TEF1p-Cas9-CYC1 t; positive transformants were selected.

The second purpose of the invention is to provide yellow wine yeast which is suitable for rapamycin mediated regulation protein subcellular localization and is prepared according to any one of the methods.

In one embodiment of the present invention, the yellow wine yeast is a haploid yeast, including but not limited to yellow wine yeast N85, saccharomyces cerevisiae model bacteria S288 c.

In one embodiment of the invention, the yellow wine yeast takes XZ-11 as a starting strain.

The invention also claims the application of the yellow wine yeast in reducing urea or EC in the food field.

Has the advantages that: the construction method of the yellow wine yeast strain suitable for the sub-cellular location of the rapamycin mediated regulatory protein is simple, convenient and convenient, is convenient to use, and does not need to introduce exogenous genetic markers compared with the prior art. Finally, the obtained recombinant yellow wine yeast strain JNZ01 grows well in a culture medium containing 1 mug/mL, 5 mug/mL and 10 mug/mL of rapamycin, and can be used for rapamycin mediated regulation and control protein subcellular localization and regulation and control of transcription factor transportation to the inside and outside of a cell nucleus.

Drawings

FIG. 1 shows the result of dot-panel detection of recombinant yellow wine yeast JNZ01 rapamycin tolerance; wherein XZ-11 is wild strain; JNZ-01 is the strain constructed by the invention.

Detailed Description

Example 1 resolution of diploid s.cerevisiae strains XZ-11 for yellow wine production to obtain haploid strains

Haploid XZ-11a strains that do not contain a resistance gene are obtained by the methods and procedures described in the articles "Wu D H, Li X M, Shen C, et al.

Example 2 construction of auxotrophic haploid yellow wine Yeast JNZ00

Yellow wine yeast XZ-11 strain genome is taken as a template, 300bp sequences of the upstream and downstream of URA3 gene are respectively amplified, and the two amplified fragments are fused by fusion PCR to obtain a URA3 gene knockout frame. The strain XZ-11a is transformed by the URA3 knockout box, and screened on a 5-FOA plate (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, uracil 25mg/L, 5-FOA 1g/L, agar powder 20g/L) to obtain the uracil auxotrophic strain XZ-11a-URA 3. Yellow wine yeast XZ-11 strain genome is taken as a template, 300bp sequences of the upstream and downstream of TRP1 gene are respectively amplified, and the two amplified fragments are fused by fusion PCR to obtain TRP1 gene knockout frame. The strain XZ-11a-ura3 was transformed by removing the TRP1 knockout cassette, and screened on a 5-FAA plate (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, uracil 25mg/L, tryptophan 25mg/L, 5-FAA 1g/L, agar powder 20g/L) to obtain uracil and tryptophan double auxotrophic strain JNZ00 (MATa. DELTA. ura3,. DELTA. TRP 1).

Example 3 construction of pRS426-Tor1sgRNA-Fpr1sgRNA-URA3 plasmid

The 20nt sequences required for editing the FPR1 and TOR1 sites on the genome using the CRISPR-Cas9 system (FPR 1: TTGGTTACCATTCATTACAC; TOR 1: TGTTATGTTCAACGAAAAAT) were first designed based on Yeast (http:// Yeastriction. tnw. tudelft. nl/# |). Plasmid p426-SNR52p-gRNA. CAN1.Y-SUP4t (Addgene No. 43803) is used as a template, Fpr1sgRNA and Tor1sgRNA coding frames are respectively obtained through fusion PCR, and 20nt sequences originally positioned at a CAN1 site are respectively replaced by 20nt sequences positioned at FPR1 and TOR 1. Fpr1sgRNA and Tor1sgRNA were cloned into Kpn I and Xho I, Spe I and Sac I sites of the plasmid pRS426-URA3 by enzymatic ligation, respectively, to give a plasmid pRS426-Fpr1sgRNA-Tor1sgRNA-URA 3.

Example 4 construction of FPR1 Gene knockout cassette and TOR1 Gene Point mutation recombination cassette

And respectively amplifying 200bp fragments of the upstream and downstream of the FPR1 gene by taking the genome as a template, and obtaining a knockout frame of the FPR1 gene by fusion PCR. Respectively amplifying sequences between 5801-5923 bp and 5911-6000 bp of TOR1 genes by taking a genome as a template, mutating a sequence in a 5914-5919 bp region from an original AGCCGC to CGTCGA in a primer, mutating serine at a 1972 position to arginine, and simultaneously introducing a synonymous mutation at the 1973 position to generate a Sal I enzyme cutting site. The two fragments were fused into TOR1 gene point mutation recombination boxes by fusion PCR.

Example 5 CRISPR-Cas9 System one-step knockout of FPR1 Gene and Point mutation TOR1 Gene

The plasmid p414-TEF1p-Cas9-CYC1t (Addgene number 43802) is transformed into the starting strain yellow wine yeast XZ-11, and positive transformants are screened on an SC-trp1 plate (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, uracil 25mg/L, agar powder 20 g/L). Plasmid p426-Fpr1sgRNA-Tor1sgRNA-URA3, FPR1 gene knockout frame and TOR1 gene point mutation recombination frame are transformed into starting bacteria with p414-TEF1p-Cas9-CYC1t plasmid, and the starting bacteria are screened on SC plates (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L and agar powder 20 g/L). Recombinant bacteria which knock out FPR1 gene and mutate TOR1 gene simultaneously are screened by colony PCR to obtain positive transformant JNZ0(MATa, delta URA3, delta trp1, TOR1S1972R, delta FPR1, p426-Fpr1sgRNA-TOR1sgRNA-URA3, p414-TEF1p-Cas9-CYC1 t).

Example 6 Elimination of CRISPR-Cas9 System plasmid

The positive transformants obtained by selection were subcultured in YPD medium (yeast extract 10g/L, peptone 20g/L, glucose 20g/L) and transferred to fresh YPD medium at an inoculum size of 10% after each 24h of culture. Each transfer was performed while streaking plates containing 5-FOA and 5-FAA (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, uracil 25mg/L, tryptophan 25mg/L, 5-FOA 1g/L, 5-FAA 1g/L, agar powder 20g/L) until transformants were obtained on the plates containing 5-FOA and 5-FAA. The transformants were verified by colony PCR that p426-Fpr1sgRNA-Tor1sgRNA-URA3 and p414-TEF1p-Cas9-CYC1t had been eliminated, resulting in recombinant yellow wine yeast JNZ01(MATa, Δ URA3, Δ trp1, TOR1S1972R, Δ Fpr 1).

Example 7 Spot testing of recombinant yellow wine Yeast JNZ01 rapamycin tolerance

The recombinant yellow wine yeast JNZ01 and the starting yellow wine yeast XZ-11 (industrial production strains) are respectively inoculated in YPD culture medium, cultured at 30 ℃ and 220rpm for 18h, centrifuged to collect thalli, and washed twice by normal saline. Gradient dilution to OD₆₀₀＝10⁰、10^-1、10^-2、10^-3、10^-4. Separately, 3. mu.L of each of the above-described bacterial cells was spotted on YPD plates (yeast extract 10g/L, peptone 20g/L, glucose 20g/L, agarose 20g/L, rapamycin 0, 1, 5, 10. mu.g/mL) having different rapamycin concentrations, and cultured at 30 ℃ for 48 hours to observe the growth of the cells. As shown in FIG. 1, the starting yellow wine yeast XZ-11 hardly grew on the rapamycin plate of 1. mu.g/mL, while the recombinant yellow wine yeast JNZ01 grew normally on the rapamycin plate of 0, 1, 5 or 10. mu.g/mL.

Example 8 modulation of transcriptional activators GLN3 and GAT1 to reduce Urea accumulation in yellow wine Yeast

(1) Fusion PCR construction fusion expression of recombinant frames GLN3, FKBP12, GAT1 and FKBP12

First (GGGGS) by whole plasmid PCR₃After the linker was introduced into the BamH I site of the high copy plasmid vector pRS426-TEF-URA3, pRS426-TEF-GS-URA3 was obtained. Obtaining FKBP12 protein fused with 4 SV40 nuclear localization sequences at the N end by gene synthesis, cloning to EcoR I and Xho I sites of a vector pRS426-TEF-GS-URA3 by enzyme digestion connection to obtain pRS426-TEF-GS-SV40-FKBP12-URA 3. 500bp sequences without stop codons at the ends of GLN3 and GAT1 were amplified from the genome, and cloned into Spe I and BamH I sites of vectors pRS426-TEF-GS-SV40-FKBP12-URA3 by enzymatic ligation, respectively, to give pRS426-TEF-Gln3D-GS-SV40-FKBP12-URA3 and pRS426-TEF-Gat1D-GS-SV40-FKBP12-URA 3. Then, the obtained plasmid is used as a template to carry out PCR amplification, and a fusion expression GLN3, an FKBP12 recombination frame and GAT1, an FKBP12 recombination frame are respectively obtained by introducing GLN3 and GAT1 downstream 50bp sequences into an upstream primer.

(2) Integrating and fusing GLN3, FKBP12, GAT1 and FKBP12 recombinant frames on recombinant yellow wine yeast JNZ01 genome through CRISPR-Cas9 system

The 20nt sequences required for editing GLN3 and GAT1 sites on the genome using the CRISPR-Cas9 system were first designed based on Yeast (http:// Yeastriction. tnw. tudelft. nl/# |) (GLN3: ATAATGATAATGATAATACG; GAT1: AATTCAGATTCAACCAATCC). Plasmid p426-SNR52p-gRNA. CAN1.Y-SUP4t (Addgene number 43803) is used as a template, and 20nt sequence replaces 20nt sequence positioned at CAN1 site on original plasmid by whole plasmid PCR to respectively obtain p426-Gln3sgRNA and p426-Gat1 sgRNA. The plasmid p414-TEF1p-Cas9-CYC1t (Addgene number 43802) is transformed into recombinant yellow wine yeast JNZ01, and positive transformants are screened on an SC-trp1 plate (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, uracil 25mg/L and agar powder 20g/L) to obtain a strain JNZ01-Cas 9. The strain JNZ01-Cas9 was transformed with plasmid p426-Gln3sgRNA and recombinant frames of fusion expression GLN3 and FKBP12, and screened on SC plates (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, agar powder 20 g/L). Positive transformants expressing the integration of the fusion GLN3, FKBP12 recombination cassette into the genome were screened by colony PCR. The strain JNZ01-Cas9 was transformed with plasmid p426-Gat1sgRNA together with recombinant cassettes for fusion expression GAT1 and FKBP12, and screened on SC plates (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, agar powder 20 g/L). Positive transformants expressing the integration of the GAT1, FKBP12 fusion cassette into the genome were screened by colony PCR.

(3) Plasmid for eliminating CRISPR-Cas9 system

The positive transformants obtained by selection were subcultured in YPD medium (yeast extract 10g/L, peptone 20g/L, glucose 20g/L) and transferred to fresh YPD medium at an inoculum size of 10% after each 24h of culture. While each transfer was performed, the 5-FOA and 5-FAA plates (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, uracil 25mg/L, tryptophan 25mg/L, 5-FOA 1g/L, 5-FAA 1g/L, agar powder 20g/L) were streaked, respectively, until transformants were obtained on the 5-FOA and 5-FAA plates. The transformants were verified by colony PCR that p426-Gln3sgRNA, p426-Gat1sgRNA and p414-TEF1p-Cas9-CYC1t had been eliminated, yielding recombinant yellow wine yeasts JNZ02(MATa, Δ ura3, Δ trp1, TOR1S1972R, Δ fpr1, GLN3:: FKBP12) and JNZ03(MATa, Δ ura3, Δ trp1, TOR1S1972R, Δ fpr1, GAT1:: FKBP 12).

(4) Fusion expression of SPT15 and FRB

FRB with 4 SV40 nuclear localization sequences fused at the N end is obtained through gene synthesis, and is cloned to EcoR I and Xho I sites of a vector pRS426-TEF-GS-URA3 through enzyme digestion connection to obtain pRS426-TEF-GS-SV40-FRB-URA 3. The SPT15 gene sequence without a stop codon is obtained by amplification from the genome of recombinant yellow wine yeast JNZ01(MATa, delta URA3, delta trp1, TOR1S1972R and delta fpr1), and is cloned to Spe I and BamH I sites of a vector pRS426-TEF-GS-SV40-FRB-URA3 through enzyme digestion connection to obtain pRS426-TEF-Spt15-GS-SV40-FRB-URA 3. Plasmid pRS426-TEF-Spt15-GS-SV40-FRB-URA3 was transformed into recombinant yellow wine yeast JNZ02 and JNZ03, respectively, and positive transformants were selected on SC-URA3 medium (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, tryptophan 25mg/L, agar powder 20g/L) to obtain recombinant yellow wine yeast JNZ04(MATa, Δ URA3, Δ trp1, TOR1S1972R, Δ fpr1, GLN3:: FKBP12, pRS426-TEF-Spt15-FRB-URA3) and JNZ05(MATa, Δ URA3, Δ trp1, TOR1S1972R, Δ fpr1, GAT 2:: BP 56, pRS 82FKS-Spt 86426-15).

(5) Application of JNZ04 and JNZ05 strains in fermentation for reducing urea accumulation in fermentation liquor

Fermentation was carried out in a fermentation medium (YNB 1.7g/L, ammonium sulfate 5g/L, glucose 20g/L, 5g/L of each of the 20 essential amino acids, urea 5g/L, rapamycin 1. mu.g/mL) using JNZ04, JNZ05 and JNZ 01. After culturing for 48h at 30 ℃ and 220rpm, detecting the urea content in the fermentation liquor by using high performance liquid chromatography. After Gln3 or Gat1 is finally regulated and controlled to be positioned in cell nucleus, the urea content in the fermentation liquid is respectively reduced to 8.25mg/L and 9.95mg/L, which are respectively reduced by 49.45 percent and 38.98 percent compared with the original bacteria. The detection method is the same as that in the paper Zhang W, Cheng Y, Li Y, et al, adaptive evaluation methods both expressed and analyzed results area amplification in cultures of the Chinese line year strain Saccharomyces cerevisiae XZ-11[ J ]. J agricultural Food Chem,2018,66(34):9061-9069.

(6) Application of JNZ04 and JNZ05 strains in yellow wine simulated fermentation system for reducing urea

Yellow wine simulated fermentation is carried out by JNZ04, JNZ05 and JNZ 01. Soaking 100g of glutinous rice at room temperature for 2-3 days; after cooking at normal pressure, 17.4g of wheat koji (13.5 g of raw wheat koji and 3.4g of cooked wheat koji) and 170g of water were added, and the activated strains of JNZ04, JNZ05 and JNZ01 were inoculated in an inoculum size of 10% (v/v), and rapamycin was added to a final concentration of 1. mu.g/mL. And adding a fermentation plug into a shake flask, standing at 30 ℃ for fermentation, weighing every day, and finishing the primary fermentation when the daily weight loss is less than 2 g. Placing the shake flask at 15 deg.C, standing for fermentation, and finishing after 15 days. The urea content in the fermentation system is detected, and the result shows that after Gln3 or Gat1 is regulated and controlled to be positioned in cell nucleus, the urea content in the fermentation system is respectively reduced to 7.32mg/L and 8.97mg/L, and is respectively reduced by 45.33 percent and 33.01 percent compared with the original bacteria.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> yellow wine yeast suitable for rapamycin mediated regulation protein subcellular localization

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

ttggttacca ttcattacac 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

tgttatgttc aacgaaaaat 20

<210> 3

<211> 15

<212> PRT

<213> Artificial sequence

<400> 3

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

ataatgataa tgataatacg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

aattcagatt caaccaatcc 20

Claims (2)

1. A method for constructing yellow wine yeast with reduced urea accumulation capacity is characterized in that yellow wine yeast XZ-11 is used as an initial strain, MATa is carried out,Δura3，Δtrp1，TOR1 S1972R，Δfpr1constructing recombinant yellow wine yeast JNZ 01; the genome of yellow wine yeast JNZ01 is fused and expressed with GLN3, FKBP12 or GAT1 and FKBP12, and the fusion expression is carried out on a plasmidSPT15FRB; simultaneous pairing by CRISPR-Cas9 systemFPR1Knock out the gene andTOR1carrying out point mutation on the gene; the CRISPR-Cas9 system includes but is not limited to p414-TEF1p-Cas9-CYC1t, pRS 426-Torr 1sgRNA-Fpr1sgRNA-URA 3.

2. The method according to claim 1, characterized by the following specific steps: (1) pRS426-URA3 are used as starting plasmids, sgRNA expression elements are introduced and positioned on the starting plasmids respectivelyFPR120nt sequence of site andTOR1obtaining a 20nt sequence of the locus, and obtaining a plasmid pRS426-Tor1sgRNA-Fpr1sgRNA-URA 3; (2) constructed separately for knock-outFPR1Knock-out frames of genes and methods for mutagenesisTOR1A recombination frame for the gene; transferring the plasmid p414-TEF1p-Cas9-CYC1t into yellow wine yeast XZ-11; (3) plasmid pRS426-Tor1sgRNA-Fpr1sgRNA-URA3, FPR1 knockout cassette andTOR1the gene mutation recombination frames are transferred into an original strain with p414-TEF1p-Cas9-CYC1 t; positive transformants were selected.

Images